Targeting Fatty Acid Amide Hydrolase Counteracts the Epithelial-to-Mesenchymal Transition in Keratinocyte-Derived Tumors
Abstract
:1. Introduction
2. Results
2.1. Inhibition of FAAH Induced by URB597 Downregulates Proliferative Capacity and Increases Anandamide Levels in Primary Keratinocytes
2.2. URB597 Contrasts the IGF-1-Induced EMT Process by Regulating Vimentin Expression, E-Cadherin Localization, and Cytokine Release–Involvement of AKT/STAT3 Signaling Pathway
2.3. URB597 Contrasts the TNF-α-Induced EMT Process by Modulating E-Cadherin Localization and by Promoting Keratinocyte Differentiation
2.4. URB597 Reduces the Proliferative and Migratory Potential and Counteracts the EMT Process in the A431 Squamous Carcinoma Cell Line
2.5. URB597 Modulates the Profile of Pro-Tumorigenic Lipid Species in A431 Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Cell Cultures, Ex Vivo Skin Explants, and Treatments
4.2. Neutral Red Assay
4.3. Immunofluorescence Analysis
4.4. Immunohistochemical Analysis
4.5. Western Blot Analysis
4.6. Protein Determination Using Sandwich Enzyme-Linked Immunosorbent Assay (ELISA)
4.7. RNA Extraction and Real-Time RT-PCR
4.8. Scratch Assay
4.9. Lipid Extraction
4.10. AEA High-Performance Liquid Chromatography/Mass Spectrometry
4.11. Assessment of Pro-Inflammatory Lipid Mediators by High-Performance Liquid Chromatography/Mass Spectrometry
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Devane, W.A.; Hanus, L.; Breuer, A.; Pertwee, R.G.; Stevenson, L.A.; Griffin, G.; Gibson, D.; Mandelbaum, A.; Etinger, A.; Mechoulam, R. Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science 1992, 258, 1946–1949. [Google Scholar] [CrossRef] [PubMed]
- Sugiura, T.; Kondo, S.; Sukagawa, A.; Nakane, S.; Shinoda, A.; Itoh, K.; Yamashita, A.; Waku, K. 2-Arachidonoylglycerol: A possible endogenous cannabinoid receptor ligand in brain. Biochem. Biophys. Res. Commun. 1995, 215, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Karwad, M.A.; Macpherson, T.; Wang, B.; Theophilidou, E.; Sarmad, S.; Barrett, D.A.; Larvin, M.; Wright, K.L.; Lund, J.N.; O’Sullivan, S.E. Oleoylethanolamine and palmitoylethanolamine modulate intestinal permeability in vitro via TRPV1 and PPARα. FASEB J. 2017, 31, 469–481. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, L.A.; Lolait, S.J.; Brownstein, M.J.; Young, A.C.; Bonner, T.I. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 1990, 346, 561–564. [Google Scholar] [CrossRef] [PubMed]
- Munro, S.; Thomas, K.L.; Abu-Shaar, M. Molecular characterization of a peripheral receptor for cannabinoids. Nature 1993, 365, 61–65. [Google Scholar] [CrossRef] [PubMed]
- Iozzo, M.; Sgrignani, G.; Comito, G.; Chiarugi, P.; Giannoni, E. Endocannabinoid System and Tumour Microenvironment: New Intertwined Connections for Anticancer Approaches. Cells 2021, 10, 3396. [Google Scholar] [CrossRef]
- Pacher, P.; Bátkai, S.; Kunos, G. The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacol. Rev. 2006, 58, 389–462. [Google Scholar] [CrossRef]
- Di Marzo, V. Targeting the endocannabinoid system: To enhance or reduce? Nat. Rev. Drug Discov. 2008, 7, 438–455. [Google Scholar] [CrossRef]
