Next Article in Journal
Rock Refuges Are Strongly Associated with Increased Urban Occupancy in the Western Fence Lizard, Sceloporus occidentalis
Next Article in Special Issue
Comparing the Utility of Microsatellites and Single Nucleotide Polymorphisms in Conservation Genetics: Insights from a Study on Two Freshwater Fish Species in France
Previous Article in Journal
Characterization and Comparison of Eye Development and Phototransduction Genes in Deep- and Shallow-Water Shrimp Alvinocaris longirostris and Palaemon carinicauda
Previous Article in Special Issue
Genetic Structure and Diversity of Native Tench (Tinca tinca L. 1758) Populations in Hungary—Establishment of Basic Knowledge Base for a Breeding Program
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 14
Issue 8
10.3390/d14080654
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity of Chinese Longsnout Catfish (Leiocassis longirostris) in Four Farmed Populations Based on 20 New Microsatellite DNA Markers

by
Lu Zhang
1,
Chenyan Mou
1,
Jian Zhou
1,
Hua Ye
2,
Zhen Wei
3,
Hongyu Ke
1,
Zhipeng Huang
1,
Yuanliang Duan
1,
Zhongmeng Zhao
1,
Han Zhao
1,
Huadong Li
1,
Jun Du
1 and
Qiang Li
1,*
1
Fishery Institute of the Sichuan Academy of Agricultural Sciences, Chengdu 611731, China
2
Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), College of Fisheries, Southwest University, Chongqing 402460, China
3
Sichuan Chinese Longsnout Catfish Foundation Seed Farm, Chongzhou 611230, China
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(8), 654; https://0-doi-org.brum.beds.ac.uk/10.3390/d14080654
Submission received: 8 July 2022 / Revised: 11 August 2022 / Accepted: 11 August 2022 / Published: 13 August 2022
(This article belongs to the Special Issue Genetic Diversity of Domesticated and Natural Fish Populations: Patterns and Processes)
Browse Figures
Versions Notes

Abstract

:
Freshwater aquaculture has a long and vibrant tradition in China. The Chinese longsnout catfish (Leiocassis longirostris) is a popular economic freshwater fish native to China. Understanding the genetic structure of L. longirostris populations is important for ensuring the efficacy of management practices and the sustainability of future increases in production. In this study, we used Illumina sequencing technology to isolate 20 novel polymorphic microsatellites from the genome of L. longirostris. These microsatellites were used to analyze the genetic diversity of 240 L. longrostris individuals from four populations. Genetic diversity parameters (NA, HO, HE, I, PIC, and FST) of the four farmed L. longirostris populations were analyzed. The level of genetic differentiation among the four farmed L. longirostris populations (inferred by pairwise comparisons of FST values) was low, but the genetic diversity of these populations was high, indicating that they still provide useful sources of genetic variation that could aid in breeding efforts. The STRUCTURE and ADMIXTURE analyses indicated that admixture might be occurring in the four L. longirostris populations, especially between the MS and YB populations. Understanding the genetic diversity of farmed L. longirostris populations and inbreeding prevention could greatly aid in breeding and production. These newly isolated microsatellite markers and the high genetic diversity of L. longirostris populations in the main breeding areas have important implications for the breeding and stock management of L. longirostris.

1. Introduction

Freshwater aquaculture has a long and vibrant tradition in China [1]. The Chinese longsnout catfish (Leiocassis longirostris) belongs to the family Bagridae, which is an economically important freshwater fish native to China [2]. L. longirostris has no scales and no intramuscular spines, and its meat is soft and flavorsome [3], which makes it highly popular among consumers. L. longirostris is rich in protein and fat, possessing a crude protein content of 15.85% and a crude fat content of 5.31%; additionally, the content of unsaturated fatty acids in L. longirostris, such as DHA, EPA, and DPA n-3, is higher than that in many freshwater fish [4,5]. Global diversity is declining, and wild fish stocks are being depleted in various places worldwide [6]. L. longirostris populations have declined rapidly and have nearly disappeared in many river systems due to overfishing, pollution, and other human disturbances [7]. Fishing in the Yangtze River, where L. longirostris is most common, has been banned for 10 years to protect the fish resources [8]. Aquaculture has promoted rapid increases in production and has become one of the world’s most important food-production technologies [1]. L. longirostris production in China reached 21,195 tons in 2020, and Sichuan Province is responsible for 49.9% of the L. longirostris supply [9].
Since the successful domestication and artificial propagation of L. longirostris were achieved in the 1980s, artificial breeding technology has developed rapidly, and the domestic supply of L. longirostris is now almost completely derived from artificially bred individuals [10,11,12]. For most aquaculture species, a small number of parents are used to establish a base population for reproduction that is sufficient to produce a large number of offspring populations for the market, and the genetic diversity of these offspring populations can decline significantly [13]. The loss of genetic diversity has been observed over recent decades in many captive aquatic animal populations, such as Salmo salar [14], Lates calcarifer [15], Larimichthys crocea [16], Colossoma macropomum [17], and Acanthopagrus schlegelii [18]. The average number of eggs conceived by each sexually mature L. longirostris ranges from approximately 1,184 to 145,410; a female L. longirostris can produce tens of thousands of offspring every year, and a large number of offspring can be obtained using a small number of parents [19]. In addition, obtaining semen by artificial extrusion is extremely difficult due to the highly branched and finger-like testis of L. longirostris [20]; thus, it is often necessary to euthanize male L. longirostris and remove the testis to obtain semen for artificial insemination, which precludes the reuse of male parents [12,21]. The genetic diversity of L. longirostris cultures has decreased significantly after several generations of artificial breeding due to inbreeding and genetic drift [22]. Previous studies on the genetic diversity of wild L. longirostris populations have employed various molecular genetic methods, but few studies have examined the genetic background of L. longirostris parents used for reproduction [22,23,24,25,26,27]. Assessments of the genetic structure of populations are necessary for the management of farmed L. longirostris.
Microsatellites are neutral, codominant, and highly polymorphic markers, and these properties make them useful in population genetic studies of freshwater fish [28]. L. longirostris microsatellites have been developed, including 17 dinucleotide microsatellite loci isolated by the magnetic bead enrichment method in 2009 and 16 polymorphic trinucleotide and tetranucleotide microsatellite loci isolated by enrichment methods in 2010 [29,30]. However, few studies of farmed L. longirostris have been conducted using microsatellites. Illumina sequencing technology has been used to enrich molecular markers for L. longirostris; this is a less expensive and more efficient method for developing microsatellites compared with creating enriched libraries by the magnetic bead enrichment method [28]. The high-quality chromosome-level reference genome for L. longirostris was published in 2021 [2], and this has greatly facilitated the development and utilization of microsatellite molecular markers. Using Illumina sequencing technology, we isolated 20 new microsatellites with trinucleotide and tetranucleotide motifs and validated all of them in 240 individuals from four L. longirostris populations. These newly isolated microsatellite markers have important implications for the management of L. longirostris populations.
In this study, L. longirostris were collected from four seed farms in four different areas in Sichuan Province and Hubei Province. These two provinces are the main breeding and seedling production areas of L. longirostris, and one of the L. longirostris populations was sampled from the national L. longirostris seed farm in Hubei Province. The genetic diversity of the four L. longirostris populations was characterized using 20 microsatellites. Overall, the aim of this study was to clarify the genetic background of the main farmed L. longirostris populations.

