Exploring CDKN1A Upregulation Mechanisms: Insights into Cell Cycle Arrest Induced by NC2603 Curcumin Analog in MCF-7 Breast Cancer Cells
Abstract
:1. Introduction
2. Results
2.1. Cytotoxic Evaluation of NC2603: Dose-Response Analysis, IC50 Determination, and Comparative Efficacy against MCF-7 and HaCaT Cell Lines
2.2. Differential Gene Expression Analysis: Significantly Altered Genes Regulated by Analog NC2603
2.3. Insights through Enrichment Analysis of Differentially Expressed Genes
2.4. RNAseq Data Validation
2.5. Antiproliferative Effects of the Curcumin Analog NC2603
2.6. In Silico Analysis of ESR1 and GADD45A Genes
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Cell Viability
4.4. Next Generation Sequencing
4.5. RT-qPCR
4.6. Enrichment Analysis
4.7. Cell Cycle Progression Assay
4.8. In Silico Analysis
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roser, M.; Ritchie, H. Cancer—Our World in Data. Available online: https://ourworldindata.org/cancer (accessed on 3 May 2022).
- Wilkinson, L.; Gathani, T. Understanding Breast Cancer as a Global Health Concern. Br. J. Radiol. 2022, 95, 20211033. [Google Scholar] [CrossRef] [PubMed]
- Tsang, J.Y.S.; Tse, G.M. Molecular Classification of Breast Cancer. Adv. Anat. Pathol. 2020, 27, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Gomes Do Nascimento, R.; Otoni, K.M. Histological and Molecular Classification of Breast Cancer: What Do We Know? Mastology 2020, 30, 20200024. [Google Scholar] [CrossRef]
- Holliday, D.L.; Speirs, V. Choosing the Right Cell Line for Breast Cancer Research. Breast Cancer Res. 2011, 13, 215. [Google Scholar] [CrossRef] [PubMed]
- Soliman, N.A.; Yussif, S.M. Ki-67 as a Prognostic Marker According to Breast Cancer Molecular Subtype. Cancer Biol. Med. 2016, 13, 496. [Google Scholar] [CrossRef]
- Barzaman, K.; Karami, J.; Zarei, Z.; Hosseinzadeh, A.; Kazemi, M.H.; Moradi-Kalbolandi, S.; Safari, E.; Farahmand, L. Breast Cancer: Biology, Biomarkers, and Treatments. Int. Immunopharmacol. 2020, 84, 106535. [Google Scholar] [CrossRef] [PubMed]
- Azim, H.A.; Peccatori, F.A.; Liptrott, S.J.; Catania, C.; Goldhirsch, A. Breast Cancer and Pregnancy: How Safe Is Trastuzumab? Nat. Rev. Clin. Oncol. 2009, 6, 367–370. [Google Scholar] [CrossRef] [PubMed]
- Sarhangi, N.; Hajjari, S.; Heydari, S.F.; Ganjizadeh, M.; Rouhollah, F.; Hasanzad, M. Breast Cancer in the Era of Precision Medicine. Mol. Biol. Rep. 2022, 49, 10023–10037. [Google Scholar] [CrossRef] [PubMed]
- Bordoloi, D.; Roy, N.K.; Monisha, J.; Padmavathi, G.; Kunnumakkara, A.B. Multi-Targeted Agents in Cancer Cell Chemosensitization: What We Learnt from Curcumin Thus Far. Recent Pat. Anti-Cancer Drug Discov. 2016, 11, 67–97. [Google Scholar] [CrossRef]
- Xiaokaiti, Y.; Li, X. Natural Product Regulates Autophagy in Cancer. Adv. Exp. Med. Biol. 2020, 1207, 709–724. [Google Scholar] [CrossRef]
- Rodrigues, T.; Reker, D.; Schneider, P.; Schneider, G. Counting on Natural Products for Drug Design. Nat. Chem. 2016, 8, 531–541. [Google Scholar] [CrossRef] [PubMed]
- Yue, R.; Shan, L.; Yang, X.; Zhang, W. Approaches to Target Profiling of Natural Products. Curr. Med. Chem. 2012, 19, 3841–3855. [Google Scholar] [CrossRef] [PubMed]
- Newman, D.J.; Cragg, G.M. Natural Products as Sources of New Drugs over the 30 Years from 1981 to 2010. J. Nat. Prod. 2012, 75, 311–335. [Google Scholar] [CrossRef] [PubMed]
- Mazumder, A.; Cerella, C.; Diederich, M. Natural Scaffolds in Anticancer Therapy and Precision Medicine. Biotechnol. Adv. 2018, 36, 1563–1585. [Google Scholar] [CrossRef]