- Stasiulewicz, A.; Znajdek, K.; Grudzień, M.; Pawiński, T.; Sulkowska, A.J.I. A Guide to Targeting the Endocannabinoid System in Drug Design. Int. J. Mol. Sci. 2020, 21, 2778. [Google Scholar] [CrossRef]
- Guindon, J.; Guijarro, A.; Piomelli, D.; Hohmann, A.G. Peripheral antinociceptive effects of inhibitors of monoacylglycerol lipase in a rat model of inflammatory pain. Br. J. Pharmacol. 2011, 163, 1464–1478. [Google Scholar] [CrossRef]
- Pisanti, S.; Picardi, P.; D’Alessandro, A.; Laezza, C.; Bifulco, M. The endocannabinoid signaling system in cancer. Trends Pharmacol. Sci. 2013, 34, 273–282. [Google Scholar] [CrossRef] [PubMed]
- Braile, M.; Marcella, S.; Marone, G.; Galdiero, M.R.; Varricchi, G.; Loffredo, S. The Interplay between the Immune and the Endocannabinoid Systems in Cancer. Cells 2021, 10, 1282. [Google Scholar] [CrossRef] [PubMed]
- Bifulco, M.; Di Marzo, V. Targeting the endocannabinoid system in cancer therapy: A call for further research. Nat. Med. 2022, 8, 547–550. [Google Scholar] [CrossRef] [PubMed]
- Pisanti, S.; Bifulco, M. Endocannabinoid system modulation in cancer biology and therapy. Pharmacol. Res. 2009, 60, 107–116. [Google Scholar] [CrossRef]
- Velasco, G.; Sánchez, C.; Guzmán, M. Towards the use of cannabinoids as antitumour agents. Nat. Rev. Cancer 2012, 12, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Ramer, R.; Hinz, B. Cannabinoids as Anticancer Drugs. Adv. Pharmacol. 2017, 80, 397–436. [Google Scholar] [CrossRef] [PubMed]
- Ramer, R.; Schwarz, R.; Hinz, B. Modulation of the Endocannabinoid System as a Potential Anticancer Strategy. Front. Pharmacol. 2019, 10, 430. [Google Scholar] [CrossRef] [PubMed]
- Pagano, C.; Navarra, G.; Coppola, L.; Bifulco, M.; Laezza, C. Molecular Mechanism of Cannabinoids in Cancer Progression. Int. J. Mol. Sci. 2021, 22, 3680. [Google Scholar] [CrossRef]
- Tóth, K.F.; Ádám, D.; Bíró, T.; Oláh, A. Cannabinoid Signaling in the Skin: Therapeutic Potential of the “C(ut)annabinoid” System. Molecules 2019, 24, 918. [Google Scholar] [CrossRef]
- Soliman, E.; Van Dross, R. Anandamide-induced endoplasmic reticulum stress and apoptosis are mediated by oxidative stress in non-melanoma skin cancer: Receptor-independent endocannabinoid signaling. Mol. Carcinog. 2016, 55, 1807–1821. [Google Scholar] [CrossRef]
- Soliman, E.; Henderson, K.L.; Danell, A.S.; Van Dross, R. Arachidonoyl-ethanolamide activates endoplasmic reticulum stress-apoptosis in tumorigenic keratinocytes: Role of cyclooxygenase-2 and novel J-series prostamides. Mol. Carcinog. 2016, 55, 117–130. [Google Scholar] [CrossRef] [PubMed]
- Blázquez, C.; Carracedo, A.; Barrado, L.; Real, P.J.; Fernández-Luna, J.L.; Velasco, G.; Malumbres, M.; Guzmán, M. Cannabinoid receptors as novel targets for the treatment of melanoma. FASEB J. 2006, 20, 2633–2635. [Google Scholar] [CrossRef] [PubMed]
- Ligresti, A.; Moriello, A.S.; Starowicz, K.; Matias, I.; Pisanti, S.; De Petrocellis, L.; Laezza, C.; Portella, G.; Bifulco, M.; Di Marzo, V. Antitumor activity of plant cannabinoids with emphasis on the effect of cannabidiol on human breast carcinoma. J. Pharmacol. Exp. Ther. 2006, 318, 1375–1387. [Google Scholar] [CrossRef] [PubMed]