2. Materials and Methods

A total of 240 L. longirostris were collected, 60 individuals each, from four different areas: Meishan City (MS) (29°44’ N, 103°47’ E) and Yibin City (YB) (28°44’ N, 104°35’ E) in Sichuan Province, and Wuhan City (WH) (30°58’ N, 114°17’ E) and Shishou City (SS) (29°40’ N, 112°38’ E) in Hubei Province. Tail fin tissue samples of L. longirostris were collected, fixed in alcohol, and stored at −20 °C. All experiments that involved handling and treating fish were conducted in strict accordance with the recommendations in the Guide for the Animal Care and Use Committee of the Fishery Institute of the Sichuan Academy of Agricultural Sciences (20200116001A). All samples in this study were collected in accordance with ethical requirements. Genomic DNA was extracted using a special DNA purification kit (B518251, Sangon Biotech Co., Ltd., Shanghai, China) following the manufacturer’s instructions. A spectrophotometer (Nanodrop ND-2000; Thermo Fisher Scientific, Waltham, MA, USA) was used to check the quality of genomic DNA.
Fin tissue samples of L. longirostris used for Illumina sequencing were collected from Yibin City, Sichuan Province. The L. longirostris DNA genome sequence library was constructed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). Clustering of all qualified libraries was conducted using a cBot Cluster Generation System and Illumia Cluster Kit (Illumina, Inc., San Diego, CA, USA), followed by sequencing using Illumina NovaSeq 6000 platform (Illumina, Inc., San Diego, CA, USA). Isolation of microsatellites and primer design were performed using Perl scripts; minimum repeat count parameters were defined to determine the numbers of dinucleotide–hexanucleotide motifs, which were 10, 6, 5, 5, and 5, respectively. We randomly selected 50 primer pairs to generate PCR products; 20 pairs with good stability and polymorphism were used in 240 individuals. The total volume of the PCR amplification reaction was 25 μL; each reaction contained 12.5 µL of 2 × Taq PCR Mix, 1 µL of DNA (concentration 100 ng/μL), 1 µL of fluorescent primer (Table 1), and ddH2O for the remainder. The thermal cycling conditions for the PCR reactions were 94 °C for 5 min; t36 cycles of 94 °C for 30 s, specified temperatures (values in Table 1) for 30 s, and 72 °C for 30 s; and 72 °C for 5 min. The PCR products were genotyped by Sangon Biotech Co., Ltd. (Shanghai, China).
Cervus 3.0 software [31] and GenALEx 6.5 [32] were used to estimate the following genetic diversity parameters: number of alleles (NA), number of effective alleles (NE), expected heterozygosity (HE), observed heterozygosity (HO), Shannon’s information index (I), polymorphic information content (PIC), Hardy–Weinberg Equilibrium (HWE), and the null allele frequency. The principal coordinates of four L. longirostris populations were estimated using GenALEx 6.5. The pairwise population genetic differentiation index (FST) and Nei’s genetic distance were estimated using GENEPOP V4 software [33]. An unweighted pair group method with arithmetic mean (UPGMA) tree based on Nei’s genetic distance among the four populations was constructed using MEGA 5.2 software [34]. STRUCTURE 2.3 software [35] was used to estimate the most likely value of genetic clusters (K). The number of K populations was set from 1 to 10, the number of replicates was 20,000, and the MCMC parameter was set to 100,000 times for calculation of the most likely number of genetic clusters (K). ADMIXTURE software [36] was used to estimate genetic admixture, he number of K populations was set from 1 to 10.