- Naeem, A.; Hu, P.; Yang, M.; Zhang, J.; Liu, Y.; Zhu, W.; Zheng, Q. Natural Products as Anticancer Agents: Current Status and Future Perspectives. Molecules 2022, 27, 8367. [Google Scholar] [CrossRef] [PubMed]
- Banyal, A.; Tiwari, S.; Sharma, A.; Chanana, I.; Patel, S.K.S.; Kulshrestha, S.; Kumar, P. Vinca Alkaloids as a Potential Cancer Therapeutics: Recent Update and Future Challenges. 3 Biotech 2023, 13, 211. [Google Scholar] [PubMed]
- Yao, H.; Liu, J.; Xu, S.; Zhu, Z.; Xu, J. The Structural Modification of Natural Products for Novel Drug Discovery. Expert. Opin. Drug Discov. 2017, 12, 121–140. [Google Scholar] [CrossRef] [PubMed]
- Melfi, F.; Carradori, S.; Angeli, A.; D’Agostino, I. Nature as a Source and Inspiration for Human Monoamine Oxidase B (HMAO-B) Inhibition: A Review of the Recent Advances in Chemical Modification of Natural Compounds. Expert. Opin. Drug Discov. 2023, 18, 851–879. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Wu, Y.J.; Sun, P.L.; Zhang, F.M.; Linhardt, R.J.; Zhang, A.Q. Chemically Modified Polysaccharides: Synthesis, Characterization, Structure Activity Relationships of Action. Int. J. Biol. Macromol. 2019, 132, 970–977. [Google Scholar] [CrossRef]
- Liu, T.; Ren, Q.; Wang, S.; Gao, J.; Shen, C.; Zhang, S.; Wang, Y.; Guan, F. Chemical Modification of Polysaccharides: A Review of Synthetic Approaches, Biological Activity and the Structure–Activity Relationship. Molecules 2023, 28, 6073. [Google Scholar] [CrossRef]
- Masuda, T.; Jitoe, A.; Isobe, J.; Nakatani, N.; Yonemori, S. Anti-Oxidative and Anti-Inflammatory Curcumin-Related Phenolics from Rhizomes of Curcuma Domestica. Phytochemistry 1993, 32, 1557–1560. [Google Scholar] [CrossRef]
- Kotha, R.R.; Luthria, D.L. Curcumin: Biological, Pharmaceutical, Nutraceutical, and Analytical Aspects. Molecules 2019, 24, 2930. [Google Scholar] [CrossRef] [PubMed]
- Sueth-Santiago, V.; Mendes-Silva, G.P.; Decoté-Ricardo, D.; De Lima, M.E.F. Curcumina, o Pó Dourado Do Açafrão-Da-Terra: Introspecções Sobre Química e Atividades Biológicas. Química Nova 2015, 38, 538–552. [Google Scholar]
- Hewlings, S.J.; Kalman, D.S. Curcumin: A Review of Its’ Effects on Human Health. Foods 2017, 6, 92. [Google Scholar] [CrossRef] [PubMed]
- Siwak, D.R.; Shishodia, S.; Aggarwal, B.B.; Kurzrock, R. Curcumin-Induced Antiproliferative and Proapoptotic Effects in Melanoma Cells Are Associated with Suppression of IκB Kinase and Nuclear Factor ΚB Activity and Are Independent of the B-Raf/Mitogen-Activated/Extracellular Signal-Regulated Protein Kinase Pathway and the Akt Pathway. Cancer 2005, 104, 879–890. [Google Scholar] [CrossRef] [PubMed]
- Song, F.; Zhang, L.; Yu, H.X.; Lu, R.R.; Bao, J.D.; Tan, C.; Sun, Z. The Mechanism Underlying Proliferation-Inhibitory and Apoptosis-Inducing Effects of Curcumin on Papillary Thyroid Cancer Cells. Food Chem. 2012, 132, 43–50. [Google Scholar] [CrossRef]
- Khan, M.A.; Gahlot, S.; Majumdar, S. Oxidative Stress Induced by Curcumin Promotes the Death of Cutaneous T-Cell Lymphoma (HuT-78) by Disrupting the Function of Several Molecular Targets. Mol. Cancer Ther. 2012, 11, 1873–1883. [Google Scholar] [CrossRef] [PubMed]
- Semlali, A.; Contant, C.; Al-Otaibi, B.; Al-Jammaz, I.; Chandad, F. The Curcumin Analog (PAC) Suppressed Cell Survival and Induced Apoptosis and Autophagy in Oral Cancer Cells. Sci. Rep. 2021, 11, 11701. [Google Scholar] [CrossRef] [PubMed]