- Casanova, M.L.; Blázquez, C.; Martínez-Palacio, J.; Villanueva, C.; Fernández-Aceñero, M.J.; Huffman, J.W.; Jorcano, J.L.; Guzmán, M. Inhibition of skin tumor growth and angiogenesis in vivo by activation of cannabinoid receptors. J. Clin. Investig. 2003, 111, 43–50, PMCID:PMC151833. [Google Scholar] [CrossRef] [PubMed]
- Guzmán, M. Cannabinoids: Potential anticancer agents. Nat. Rev. Cancer 2003, 3, 745–755. [Google Scholar] [CrossRef] [PubMed]
- Van Dross, R.T. Metabolism of anandamide by COX-2 is necessary for endocannabinoid-induced cell death in tumorigenic keratinocytes. Mol. Carcinog. 2009, 48, 724–732. [Google Scholar] [CrossRef]
- Ratushny, V.; Gober, M.D.; Hick, R.; Ridky, T.W.; Seykora, J.T. From keratinocyte to cancer: The pathogenesis and modeling of cutaneous squamous cell carcinoma. J. Clin. Investig. 2012, 122, 464–472. [Google Scholar] [CrossRef]
- Nehal, K.S.; Bichakjian, C.K. Update on Keratinocyte Carcinomas. N. Engl. J. Med. 2018, 379, 363–374. [Google Scholar] [CrossRef]
- Ramer, R.; Wendt, F.; Wittig, F.; Schäfer, M.; Boeckmann, L.; Emmert, S.; Hinz, B. Impact of Cannabinoid Compounds on Skin Cancer. Cancers 2022, 14, 1769, PMCID:PMC8997154. [Google Scholar] [CrossRef] [PubMed]
- Toll, A.; Masferrer, E.; Hernández-Ruiz, M.E.; Ferrandiz-Pulido, C.; Yébenes, M.; Jaka, A.; Tuneu, A.; Jucglà, A.; Gimeno, J.; Baró, T.; et al. Epithelial to mesenchymal transition markers are associated with an increased metastatic risk in primary cutaneous squamous cell carcinomas but are attenuated in lymph node metastases. J. Dermatol. Sci. 2013, 72, 93–102. [Google Scholar] [CrossRef] [PubMed]
- Brougham, N.D.; Dennett, E.R.; Cameron, R.; Tan, S.T. The incidence of metastasis from cutaneous squamous cell carcinoma and the impact of its risk factors. J. Surg. Oncol. 2012, 106, 811–815. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Gómez, E.; Andradas, C.; Flores, J.M.; Quintanilla, M.; Paramio, J.M.; Guzmán, M.; Sánchez, C. The orphan receptor GPR55 drives skin carcinogenesis and is upregulated in human squamous cell carcinomas. Oncogene 2013, 32, 2534–2542. [Google Scholar] [CrossRef] [PubMed]
- Kuc, C.; Jenkins, A.; Van Dross, R.T. Arachidonoyl ethanolamide (AEA)-induced apoptosis is mediated by J-series prostaglandins and is enhanced by fatty acid amide hydrolase (FAAH) blockade. Mol. Carcinog. 2012, 51, 139–149. [Google Scholar] [CrossRef] [PubMed]
- Park, S.W.; Kim, J.E.; Oh, S.M.; Cha, W.J.; Hah, J.H.; Sung, M.W. Anticancer effects of anandamide on head and neck squamous cell carcinoma cells via the production of receptor-independent reactive oxygen species. Head Neck 2015, 37, 1187–1192. [Google Scholar] [CrossRef] [PubMed]
- Go, Y.Y.; Kim, S.R.; Kim, D.Y.; Chae, S.W.; Song, J.J. Cannabidiol enhances cytotoxicity of anti-cancer drugs in human head and neck squamous cell carcinoma. Sci. Rep. 2020, 10, 20622. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Ng, A.S.; Cai, S.; Li, Q.; Yang, L.; Kerr, D. Novel therapeutic strategies: Targeting epithelial-mesenchymal transition in colorectal cancer. Lancet Oncol. 2021, 22, e358–e368. [Google Scholar] [CrossRef] [PubMed]