3. Results

A total of 399,740 microsatellite sequences were identified in this study, and the most repeats were dinucleotide motifs (297,200, 74.35%), trinucleotide motifs (46,879, 11.73%), and tetranucleotide motifs (49,767, 12.45%); pentanucleotide motifs (5,471, 1.37%) and hexanucleotide motifs (423, 0.10%) were relatively uncommon.
A total of 50 microsatellite loci primers were designed, of which 5 trinucleotide and 15 tetranucleotide microsatellite loci (GenBank accession numbers OM868049-OM868068) were selected to generate PCR products. NA ranged from 7 to 17, average NA for all 20 loci was 10.3, and average HO and HE were 0.8072 and 0.8104, respectively (Table 1). The PIC values of all 20 microsatellite loci of L. longirostris analyzed in this study ranged from 0.545 to 0.890. There were three loci (CLC5, CLC12, and CLC18) showing significant deviation from HWE (p < 0.05); after Bonferroni correction, CLC5 and CLC12 still showed significant deviation from HWE (Table 1).
The results of the genetic diversity analysis of the four L. longirostris populations using all 20 newly isolated microsatellite markers are shown in Table 2. The mean values of NA and NE indicate that fewer alleles were observed in the WH and SS populations collected from Hubei Province than in the MS and YB populations collected from Sichuan Province. HE, I, and PIC were lower in the WH and SS populations than in the MS and YB populations; the SS population had the lowest values among all populations.
Pairwise population FST values are shown in Table 3. The FST value was lowest between MS and YB (FST = 0.009) and highest between WH and SS (FST = 0.039). Overall, low levels of genetic differentiation were observed among the four L. longirostris populations.
A UPGMA phylogenetic tree and principal coordinates of four L. longirostris populations are shown in Figure 1. The MS population was situated close to the YB population within small-clustered groups; the two populations from Sichuan Province have similar genetic characteristics and are closer genetically compared with the WH and SS populations from Hubei Province. The SS population is genetically distant from the other populations.
The STRUCTURE analysis revealed that the delta-K value was highest when K = 3, indicating that the optimal number of populations of the four L. longirostris populations was three. When three clusters (K = 3) were assumed, the three populations were admixed with >85% of the SS population in the “blue” cluster and most individuals of the WH population in the “red” cluster (Figure 2). When three clusters (K = 3) were assumed, the results of the ADMIXTURE analysis were similar to that of the STRUCTURE analysis (Figure 3).