- Mohankumar, K.; Francis, A.P.; Pajaniradje, S.; Rajagopalan, R. Synthetic Curcumin Analog: Inhibiting the Invasion, Angiogenesis, and Metastasis in Human Laryngeal Carcinoma Cells via NF-KB Pathway. Mol. Biol. Rep. 2021, 48, 6065–6074. [Google Scholar] [CrossRef]
- Lima, F.T.; Seba, V.; Silva, G.; Torrezan, G.S.; Polaquini, C.R.; Pinhanelli, V.C.; Baek, S.J.; Fachin, A.L.; Regasini, L.O.; Marins, M. The Curcumin Analog CH-5 Exerts Anticancer Effects in Human Osteosarcoma Cells via Modulation of Transcription Factors P53/Sp1. Int. J. Mol. Sci. 2018, 19, 1909. [Google Scholar] [CrossRef]
- Silva, G.; Lima, F.T.; Seba, V.; Mendes Lourenço, A.L.; Lucas, T.G.; De Andrade, B.V.; Torrezan, G.S.; Polaquini, C.R.; Garcia, M.E.; Couto, L.B.; et al. Curcumin Analog CH-5 Suppresses the Proliferation, Migration, and Invasion of the Human Gastric Cancer Cell Line HGC-27. Molecules 2018, 23, 279. [Google Scholar] [CrossRef]
- Das, U.; Sharma, R.; Dimmock, J. 1,5-Diaryl-3-Oxo-1,4-Pentadienes: A Case for Antineoplastics with Multiple Targets. Curr. Med. Chem. 2009, 16, 2001–2020. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.; Das, S.; Das, U.; Doroudi, A.; Zhu, J.; Dimmock, J.R. Novel Hybrid Molecules of 3,5-Bis(Benzylidene)-4-Piperidones and Dichloroacetic Acid Which Demonstrate Potent Tumour-Selective Cytotoxicity. Bioorganic Med. Chem. Lett. 2020, 30, 126878. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, F.G.; Sampaio, B.B.; do Couto, G.O.; da Silva, A.D.; da Silva, W.J.; Peronni, K.C.; Evangelista, A.F.; Hossain, M.; Dimmock, J.R.; Bandy, B.; et al. The Transcriptome of BT-20 Breast Cancer Cells Exposed to Curcumin Analog NC2603 Reveals a Relationship between EGR3 Gene Modulation and Cell Migration Inhibition. Molecules 2024, 29, 1366. [Google Scholar] [CrossRef]
- Mitobe, Y.; Iino, K.; Takayama, K.I.; Ikeda, K.; Suzuki, T.; Aogi, K.; Kawabata, H.; Suzuki, Y.; Horie-Inoue, K.; Inoue, S. PSF Promotes ER-Positive Breast Cancer Progression via Posttranscriptional Regulation of ESR1 and SCFD2. Cancer Res. 2020, 80, 2230–2242. [Google Scholar] [CrossRef] [PubMed]
- Xia, S.; Lin, Q. Estrogen Receptor Bio-Activities Determine Clinical Endocrine Treatment Options in Estrogen Receptor-Positive Breast Cancer. Technol. Cancer Res. Treat. 2022, 21, 15330338221090351. [Google Scholar] [CrossRef] [PubMed]
- Liao, X.H.; Lu, D.L.; Wang, N.; Liu, L.Y.; Wang, Y.; Li, Y.Q.; Yan, T.B.; Sun, X.G.; Hu, P.; Zhang, T.C. Estrogen Receptor α Mediates Proliferation of Breast Cancer MCF–7 Cells via a P21/PCNA/E2F1-Dependent Pathway. FEBS J. 2014, 281, 927–942. [Google Scholar] [CrossRef] [PubMed]
- Engeland, K. Cell Cycle Regulation: P53-P21-RB Signaling. Cell Death Differ. 2022, 29, 946. [Google Scholar] [CrossRef] [PubMed]
- Goel, S.; DeCristo, M.J.; McAllister, S.S.; Zhao, J.J. CDK4/6 Inhibition in Cancer: Beyond Cell Cycle Arrest. Trends Cell Biol. 2018, 28, 911. [Google Scholar] [CrossRef]
- Kim, S.; Leong, A.; Kim, M.; Yang, H.W. CDK4/6 Initiates Rb Inactivation and CDK2 Activity Coordinates Cell-Cycle Commitment and G1/S Transition. Sci. Rep. 2022, 12, 16810. [Google Scholar] [CrossRef]
- Al Bitar, S.; Gali-Muhtasib, H. The Role of the Cyclin Dependent Kinase Inhibitor P21cip1/Waf1 in Targeting Cancer: Molecular Mechanisms and Novel Therapeutics. Cancers 2019, 11, 1475. [Google Scholar] [CrossRef] [PubMed]
- Palomer, X.; Salvador, J.M.; Griñán-Ferré, C.; Barroso, E.; Pallàs, M.; Vázquez-Carrera, M. GADD45A: With or without You. Med. Res. Rev. 2024; Online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Kleinsimon, S.; Longmuss, E.; Rolff, J.; Jäger, S.; Eggert, A.; Delebinski, C.; Seifert, G. GADD45A and CDKN1A Are Involved in Apoptosis and Cell Cycle Modulatory Effects of ViscumTT with Further Inactivation of the STAT3 Pathway. Sci. Rep. 2018, 8, 5750. [Google Scholar] [CrossRef] [PubMed]