- Hesse, K.; Satzger, I.; Schacht, V.; Köther, B.; Hillen, U.; Klode, J.; Schaper, K.; Gutzmer, R. Characterisation of Prognosis and Invasion of Cutaneous Squamous Cell Carcinoma by Podoplanin and E-Cadherin Expression. Dermatology 2016, 232, 558–565. [Google Scholar] [CrossRef] [PubMed]
- De Craene, B.; Berx, G. Regulatory networks defining EMT during cancer initiation and progression. Nat. Rev. Cancer 2013, 13, 97–110. [Google Scholar] [CrossRef]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef]
- Janda, E.; Lehmann, K.; Killisch, I.; Jechlinger, M.; Herzig, M.; Downward, J.; Beug, H.; Grünert, S. Ras and TGF[beta] cooperatively regulate epithelial cell plasticity and metastasis: Dissection of Ras signaling pathways. J. Cell Biol. 2002, 156, 299–313, PMCID:PMC2199233. [Google Scholar] [CrossRef] [PubMed]
- Bachelder, R.E.; Yoon, S.O.; Franci, C.; de Herreros, A.G.; Mercurio, A.M. Glycogen synthase kinase-3 is an endogenous inhibitor of Snail transcription: Implications for the epithelial-mesenchymal transition. J. Cell Biol. 2005, 168, 29–33. [Google Scholar] [CrossRef] [PubMed]
- Eger, A.; Stockinger, A.; Schaffhauser, B.; Beug, H.; Foisner, R. Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear translocation of beta-catenin and upregulation of beta-catenin/lymphoid enhancer binding factor-1 transcriptional activity. J. Cell Biol. 2000, 148, 173–188. [Google Scholar] [CrossRef] [PubMed]
- Sou, P.W.; Delic, N.C.; Halliday, G.M.; Lyons, J.G. Snail transcription factors in keratinocytes: Enough to make your skin crawl. Int. J. Biochem. Cell Biol. 2010, 42, 1940–1944. [Google Scholar] [CrossRef] [PubMed]
- Heldin, C.H.; Moustakas, A. Role of Smads in TGFβ signaling. Cell Tissue Res. 2012, 347, 21–36. [Google Scholar] [CrossRef] [PubMed]
- Vincent, T.; Neve, E.P.; Johnson, J.R.; Kukalev, A.; Rojo, F.; Albanell, J.; Pietras, K.; Virtanen, I.; Philipson, L.; Leopold, P.L.; et al. A SNAIL1-SMAD3/4 transcriptional repressor complex promotes TGF-beta mediated epithelial-mesenchymal transition. Nat. Cell Biol. 2009, 11, 943–950, PMCID:PMC3769970. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Ren, G.; Wang, T.; Chen, Y.; Gong, C.; Bai, Y.; Wang, B.; Qi, H.; Shen, J.; Zhu, L.; et al. Aberrantly expressed Fra-1 by IL-6/STAT3 transactivation promotes colorectal cancer aggressiveness through epithelial-mesenchymal transition. Carcinogenesis 2015, 36, 459–468, PMCID:PMC4392608. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.; Kumar, B.; Datta, J.; Teknos, T.N.; Kumar, P. IL-6 promotes head and neck tumor metastasis by inducing epithelial-mesenchymal transition via the JAK-STAT3-SNAIL signaling pathway. Mol. Cancer Res. 2011, 9, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Zhang, F.; Niu, R. Multiple regulation pathways and pivotal biological functions of STAT3 in cancer. Sci. Rep. 2015, 5, 17663. [Google Scholar] [CrossRef]
- Chen, K.S.; Carbajal, S.; Kiguchi, K.; Clifford, J.; Sano, S.; DiGiovanni, J. Epidermal growth factor receptor-mediated activation of Stat3 during multistage skin carcinogenesis. Cancer Res. 2004, 64, 2382–2389. [Google Scholar] [CrossRef]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef]