4. Discussion

Microsatellite markers are highly stable, polymorphic, and identifiable in genetic analyses [37]; thus, they have become a practical tool for population genetic studies of aquatic animals, such as Xenocypris davidi [28], Paralichthys adspersus [38], and Procypris rabaudi Tchang [39]. The trinucleotide and tetranucleotide repeats are less likely to be scored ambiguously and slip compared with dinucleotide repeats [30,40]. In our study, 5 trinucleotide and 15 tetranucleotide microsatellite loci were isolated in L. longirostris; all the new microsatellite loci were able to generate consistent and reliable polymorphic PCR products in 240 individuals from four L. longirostris populations. NA ranged from 7 to 17; after Bonferroni correction, CLC5 and CLC12 still significantly deviated from HWE (Table 1). Null alleles might cause deviation from HWE in the aforementioned loci because null alleles occur widely in organisms and are one of the main drivers of changes in population structure [28]. PIC takes into account not only the number of detected alleles but also the relative relatedness of those alleles [41]. According to previous studies, loci with PIC values greater than 0.5 are highly informative [42]. The PIC values of all the 20 microsatellite loci of L. longirostris analyzed in this study ranged from 0.545 to 0.890; thus, all loci were highly informative. These 20 microsatellite markers, therefore, are sufficient for discriminating among L. longirostris individuals and populations according to the results of previous studies employing combinations of microsatellite markers [42].
Artificial breeding technology of many aquatic animals, including L. longirostris, is relatively mature; nursery technology is well-developed; modern water treatment technology and Internet of Things technology have been increasingly used; and the degree of industrialization and informatization of nursery production has been greatly improved. This large-scale breeding technology system for aquatic fry has promoted the artificial propagation of fry and their transportation to different areas for breeding [43,44]. Unlike in wild populations, the genetic distance between farmed populations is not entirely determined by geographic location, but more so by the source of fry [45]. Due to sharp decreases in wild L. longirostris populations, the parents are mostly individuals that have been artificially bred for multiple generations. This, coupled with the introduction of parents and the use of unplanned fry production practices by many seedling farms, has resulted in the mixing of germplasm resources and a lack of uniformity in the quality of the fry produced and has restricted the development of the aquaculture industry [2,22]. Clarifying the genetic structure of L. longirostris populations is important for ensuring the efficacy of management practices and the sustainability of the growth in L. longirostris production. In this study, we characterized the genetic diversity of four representative L. longirostris fry production farms in two main L. longirostris production areas in Sichuan Province and Hubei Province. The results of the genetic diversity analysis for the four L. longirostris populations revealed that NA ranged from 7.85 to 9.75; HO (0.791–0.828) and HE (0.740–0.821) were greater than 0.6; and PIC (0.701–0.792) was greater than 0.5 (Table 2). The genetic diversity of the four L. longirostris populations was high according to the results of previous studies employing multiple microsatellite markers [42].
Polymorphism is an important parameter for selecting informative loci for primer evaluation and population analyses [41]. Microsatellite markers have been used to analyze genetic diversity in wild L. longirostris populations. For example, Wang et al. [26] used eight pairs of microsatellite primers to amplify sequences in 86 samples from four wild L. longirostris populations. NA counts in the four populations were 7.3, 5.6, 4.8, and 3.3, and HO values were 0.732, 0.312, 0.681, and 0.877. NA was lower in the study by Wang et al. than in this study (NA ranged from 7.85 to 9.75); additionally, HO of three of the four wild populations in the study by Wang et al. was lower than that of the four populations in this study (HO ranged from 0.791 to 0.828), which might be related to the number of microsatellite markers and the total number of samples. The sample size used for microsatellite analysis is positively correlated with the average PIC and NA [46]. Yang et al. [23] used 20 microsatellite markers (10 dinucleotide and 10 tri- and tetranucleotide) to analyze the genetic diversity of 132 samples which were collected in the upper–lower reaches of the Yangtze River; HO ranged from 0.8205 to 0.8697, and HE ranged from 0.7757 to 0.8300. HO and HE were higher in wild L. longirostris populations than in farmed L. longirostris (HO, 0.791–0.828; HE, 0.740–0.821), indicating that the genetic diversity of farmed L. longirostris was lower. Many seedling production farms pair multiple females with the same male to save costs, but this might result in the loss of genetic diversity.
Genetic distance calculations involve using allele frequency to describe the process of population differentiation, which is an effective method for analyzing populations [47]. The UPGMA tree and principal coordinates of the four L. longirostris populations revealed that the MS population was situated close the YB populations within small-clustered groups, and the two populations collected from Sichuan Province were closely related compared with the WH and SS populations from Hubei Province. The genetic characteristics of the MS and YB populations were similar, and the genetic structure of the SS population differed from that of the other populations. However, the FST values (0.009–0.039) among the four populations were less than 0.05 (Table 3); low levels of genetic differentiation were observed among these populations, and 0 < FST < 0.05 indicated that there was little genetic differentiation among the populations based on the results of a previous study [48]. Xiao et al. used mitochondrial DNA control region sequences to analyze the genetic diversity of three farmed L. longirostris populations in Meishan City, Shishou City, and Huainan City in 2013; the FST values among the three populations ranged from 0.0391 to 0.1024 [22]. The level of genetic differentiation among the four L. longirostris populations in this study was lower. The STRUCTURE analysis revealed the optimal number of populations of the four L. longirostris populations was three (K = 3). The STRUCTURE analysis indicated that MS and YB farms may collect some additional individuals from a common unknown origin. Results in Figure 3 indicate that there might be much admixture in all farms, thus suggesting adequate diversification policies in all farms. We speculated that the introduction of parents and the use of unplanned fry production practices in fry breeding farms have resulted in the mixing of germplasm resources and a reduction in the degree of genetic differentiation among populations.

5. Conclusions

Overall, the level of genetic differentiation among the four farmed L. longirostris populations was relatively low according to pairwise comparisons of FST values among the populations; however, the genetic diversity of these populations was high, which indicates that they still provide useful sources of genetic variation that could aid in breeding efforts. Preventing inbreeding is important for ensuring that the production of L. longirostris derived from farmed populations is sustainable over the long term. In our study, we isolated 20 new polymorphic microsatellite loci from the genome sequences of L. longirostris and validated the efficacy of these markers in four L. longirostris populations. These newly isolated microsatellite markers and the high genetic diversity of L. longirostris populations in the main breeding areas have important implications for the breeding and stock management of L. longirostris.

Author Contributions

Data curation, L.Z., H.Y., H.K. and Y.D.; funding acquisition, J.Z.; investigation, L.Z., C.M., Z.W., H.K., Z.H., Z.Z., H.Z. and H.L.; methodology, H.Y., J.D. and Q.L.; resources, J.Z., H.Y., Z.W., Z.Z., J.D. and Q.L.; software, H.Z.; writing—original draft, L.Z.; writing—review and editing, L.Z., J.Z. and Q.L. All authors have read and agreed to the published version of the manuscript.

Funding

The study was financed by the China Agriculture Research System of MOF and MARA (CARS-46), Sichuan Science and Technology Planning Project (2021YFYZ0015), and “1 + 9” open competition mechanism to select the best candidates, and scientific and technological project of Sichuan Academy of Agricultural Sciences (1 + 9KJGG004).

Institutional Review Board Statement

All experiments involving handling and treatment of fish were conducted in strict accordance with the recommendations in the Guide for the Animal Care and Use Committee of the Fishery Institute of the Sichuan Academy of Agricultural Sciences (20200116001A). All animal collection and use protocols were carried out in accordance with the guidelines and regulations for the care and use of laboratory animals at the Fishery Institute of the Sichuan Academy of Agricultural Sciences.

Data Availability Statement

Data available on request from the authors.