- Yoshiko, S.; Hoyoko, N. Fucoxanthin, a Natural Carotenoid, Induces G1 Arrest and GADD45 Gene Expression in Human Cancer Cells. Vivo 2007, 21, 305–309. [Google Scholar]
- Oliveras-Ferraros, C.; Fernández-Arroyo, S.; Vazquez-Martin, A.; Lozano-Sánchez, J.; Cufí, S.; Joven, J.; Micol, V.; Fernández-Gutiérrez, A.; Segura-Carretero, A.; Menendez, J.A. Crude Phenolic Extracts from Extra Virgin Olive Oil Circumvent de Novo Breast Cancer Resistance to HER1/HER2-Targeting Drugs by Inducing GADD45-Sensed Cellular Stress, G2/M Arrest and Hyperacetylation of Histone H3. Int. J. Oncol. 2011, 38, 1533–1547. [Google Scholar] [CrossRef] [PubMed]
- Saha, A.; Kuzuhara, T.; Echigo, N.; Fujii, A.; Suganuma, M.; Fujiki, H. Apoptosis of Human Lung Cancer Cells by Curcumin Mediated through Up-Regulation of “Growth Arrest and DNA Damage Inducible Genes 45 and 153”. Biol. Pharm. Bull. 2010, 33, 1291–1299. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.S.; Ju, J.H.; Jang, K.; Shin, I. Induction of Apoptotic Cell Death by Phytoestrogens by Up-Regulating the Levels of Phospho-P53 and P21 in Normal and Malignant Estrogen Receptor α–Negative Breast Cells. Nutr. Res. 2011, 31, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Shen, G.; Xu, C.; Chen, C.; Hebbar, V.; Kong, A.N.T. P53-Independent G1 Cell Cycle Arrest of Human Colon Carcinoma Cells HT-29 by Sulforaphane Is Associated with Induction of P21CIP1 and Inhibition of Expression of Cyclin D1. Cancer Chemother. Pharmacol. 2006, 57, 317–327. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.H.; Kang, S.S.; Park, K.K.; Chang, H.W.; Magae, J.; Chang, Y.C. P53-Independent Induction of G1 Arrest and P21WAF1/CIP1 Expression by Ascofuranone, an Isoprenoid Antibiotic, through Downregulation of c-Myc. Mol. Cancer Ther. 2010, 9, 2102–2113. [Google Scholar] [CrossRef]
- Fan, W.; Richter, G.; Cereseto, A.; Beadling, C.; Smith, K.A. Cytokine Response Gene 6 Induces P21 and Regulates Both Cell Growth and Arrest. Oncogene 1999, 18, 6573–6582. [Google Scholar] [CrossRef]
- Rosemary Siafakas, A.; Richardson, D.R. Growth Arrest and DNA Damage-45 Alpha (GADD45α). Int. J. Biochem. Cell Biol. 2009, 41, 986–989. [Google Scholar] [CrossRef] [PubMed]
- Hirose, T.; Sowa, Y.; Takahashi, S.; Saito, S.; Yasuda, C.; Shindo, N.; Furuichi, K.; Sakai, T. P53-Independent Induction of Gadd45 by Histone Deacetylase Inhibitor: Coordinate Regulation by Transcription Factors Oct-1 and NF-Y. Oncogene 2003, 22, 7762–7773. [Google Scholar] [CrossRef] [PubMed]
- Komoto, T.T.; Bernardes, T.M.; Mesquita, T.B.; Bortolotto, L.F.B.; Silva, G.; Bitencourt, T.A.; Baek, S.J.; Marins, M.; Fachin, A.L. Chalcones Repressed the AURKA and MDR Proteins Involved in Metastasis and Multiple Drug Resistance in Breast Cancer Cell Lines. Molecules 2018, 23, 2018. [Google Scholar] [CrossRef] [PubMed]
- Komoto, T.T.; Bitencourt, T.A.; Silva, G.; Beleboni, R.O.; Marins, M.; Fachin, A.L.; Komoto, T.T.; Bitencourt, T.A.; Silva, G.; Beleboni, R.O.; et al. Gene Expression Response of Trichophyton Rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents. Evid. Based Complement. Altern. Med. 2015, 2015, 180535. [Google Scholar] [CrossRef]
- BD DNA Reagent Kit. Available online: www.bdbiosciences.com/content/bdb/paths/generate-tds-document.nz.340242.pdf (accessed on 11 September 2023).