- Scanlon, C.S.; Van Tubergen, E.A.; Inglehart, R.C.; D’Silva, N.J. Biomarkers of epithelial-mesenchymal transition in squamous cell carcinoma. J. Dent. Res. 2013, 92, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Usman, S.; Waseem, N.H.; Nguyen, T.K.N.; Mohsin, S.; Jamal, A.; Teh, M.T.; Waseem, A. Vimentin Is at the Heart of Epithelial Mesenchymal Transition (EMT) Mediated Metastasis. Cancers 2021, 13, 4985, PMCID:PMC8507690. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Y.; Lin, H.H.; Tang, M.J.; Wang, Y.K. Vimentin contributes to epithelial-mesenchymal transition cancer cell mechanics by mediating cytoskeletal organization and focal adhesion maturation. Oncotarget 2015, 6, 15966–15983. [Google Scholar] [CrossRef] [PubMed]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428, Erratum in: J. Clin. Investig. 2010, 120, 1786. [Google Scholar] [CrossRef] [PubMed]
- Roche, J. The Epithelial-to-Mesenchymal Transition in Cancer. Cancers 2018, 10, 52, Erratum in: Cancers 2018, 10, 79. [Google Scholar] [CrossRef]
- Che, D.; Zhang, S.; Jing, Z.; Shang, L.; Jin, S.; Liu, F.; Shen, J.; Li, Y.; Hu, J.; Meng, Q.; et al. Macrophages induce EMT to promote invasion of lung cancer cells through the IL-6-mediated COX-2/PGE2/β-catenin signalling pathway. Mol. Immunol. 2017, 90, 197–210, Erratum in: Mol. Immunol. 2020, 126, 165–166. [Google Scholar] [CrossRef] [PubMed]
- Brunetti, L.; Loiodice, F.; Piemontese, L.; Tortorella, P.; Laghezza, A. New Approaches to Cancer Therapy: Combining Fatty Acid Amide Hydrolase (FAAH) Inhibition with Peroxisome Proliferator-Activated Receptors (PPARs) Activation. J. Med. Chem. 2019, 62, 10995–11003. [Google Scholar] [CrossRef] [PubMed]
- Toczek, M.; Malinowska, B. Enhanced endocannabinoid tone as a potential target of pharmacotherapy. Life Sci. 2018, 204, 20–45. [Google Scholar] [CrossRef]
- Bottemanne, P.; Muccioli, G.G.; Alhouayek, M. N-acylethanolamine hydrolyzing acid amidase inhibition: Tools and potential therapeutic opportunities. Drug Discov. Today 2018, 23, 1520–1529. [Google Scholar] [CrossRef]
- Petrosino, S.; Di Marzo, V. FAAH and MAGL inhibitors: Therapeutic opportunities from regulating endocannabinoid levels. Curr. Opin. Investig. Drugs 2010, 11, 51–62. [Google Scholar]
- Mallet, C.; Dubray, C.; Dualé, C. FAAH inhibitors in the limelight, but regrettably. Int. J. Clin. Pharmacol. Ther. 2016, 54, 498–501. [Google Scholar] [CrossRef] [PubMed]
- van Esbroeck, A.C.M.; Janssen, A.P.A.; Cognetta, A.B., III; Ogasawara, D.; Shpak, G.; van der Kroeg, M.; Kantae, V.; Baggelaar, M.P.; de Vrij, F.M.S.; Deng, H.; et al. Activity-based protein profiling reveals off-target proteins of the FAAH inhibitor BIA 10-2474. Science 2017, 356, 1084–1087, PMCID:PMC5641481. [Google Scholar] [CrossRef] [PubMed]
- Kathuria, S.; Gaetani, S.; Fegley, D.; Valiño, F.; Duranti, A.; Tontini, A.; Mor, M.; Tarzia, G.; La Rana, G.; Calignano, A.; et al. Modulation of anxiety through blockade of anandamide hydrolysis. Nat. Med. 2003, 9, 76–81. [Google Scholar] [CrossRef]
- Ladin, D.A.; Soliman, E.; Griffin, L.; Van Dross, R. Corrigendum: Preclinical and Clinical Assessment of Cannabinoids as Anti-Cancer Agents. Front. Pharmacol. 2021, 12, 732903, Erratum for: Front. Pharmacol. 2016, 7, 361. [Google Scholar] [CrossRef] [PubMed]