Acknowledgments

We thank the national Leiocassis longirostris Seed Farm in Hubei Province for providing the tail fin tissue samples of L. longirostris for this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Naylor, R.L.; Hardy, R.W.; Buschmann, A.H.; Bush, S.R.; Cao, L.; Klinger, D.H.; Little, D.C.; Lubchenco, J.; Shumway, S.E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591, 551–563. [Google Scholar] [CrossRef] [PubMed]
  2. He, W.P.; Zhou, J.; Li, Z.; Jing, T.S.; Li, C.H.; Yang, Y.J.; Xiang, M.B.; Zhou, C.W.; Lv, G.J.; Xu, H.Y.; et al. Chromosome-level genome assembly of the Chinese longsnout catfish Leiocassis longirostris. Zool. Res. 2021, 42, 417–422. [Google Scholar] [CrossRef] [PubMed]
  3. Hu, M.H.; Wang, Y.J. Biological characteristics and artificial breeding techniques of Leiocassis longirostris. Fish. Guide Be Rich 2006, 24, 27–29. [Google Scholar]
  4. Zhang, S.L.; Sun, X.J.; Zhang, X.; Zhi, Q.J.; Su, J.T.; Liang, Y.J.; Yang, P. Analysis of meat content and muscle nutrient components in the Chinese longsnout catfish. J. Dalian Ocean Univ. 2013, 28, 335–336. [Google Scholar]
  5. Gao, Y.X.; Zhang, H.X.; Hu, Y.M.; Li, Z.M.; Shang, X.H.; Zhao, Y.F.; Wu, Y.N. Fatty acid content of freshwater fishes in Dongting Lake. J. Food Hyg. China 2015, 27, 6–9. [Google Scholar]
  6. Hubert, N.; Pepey, E.; Mortillaro, J.M.; Steinke, D.; Verdal, H.D. Mitochondrial Genetic Diversity among Farmed Stocks of Oreochromis spp. (Perciformes, Cichlidae) in Madagascar. Diversity 2021, 13, 281. [Google Scholar] [CrossRef]
  7. Xiao, M.; Hu, Q.; Zhao, Y.; Bao, F. Development of SNP markers in Leiocassis longirostris Günther using high-throughput sequencing. Conserv. Genet. Resour. 2020, 12, 173–176. [Google Scholar] [CrossRef]
  8. Zeng, S.Q. A 10-year ban on fishing in the Yangtze river has led to an ecological war. Rural. Work. Newsl. 2020, 16, 13–15. [Google Scholar]
  9. Wang, D.; Wu, F.X.; Song, D.D.; Gao, H.Q.; Wang, Y.L.; Wang, J.X.; Wang, S.H.; Wang, X.H.; Wei, J.X.; Zhu, M.; et al. Bureau of Fisheries, Ministry of Agriculture and Rural Affairs of the People’s Republic of China. China Fishery Statistical Yearbook, 1st ed.; China Agriculture Press: Bejing, China, 2021. [Google Scholar]
  10. Luo, Y.H.; Zhang, Y.Y. Studies on the storage and artificial propagation techniques of Leiocassis longirostris. Freshw. Fish. 1986, 4, 5–9. [Google Scholar]
  11. Liu, F.R. Discussion on the practical technology of intensive culture of Leiocassis longirostris. Mod. Fish. Inf. 2003, 18, 22–25. [Google Scholar]
  12. Zhu, L.; Li, Z.H.; Li, X.X.; Yang, Z.Q. Artificial breeding and culture techniques of Leiocassis longirostris. J. Aquac. 2020, 41, 54–55. [Google Scholar]
  13. Jenkins, S.F.; Ishengoma, E.; Rhode, C. A temporal assessment of family composition and genetic diversity in a commercial cohort of Dusky Kob, Argyrosomus japonicus, across the production cycle. Aquaculture 2020, 516, 734640. [Google Scholar] [CrossRef]
  14. Skaala, Ø.; Høyheim, B.; Glovera, K.; Dahlea, G. Microsatellite analysis in domesticated and wild Atlantic salmon (Salmo salar L). Allelic Divers. Identif. Individ. Aquac. 2004, 240, 131–143. [Google Scholar]
  15. Frost, L.A.; Evans, B.S.; Jerry, D.R. Loss of genetic diversity due to hatchery culture practices in barramundi (Lates calcarifer). Aquaculture 2007, 261, 1056–1064. [Google Scholar] [CrossRef]
  16. Le, W.; Shi, X.; Su, Y.; Meng, Z.; Lin, H. Loss of Genetic Diversity in the Cultured Stocks of the Large Yellow Croaker, Larimichthys crocea, Revealed by Microsatellites. Int. J. Mol. Sci. 2012, 13, 5584–5597. [Google Scholar]
  17. Santos, C.H.A.; Santana, G.X.; Leitão, C.S.S.; Paula-Silva, M.N.; Almeida-Val, V.M.F. Loss of genetic diversity in farmed populations of Colossoma macropomum estimated by microsatellites. Anim. Genet. 2016, 47, 373–376. [Google Scholar] [CrossRef]
  18. Shan, B.B.; Liu, Y.; Song, N.; Yang, C.P.; Liu, S.G.; Gao, T.X.; Sun, D.R. Parentage determination of black sea bream (Acanthopagrus schlegelii) for stock enhancement: Effectiveness and loss of genetic variation. Acta Oceanol. Sin. 2021, 40, 41–49. [Google Scholar] [CrossRef]