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A Web Server for Cancer and Normal Gene Expression Profiling and Interactive Analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef]
Gene | Primer | |
---|---|---|
Forward 5′–3′ | Reverse 5′–3′ | |
GADD45A | TGCGAGAACGACATCAACAT | TCCCGGCAAAAACAAATAAG |
CCNB1 | AATAAGGCGAAGATCAACATGGC | TTTGTTACCAATGTCCCCAAGAG |
CDKN1A | GACACCACTGGAGGGTGACT | CAGGTCCACATGGTCTTCCT |
CCNA2 | CACTCTACACAGTCACGGGA | AGTGTCTCTGGTGGGTTGAG |
CCNE2 | CTTACGTCACTGATGGTGCTTGC | CTTGGAGAAAGAGATTTAGCCAGG |
CCND1 | TCTACACCGACAACTCCATCCG | TCTGGCATTTTGGAGAGGAAGTG |
CCND2 | GTTCCTGGCCTCCAAACTCA | CTTGATGGAGTTGTCGGTGTAAAT |
CDK2 | ATGGATGCCTCTGCTCTCACTG | CCCGATGAGAATGGCAGAAAGC |
CDK1 | TTTTCAGAGCTTTGGGCACT | CCATTTTGCCAGAAATTCGT |
CDK4 | CCATCAGCACAGTTCGTGAGGT | TCAGTTCGGGATGTGGCACAGA |
CDK6 | GGATAAAGTTCCAGAGCCTGGAG | GCGATGCACTACTCGGTGTGAA |
PCNA | ATTAAACGGTTGCAGGCGTAG | ACATCTGCAGACATACTGAGTG |
ESR1 | GCTTACTGACCAACCTGGCAGA | GGATCTCTAGCCAGGCACATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nishimura, F.G.; Sampaio, B.B.; Komoto, T.T.; da Silva, W.J.; da Costa, M.M.G.; Haddad, G.I.; Peronni, K.C.; Evangelista, A.F.; Hossain, M.; Dimmock, J.R.; et al. Exploring CDKN1A Upregulation Mechanisms: Insights into Cell Cycle Arrest Induced by NC2603 Curcumin Analog in MCF-7 Breast Cancer Cells. Int. J. Mol. Sci. 2024, 25, 4989. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094989
Nishimura FG, Sampaio BB, Komoto TT, da Silva WJ, da Costa MMG, Haddad GI, Peronni KC, Evangelista AF, Hossain M, Dimmock JR, et al. Exploring CDKN1A Upregulation Mechanisms: Insights into Cell Cycle Arrest Induced by NC2603 Curcumin Analog in MCF-7 Breast Cancer Cells. International Journal of Molecular Sciences. 2024; 25(9):4989. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094989
Chicago/Turabian StyleNishimura, Felipe Garcia, Beatriz Borsani Sampaio, Tatiana Takahasi Komoto, Wanessa Julia da Silva, Mariana Mezencio Gregório da Costa, Gabriela Inforçatti Haddad, Kamila Chagas Peronni, Adriane Feijó Evangelista, Mohammad Hossain, Jonathan R. Dimmock, and et al. 2024. "Exploring CDKN1A Upregulation Mechanisms: Insights into Cell Cycle Arrest Induced by NC2603 Curcumin Analog in MCF-7 Breast Cancer Cells" International Journal of Molecular Sciences 25, no. 9: 4989. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094989