- Pokrywka, M.; Góralska, J.; Solnica, B. Cannabinoids-a new weapon against cancer? Postepy. Hig. Med. Dosw. 2016, 70, 1309–1320. [Google Scholar] [CrossRef]
- Milando, R.; Friedman, A. Cannabinoids: Potential Role in Inflammatory and Neoplastic Skin Diseases. Am. J. Clin. Dermatol. 2019, 20, 167–180. [Google Scholar] [CrossRef] [PubMed]
- Bíró, T.; Tóth, B.I.; Haskó, G.; Paus, R.; Pacher, P. The endocannabinoid system of the skin in health and disease: Novel perspectives and therapeutic opportunities. Trends Pharmacol. Sci. 2009, 30, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Ramer, R.; Bublitz, K.; Freimuth, N.; Merkord, J.; Rohde, H.; Haustein, M.; Borchert, P.; Schmuhl, E.; Linnebacher, M.; Hinz, B. Cannabidiol inhibits lung cancer cell invasion and metastasis via intercellular adhesion molecule-1. FASEB J. 2012, 26, 1535–1548. [Google Scholar] [CrossRef] [PubMed]
- Winkler, K.; Ramer, R.; Dithmer, S.; Ivanov, I.; Merkord, J.; Hinz, B. Fatty acid amide hydrolase inhibitors confer anti-invasive and antimetastatic effects on lung cancer cells. Oncotarget 2016, 7, 15047–15064. [Google Scholar] [CrossRef]
- Hamtiaux, L.; Masquelier, J.; Muccioli, G.G.; Bouzin, C.; Feron, O.; Gallez, B.; Lambert, D.M. The association of N-palmitoylethanolamine with the FAAH inhibitor URB597 impairs melanoma growth through a supra-additive action. BMC Cancer 2012, 12, 92, PMCID:PMC3364151. [Google Scholar] [CrossRef] [PubMed]
- Wasilewski, A.; Krajewska, U.; Owczarek, K.; Lewandowska, U.; Fichna, J. Fatty acid amide hydrolase (FAAH) inhibitor PF-3845 reduces viability, migration and invasiveness of human colon adenocarcinoma Colo-205 cell line: An in vitro study. Acta Biochim. Pol. 2017, 64, 519–525. [Google Scholar] [CrossRef] [PubMed]
- Ravi, J.; Sneh, A.; Shilo, K.; Nasser, M.W.; Ganju, R.K. FAAH inhibition enhances anandamide mediated anti-tumorigenic effects in non-small cell lung cancer by downregulating the EGF/EGFR pathway. Oncotarget 2014, 5, 2475–2486. [Google Scholar] [CrossRef] [PubMed]
- Velez-delValle, C.; Marsch-Moreno, M.; Castro-Muñozledo, F.; Galván-Mendoza, I.J.; Kuri-Harcuch, W. Epithelial cell migration requires the interaction between the vimentin and keratin intermediate filaments. Sci. Rep. 2016, 6, 24389. [Google Scholar] [CrossRef] [PubMed]
- Dmello, C.; Sawant, S.; Alam, H.; Gangadaran, P.; Mogre, S.; Tiwari, R.; D’Souza, Z.; Narkar, M.; Thorat, R.; Patil, K.; et al. Vimentin regulates differentiation switch via modulation of keratin 14 levels and their expression together correlates with poor prognosis in oral cancer patients. PLoS ONE 2017, 12, e0172559, PMCID:PMC5321444. [Google Scholar] [CrossRef] [PubMed]