  19. Rao, F.X. Biological characteristics of Leiocassis longirostris and its artificial propagation. Henan Fish. 1994, 4, 31–32. [Google Scholar]
  20. Zhang, Y.G.; Luo, Q.S.; Zhong, M.C. Study on the nesting and sperm structure of Leiocassis longirostris. Acta Hydrobiol. Sin. 1993, 17, 246–250. [Google Scholar]
  21. Wu, Y.J. Study on the simple method of fish sperm preservation. Inland Fish. 2003, 6, 31. [Google Scholar]
  22. Xiao, M.S.; Cui, F.; Jian, K.; Ma, Y.H. Analysis on sequence polymorphism of the mitochondrial DNA control region and population genetic diversity of the cultivated and natural chinese longsnout catfish (Leiocassis longirostris). Acta Hydrobiol. Sin. 2013, 37, 90–99. [Google Scholar]
  23. Yang, G.; Xiao, M.; Yu, Y.; Xu, S. Genetic variation at mtDNA and microsatellite loci in Chinese longsnout catfish (Leiocassis longirostris). Mol. Biol. Rep. 2012, 39, 4605–4617. [Google Scholar] [CrossRef] [PubMed]
  24. Mo, Y.X.; Wang, X.Q.; Mo, Y.L. RAPD analysis of genetic diversity of Leiocassis longirostris. Jiangxi Fish. Sci. Technol. 2010, 2, 13–16. [Google Scholar]
  25. Xiao, M.S.; Xia, H.W.; Ma, Y.H. Genetic variation of the Chinese longsnout catfish Leiocassis longirostris in the Yangtze River revealed using mitochondrial DNA cytochrome b sequences. Acta Ecol. Sin. 2012, 32, 305–313. [Google Scholar] [CrossRef]
  26. Wang, H.Y.; Huang, W.Q. Preliminary Analysis on the Genetic Diversity in Four Populations of Leiocassis longirostris by Using Microsatellite Markers. J. Henan Agric. Sci. 2011, 40, 146–148. [Google Scholar]
  27. Wang, Z.; Zhou, J.; Ye, Y.; Wei, Q.; Wu, Q. Genetic structure and low-genetic diversity suggesting the necessity for conservation of the Chinese Longsnout catfish, Leiocassis longirostris (Pisces: Bagriidae). Environ. Biol. Fishes 2006, 75, 455–463. [Google Scholar] [CrossRef]
  28. Guo, A.; Yuan, J.; Lian, Q.; Li, M.; Gu, Z. Isolation and characterization of 20 polymorphic microsatellites loci for Xenocypris davidi based on high-throughput sequencing. Mol. Biol. Rep. 2020, 47, 8305–8310. [Google Scholar] [CrossRef]
  29. Xiao, M.; Yang, G. Isolation and characterization of 17 microsatellite loci for the Chinese longsnout catfish (Leiocassis longirostris). Mol. Ecol. Resour. 2009, 9, 1039–1041. [Google Scholar] [CrossRef]
  30. Yu, Y.; Xiao, M.; Chen, L.; Yang, G. Isolation and characterization of microsatellite loci in the longsnout catfish (Leiocassis longirostris). Aquaculture Research,. 2009, 40, 246–248. [Google Scholar] [CrossRef]
  31. Marshall, T.C.; Slate, J.; Kruuk LE, B.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 1998, 7, 639–655. [Google Scholar] [CrossRef]
  32. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  33. Raymond, M.; Rousset, F. GENEPOP (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar] [CrossRef]
  34. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
  35. Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol Ecol Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef] [PubMed]
  36. Chakraborty, R.; Weiss, K.M. Admixture as a tool for finding linked genes and detecting that difference from allelic association between loci. Proc. Natl. Acad. Sci. USA 1988, 85, 9119–9123. [Google Scholar] [CrossRef]
  37. Yue, L.; Wang, Y.; Xian, W.; Zhang, H. Genetic Diversity and Population Structure of Portunus trituberculatus in Released and Wild Populations Based on Microsatellite DNA Markers from the Yangtze Estuary. Diversity 2022, 14, 374. [Google Scholar] [CrossRef]
  38. Sánchez-Velásqueza, J.J.; Pinedo-Bernalb, P.N.; Reyes-Floresa, L.E.; Yzásiga-Barreraa, C.; Zelada-Mázmela, E. Genetic diversity and relatedness inferred from microsatellite loci as a tool for broodstock management of fine flounder Paralichthys adspersus. Aquac. Fish. 2021, 7, 664–674. [Google Scholar] [CrossRef]
  39. Zhang, X.Y.; Yang, M.O.; Zhang, F.T.; Wang, J.W. Study on the genetic structure of wild and hatchery populations of Procypris rabaudi Tchang, an endemic fish in the upper Yangtze River. Fish. Res. 2022, 245, 106–134. [Google Scholar] [CrossRef]
  40. Lindqvist, A.K.; Magnusson, P.K.; Balciuniene, J.; Wadelius, C.; Lindholm, E.; Alarcon-Riquelme, M.E.; Gyllensten, U.B. Chromosome-specific panels of tri- and tetranucleotide microsatellite markers for multiplex fluorescent detection and automated genotyping: Evaluation of their utility in pathology and forensics. Genome Res. 1996, 6, 1170–1176. [Google Scholar] [CrossRef]
  41. Souza-Shibatta, L.; Ricardo, P.C.; Pina, W.C.; Flaresso-Neto, V.; Freiria, G.A.; Kotelok-Diniz, T.; Gaglianone, M.C.; Arias, M.C.; Sofia, S.H. Isolation and characterization of microsatellite markers in two species of the neotropical Epicharis (Hymenoptera, Apidae, Centridini) genus and cross-amplification in related species. Mol. Biol. Rep. 2021, 48, 1977–1983. [Google Scholar] [CrossRef]
  42. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar]
  43. Fisheries, C. Report on the development of Aquatic seed industry in China (From 1949 to 2019). China Fish. 2020, 9, 11–21. [Google Scholar]
  44. Bao, M.H.; Feng, J.; He, J.J.; He, X.P.; Ding, D.L. Main points of cultivation techniques for Leiocassis longirostris seedlings of the characteristic fish in the Yangtze River. China Fish. 2021, 8, 76–77. [Google Scholar]
  45. Shu, J.; Li, Q.; Yu, R.H.; Tian, C.Y. Microsatellites Analysis on Genetic Variation Between Wild and Cultured Populations of Pacific Abalone (Haliotis discus hannai). Period. Ocean Univ. China 2008, 38, 52–58. [Google Scholar]
  46. Zhang, L.X.; Ding, F.X.; Zhao, X.H.; Wang, J.Y.; Jin, C.F.; Zhang, L. Effects of sample size and gender on population genetic diversity in microsatellite analysis. Anim. Husb. Vet. Med. 2011, 43, 36–39. [Google Scholar]
  47. Seo, D.; Bhuiyan MS, A.; Sultana, H.; Heo, J.M.; Lee, J.H. Genetic Diversity Analysis of South and East Asian Duck Populations Using Highly Polymorphic Microsatellite Markers. Asian-Australas. J. Anim. Sci. 2016, 29, 471–478. [Google Scholar] [CrossRef] [PubMed]
  48. Ma, X.Y.; Wang, W.; Pang, Y.Z.; Chen, W.G.; Yang, Y.B. Microsatellite marker analysis of genetic diversity in the two populations of Yellow River carps. Heilongjiang Anim. Sci. Vet. Med. 2016, 12, 22–26. [Google Scholar]
Diversity 14 00654 g001 550
Figure 1. (a) UPGMA phylogenetic tree of four L. longirostris populations according to 20 microsatellite loci; (b) principal coordinates of four L. longirostris populations according to 20 microsatellite loci.
Figure 1. (a) UPGMA phylogenetic tree of four L. longirostris populations according to 20 microsatellite loci; (b) principal coordinates of four L. longirostris populations according to 20 microsatellite loci.
Diversity 14 00654 g001
Diversity 14 00654 g002 550
Figure 2. STRUCTURE bar plots for four populations of L. longirostris (K = 3).
Figure 2. STRUCTURE bar plots for four populations of L. longirostris (K = 3).
Diversity 14 00654 g002
Diversity 14 00654 g003 550
Figure 3. ADMIXTURE bar plots for four populations of L. longirostris (K = 3).
Figure 3. ADMIXTURE bar plots for four populations of L. longirostris (K = 3).
Diversity 14 00654 g003
Table
Table 1. Twenty new microsatellite primers for L. longirostris.
Table 1. Twenty new microsatellite primers for L. longirostris.
Locus NameAccession NumberPrimer Sequence (5′ - 3′)Fluorescent TypeNNASize (bp)Repeat MotifTa (°C)HoHEPICPHWENull Alleles
CLC01OM868049F:CCCATTCTGTCTTCAAATCTAAGC
R:GCCAATGCTCTACTATGCTTGTC		5′6-FAM24010108-144(AGAT)14540.6880.6890.6500.29510.0016
CLC02OM868050F:GGAAGAGAAACCAGTGTGTAGCA
R:CATGAGGTGCTGAAGTCCACTAT		5′6-FAM2407106-124(AAG)16560.5960.5820.5450.5313−0.0138
CLC03OM868051F:GGGTGAGAAGGATAGGAAAGAAA
R:TTTAACAACCCATGAATTAAAAACC		5′6-FAM2401288-140(AGAT)17540.8830.8610.8440.0069−0.0164
CLC04OM868052F:TTTAATGGGAAAGTTTAATGGATCA
R:CTGTACTGCTTCCACCTGATTG		5′6-FAM2409103-135(TAGA)14550.8170.8420.8220.61460.0157
CLC05OM868053F:AATAAACAAGGAAAATAATTGCTGG
R:ATTGATGGCTAATTTTGCTGGTA		5′6-FAM2409100-127(TAG)18540.8130.8400.8170.0011 *0.0158
CLC06OM868054F:ATGTTGGTATATGAAGCCTGGAT
R:TGACAGTATTTCCTCCATCATCA		5′6-FAM24011106-136(AAG)15540.8540.8340.8110.2034−0.0133
CLC07OM868055F:TCTGAAGTTGACCGTATGCTTTT
R:CTTTCTTTCTCCATTGTCACCAC		5′6-FAM24012153-193(AGAT)15560.8790.8590.8400.1704−0.0128