- Loh, C.Y.; Chai, J.Y.; Tang, T.F.; Wong, W.F.; Sethi, G.; Shanmugam, M.K.; Chong, P.P.; Looi, C.Y. The E-Cadherin and N-Cadherin Switch in Epithelial-to-Mesenchymal Transition: Signaling, Therapeutic Implications, and Challenges. Cells 2019, 8, 1118, PMCID:PMC6830116. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.K.; Jiang, X.Y.; Zhou, X.X.; Wang, D.M.; Song, X.L.; Jiang, H.B. Upregulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: Correlation with the clinicopathological features and patient outcome. Mod. Pathol. 2010, 23, 213–224. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.Y.; Takeuchi, S.; Moroi, Y.; Hayashida, S.; Kido, M.; Chen, S.J.; Tomoeda, H.; Uenotsuchi, T.; Tu, Y.T.; Furue, M.; et al. Overexpression of phosphorylated-ATF2 and STAT3 in cutaneous squamous cell carcinoma, Bowen’s disease and basal cell carcinoma. J. Dermatol. Sci. 2008, 51, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Suiqing, C.; Min, Z.; Lirong, C. Overexpression of phosphorylated-STAT3 correlated with the invasion and metastasis of cutaneous squamous cell carcinoma. J. Dermatol. 2005, 32, 354–360. [Google Scholar] [CrossRef]
- Sumita, N.; Bito, T.; Nakajima, K.; Nishigori, C. Stat3 activation is required for cell proliferation and tumorigenesis but not for cell viability in cutaneous squamous cell carcinoma cell lines. Exp. Dermatol. 2006, 15, 291–299. [Google Scholar] [CrossRef]
- Kamran, M.Z.; Patil, P.; Gude, R.P. Role of STAT3 in cancer metastasis and translational advances. Biomed. Res. Int. 2013, 421821. [Google Scholar] [CrossRef]
- Wang, B.; Wu, L.; Chen, J.; Dong, L.; Chen, C.; Wen, Z.; Hu, J.; Fleming, I.; Wang, D.W. Metabolism pathways of arachidonic acids: Mechanisms and potential therapeutic targets. Signal Transduct. Target Ther. 2021, 6, 94. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Weng, J.; Mei, H.; Zhuang, M.; Xiao, X.; Du, F.; Lin, L.; Wu, J.; Chen, Z.; Huang, Y.; et al. 5-Lipoxygenase promotes epithelial-mesenchymal transition through the ERK signaling pathway in gastric cancer. J. Gastroenterol. Hepatol. 2021, 36, 455–466. [Google Scholar] [CrossRef] [PubMed]
- Shujiao, L.; Lilin, H.; Yong, S. Cyclooxygenase2 expression and association with skin cancer: Ameta-analysis based on Chinese patients. J. Cancer Res. Ther. 2016, 12, C288–C290. [Google Scholar] [CrossRef] [PubMed]
- Finetti, F.; Travelli, C.; Ercoli, J.; Colombo, G.; Buoso, E.; Trabalzini, L. Prostaglandin E2 and Cancer: Insight into Tumor Progression and Immunity. Biology 2020, 9, 434. [Google Scholar] [CrossRef]
- Schwarz, R.; Ramer, R.; Hinz, B. Targeting the endocannabinoid system as a potential anticancer approach. Drug Metab. Rev. 2018, 50, 26–53. [Google Scholar] [CrossRef]
- Endsley, M.P.; Thill, R.; Choudhry, I.; Williams, C.L.; Kajdacsy-Balla, A.; Campbell, W.B.; Nithipatikom, K. Expression and function of fatty acid amide hydrolase in prostate cancer. Int. J. Cancer 2008, 123, 1318–1326. [Google Scholar] [CrossRef]
- Ye, L.; Zhang, B.; Seviour, E.G.; Tao, K.X.; Liu, X.H.; Ling, Y.; Chen, J.Y.; Wang, G.B. Monoacylglycerol lipase (MAGL) knockdown inhibits tumor cells growth in colorectal cancer. Cancer Lett. 2011, 307, 6–17. [Google Scholar] [CrossRef]
- Nomura, D.K.; Lombardi, D.P.; Chang, J.W.; Niessen, S.; Ward, A.M.; Long, J.Z.; Hoover, H.H.; Cravatt, B.F. Monoacylglycerol lipase exerts dual control over endocannabinoid and fatty acid pathways to support prostate cancer. Chem. Biol. 2011, 18, 846–856. [Google Scholar] [CrossRef]
- Proto, M.C.; Gazzerro, P.; Di Croce, L.; Santoro, A.; Malfitano, A.M.; Pisanti, S.; Laezza, C.; Bifulco, M. Interaction of endocannabinoid system and steroid hormones in the control of colon cancer cell growth. J. Cell Physiol. 2012, 227, 250–258. [Google Scholar] [CrossRef]
- Hamtiaux, L.; Hansoulle, L.; Dauguet, N.; Muccioli, G.G.; Gallez, B.; Lambert, D.M. Increasing antiproliferative properties of endocannabinoids in N1E-115 neuroblastoma cells through inhibition of their metabolism. PLoS ONE 2011, 6, e26823. [Google Scholar] [CrossRef]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Furugen, A.; Yamaguchi, H.; Mano, N. Simultaneous quantification of leukotrienes and hydroxy eicosatetraenoic acids in cell culture medium using liquid chromatography/tandem mass spectrometry. Biomed. Chromatogr. 2015, 29, 1084–1093. [Google Scholar] [CrossRef] [PubMed]
- Le Faouder, P.; Baillif, V.; Spreadbury, I.; Motta, J.P.; Rousset, P.; Chêne, G.; Guigné, C.; Tercé, F.; Vanner, S.; Vergnolle, N.; et al. LC-MS/MS method for rapid and concomitant quantification of pro-inflammatory and pro-resolving polyunsaturated fatty acid metabolites. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2013, 932, 123–133. [Google Scholar] [CrossRef] [PubMed]
Gene | Oligonucleotide Sequences (5′-3′) | Amplicon Size | Accession Number |
---|---|---|---|
E-CADHERIN | F: GAACGCATTGCCACATACAC R: ATTCGGGCTTGTTGTCATTC | 118 bp | NM_004360.5 |
FIBRONECTIN | F: CCTCGAAGAGCAAGAGGCAG R: GCTTCAGGTTTACTCTCGCA | 202 bp | NM_001365522.2 |
GAPDH | F: TGCACCACCAACTGCTTAGC R: GGCATGGACTGTGGTCATGAG | 198 bp | NM_001289746 |
K6 | F: AGTCCTGCTTCTCTTC R: CTGCTGTGGCTCCTGATG | 107 bp | NM_005554.4 |
MMP-2 | F: AGAAGGCTGTGTTCTTTGCAG R: AGGCTGGTCAGTGGCTTG | 88 bp | NM_004530.6 |
MMP-9 | F: TGACAGCGACAAGAAGTG R: CAGTGAAGCGGTACATAGG | 143 bp | NM_004994.3 |
N-CADHERIN | F: GGACTATGATTACCTGAACGACTG R: AGTTAAAGCCTAGCTTCTGAATGC | 161 bp | NM_001792.5 |
SNAI1 | F: ACTATGCCGCGCTCTTTCC R: GTCGTAGGGCTGCTGGAAG | 111 bp | NM_005985.4 |
SNAI2 | F: TGGTTGCTTCAAGGACACAT R: GCAAATGCTCTGTTGCAGTG | 77 bp | NM_003068.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kovacs, D.; Flori, E.; Bastonini, E.; Mosca, S.; Migliano, E.; Cota, C.; Zaccarini, M.; Briganti, S.; Cardinali, G. Targeting Fatty Acid Amide Hydrolase Counteracts the Epithelial-to-Mesenchymal Transition in Keratinocyte-Derived Tumors. Int. J. Mol. Sci. 2023, 24, 17379. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242417379
Kovacs D, Flori E, Bastonini E, Mosca S, Migliano E, Cota C, Zaccarini M, Briganti S, Cardinali G. Targeting Fatty Acid Amide Hydrolase Counteracts the Epithelial-to-Mesenchymal Transition in Keratinocyte-Derived Tumors. International Journal of Molecular Sciences. 2023; 24(24):17379. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242417379
Chicago/Turabian StyleKovacs, Daniela, Enrica Flori, Emanuela Bastonini, Sarah Mosca, Emilia Migliano, Carlo Cota, Marco Zaccarini, Stefania Briganti, and Giorgia Cardinali. 2023. "Targeting Fatty Acid Amide Hydrolase Counteracts the Epithelial-to-Mesenchymal Transition in Keratinocyte-Derived Tumors" International Journal of Molecular Sciences 24, no. 24: 17379. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242417379