CLC08OM868056F:CGTAGTGCTATTTGGGGTATTGA
R:TTGTCCTACAATATTCCATGTTTGTT		5′6-FAM2408156-188(ATAG)15550.8290.8100.7820.1714−0.0112
CLC09OM868057F:GAACCACTTGCAGAATAAACACC
R:TCATGATCAAAGTTCCTGACTTAAA		5′6-FAM2408150-182(TAGA)15560.8250.8200.7940.5680−0.004
CLC10OM868058F:CGCTCTGAGAAAGAAAAACTCAT
R:GAACTTTAGATTCTCGGAAGGAAA		5′6-FAM2408159-191(TAGA)15550.7790.8350.8140.56090.0312
CLC11OM868059F:TGAGCAAACATGATTTGAATTTG
R:TGTTCAAACATTTGCATCATTTC		5′-HEX2409168-207(AAG)17540.7250.7410.7070.31280.0088
CLC12OM868060F:GCAATCCTCCAAAGATATTCCTC
R:CATGTTTTTGAGGATGAGACTTTTT		5′-HEX24017194-258(TAGA)21540.8630.9000.8900.0003 **0.022
CLC13OM868061F:TCCCAGGTTATGAGTTATGGTGT
R:GCTTTACTTCTCTAAAACAGCTCTGA		5′-HEX2409221-245(AAG)17550.8130.8030.7790.0217−0.0098
CLC14OM868062F:TTACTGGGGATAGATAGATGGCT
R:TCTTTGTCTGTCTATGTATCTGCCT		5′-HEX24017138-238(TAGA)22540.8040.8360.8170.42360.0207
CLC15OM868063F:TGAGGTTGAGGTATAAAGGGAAAC
R:CACTATCTTTTTCCATCCTTTCCA		5′-HEX24010206-246(TAGA)16530.8670.8020.7810.0053−0.0474
CLC16OM868064F:GGAGAAACGTCTCAATTCACTGT
R:CGTGCACATAGTTTATGCTGAGA		5′-HEX24013202-259(AGAT)15560.8250.8380.8200.28430.0067
CLC17OM868065F:AAATACCGTATACACATGGGGGT
R:CACAAGGACAAAAATGGTGTTTT		5′-HEX2408218-246(TAGA)15560.8000.8330.8080.02960.0199
CLC18OM868066F:TTTACAAGCCAAGCTGAAAGAAT
R:CCACTCTCATAATGTCTCTGTTTCA		5′-HEX24012197-243(ATAG)20560.7710.8330.8160.00440.044
CLC19OM868067F:GCCTGAAAAATGTGTTCCTTTTA
R:TGCCTCTTATTCAAAGGCTTTAC		5′-HEX2409223-256(AGAT)15540.8460.8000.7730.0296−0.0273
CLC20OM868068F:AAAATTGGTTTGAAGATGAAGCA
R:TATGGCAATGTGGTGCAAAT		5′-HEX24012216-256(TAGA)18540.8670.8500.8330.2817−0.0132
N, number of samples; NA, number of different alleles; Ta, annealing temperature; HO, observed heterozygosity; HE, unbiased expected heterozygosity; PIC, polymorphic information content; PHWE, p-value for the Hardy–Weinberg equilibrium; * p < 0.005 and ** p < 0.0025 significance after Bonferroni correction.
Table
Table 2. Genetic diversity of four L. longirostris populations by 20 microsatellite loci (Mean ± SE).
Table 2. Genetic diversity of four L. longirostris populations by 20 microsatellite loci (Mean ± SE).
PopulationNNANEIHOHEPIC
MS609.750 ± 0.5425.771 ± 0.3841.897 ± 0.0670.791 ± 0.0190.813 ± 0.0200.784 ± 0.021
WH608.700 ± 0.4494.624 ± 0.3041.695 ± 0.0660.828 ± 0.0210.768 ± 0.0190.730 ± 0.022
SS607.850 ± 0.5194.065 ± 0.2591.588 ± 0.0550.806 ± 0.0220.740 ± 0.0180.701 ± 0.018
YB609.750 ± 0.5425.683 ± 0.2771.915 ± 0.0500.803 ± 0.0190.821 ± 0.0120.792 ± 0.013
N, number of samples; NA, number of different alleles; NE, number of effective alleles; I, Shannon’s information index; HO, observed heterozygosity; HE, unbiased expected heterozygosity; PIC, polymorphic information content.
Table
Table 3. Pairwise population genetic differentiation index (FST) of four L. longirostris populations.
Table 3. Pairwise population genetic differentiation index (FST) of four L. longirostris populations.
PopulationMSSSWHYB
MS0.000
SS0.0280.000
WH0.0190.0390.000
YB0.0090.0310.0230.000
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, L.; Mou, C.; Zhou, J.; Ye, H.; Wei, Z.; Ke, H.; Huang, Z.; Duan, Y.; Zhao, Z.; Zhao, H.; et al. Genetic Diversity of Chinese Longsnout Catfish (Leiocassis longirostris) in Four Farmed Populations Based on 20 New Microsatellite DNA Markers. Diversity 2022, 14, 654. https://0-doi-org.brum.beds.ac.uk/10.3390/d14080654

AMA Style

Zhang L, Mou C, Zhou J, Ye H, Wei Z, Ke H, Huang Z, Duan Y, Zhao Z, Zhao H, et al. Genetic Diversity of Chinese Longsnout Catfish (Leiocassis longirostris) in Four Farmed Populations Based on 20 New Microsatellite DNA Markers. Diversity. 2022; 14(8):654. https://0-doi-org.brum.beds.ac.uk/10.3390/d14080654

Chicago/Turabian Style

Zhang, Lu, Chenyan Mou, Jian Zhou, Hua Ye, Zhen Wei, Hongyu Ke, Zhipeng Huang, Yuanliang Duan, Zhongmeng Zhao, Han Zhao, and et al. 2022. "Genetic Diversity of Chinese Longsnout Catfish (Leiocassis longirostris) in Four Farmed Populations Based on 20 New Microsatellite DNA Markers" Diversity 14, no. 8: 654. https://0-doi-org.brum.beds.ac.uk/10.3390/d14080654

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop