Short Duplex Module Coupled to G-Quadruplexes Increases Fluorescence of Synthetic GFP Chromophore Analogues
Abstract
:1. Introduction
2. Materials and Methods
2.1. Synthesis of BO and GFP Chromophore Analogues
2.2. Oligonucleotides
2.3. CD Spectra and Melting Experiments
2.4. Measurement of Fluorescence and Absorption Spectra
2.5. Primary and Secondary screening of the fluorophore library
3. Results and discussion
3.1. Interaction of GFP Chromophore Analogues with TBA15 and TBA31
3.2. Interaction of GFP Chromophore Analogues with Truncated (TBA25) and Elongated (TBA63) Versions of TBA31
3.3. Interaction of GFP Chromorophore Analogues with Ribo-Variants of TBA
3.4. Interaction of GFP Chromophore Analogues with Alternative G4 Structures (LTR-III and Tel23a) Containing Additional Stabilizing Elements
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment-Rna Ligands to Bacteriophage-T4 DNA-Polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Munzar, J.D.; Ng, A.; Juncker, D. Duplexed aptamers: History, design, theory, and application to biosensing. Chem. Soc. Rev. 2019, 48, 1390–1419. [Google Scholar] [CrossRef] [PubMed]
- Ni, S.J.; Yao, H.Z.; Wang, L.L.; Lu, J.; Jiang, F.; Lu, A.P.; Zhang, G. Chemical Modifications of Nucleic Acid Aptamers for Therapeutic Purposes. Int. J. Mol. Sci. 2017, 18, 1683. [Google Scholar] [CrossRef] [PubMed]
- Platella, C.; Riccardi, C.; Montesarchio, D.; Roviello, G.N.; Musumeci, D. G-quadruplex-based aptamers against protein targets in therapy and diagnostics. Biochim. Et Biophys. Acta Gen. Subj. 2017, 1861, 1429–1447. [Google Scholar] [CrossRef]
- Zhou, J.H.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Li, D.; Xu, F.Z.; He, X.X.; Wang, K.M.; Ye, X.S.; Tang, J.T.; He, C.M. A label-free activatable aptamer probe for colorimetric detection of cancer cells based on binding-triggered in situ catalysis of split DNAzyme. Analyst 2014, 139, 4181–4184. [Google Scholar] [CrossRef]
- Ramya, A.N.; Joseph, M.M.; Nair, J.B.; Karunakaran, V.; Narayanan, N.; Maiti, K.K. New Insight of Tetraphenylethylene-based Raman Signatures for Targeted SERS Nanoprobe Construction Toward Prostate Cancer Cell Detection. ACS Appl. Mater. Inter. 2016, 8, 10220–10225. [Google Scholar] [CrossRef]
- Wang, H.X.; Zhao, Y.W.; Li, Z.; Liu, B.S.; Zhang, D. Development and Application of Aptamer-Based Surface-Enhanced Raman Spectroscopy Sensors in Quantitative Analysis and Biotherapy. Sens. Basel 2019, 19, 3806. [Google Scholar] [CrossRef] [Green Version]
- Hianik, T.; Wang, J. Electrochemical Aptasensors-Recent Achievements and Perspectives. Electroanal 2009, 21, 1223–1235. [Google Scholar] [CrossRef]
- Wang, R.E.; Zhang, Y.; Cai, J.; Cai, W.; Gao, T. Aptamer-Based Fluorescent Biosensors. Curr. Med. Chem. 2011, 18, 4175–4184. [Google Scholar] [CrossRef]
- Peeters, M.; Jiménez-Monroy, K.L.; Libert, C.; Eurlings, Y.; Cuypers, W.; Wackers, G.; Duchateau, S.; Robaeys, P.; Nesládek, M.; van Grinsven, B.; et al. Real-Time Monitoring of Aptamer Functionalization and Detection of Ara H1 by Electrochemical Impedance Spectroscopy and Dissipation-Mode Quartz Crystal Microbalance. J. Biosens. Bioelectron. 2014, 5, 155. [Google Scholar]
- van Grinsven, B.; Eersels, K.; Peeters, M.; Losada-Perez, P.; Vandenryt, T.; Cleij, T.J.; Wagner, P. The Heat-Transfer Method: A Versatile Low-Cost, Label-Free, Fast, and User-Friendly Readout Platform for Biosensor Applications. ACS Appl. Mater. Inter. 2014, 6, 13309–13318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, J.; Hu, Y.; Yoon, J. Fluorescent probes and bioimaging: Alkali metals, alkaline earth metals and pH. Chem. Soc. Rev. 2015, 44, 4619–4644. [Google Scholar] [CrossRef] [PubMed]
- Vendrell, M.; Zhai, D.T.; Er, J.C.; Chang, Y.T. Combinatorial Strategies in Fluorescent Probe Development. Chem. Rev. 2012, 112, 4391–4420. [Google Scholar] [CrossRef] [PubMed]
- Stojanovic, M.N.; Kolpashchikov, D.M. Modular aptameric sensors. J. Am. Chem. Soc. 2004, 126, 9266–9270. [Google Scholar] [CrossRef]
- Kolpashchikov, D.M. Binary malachite green aptamer for fluorescent detection of nucleic acids. J. Am. Chem. Soc. 2005, 127, 12442–12443. [Google Scholar] [CrossRef]
- Kikuchi, N.; Kolpashchikov, D.M. Split Spinach Aptamer for Highly Selective Recognition of DNA and RNA at Ambient Temperatures. Chembiochem 2016, 17, 1589–1592. [Google Scholar] [CrossRef] [Green Version]
- Kikuchi, N.; Kolpashchikov, D.M. A universal split spinach aptamer (USSA) for nucleic acid analysis and DNA computation. Chem. Commun. 2017, 53, 4977–4980. [Google Scholar] [CrossRef]
- Kato, T.; Shimada, I.; Kimura, R.; Hyuga, M. Light-up fluorophore-DNA aptamer pair for label-free turn-on aptamer sensors. Chem. Commun. 2016, 52, 4041–4044. [Google Scholar] [CrossRef]
- Kikuchi, N.; Reed, A.; Gerasimova, Y.V.; Kolpashchikov, D.M. Split Dapoxyl Aptamer for Sequence-Selective Analysis of Nucleic Acid Sequence Based Amplification Amplicons. Anal. Chem. 2019, 91, 2667–2671. [Google Scholar] [CrossRef]
- Zhang, Z.X.; Sharon, E.; Freeman, R.; Liu, X.Q.; Willner, I. Fluorescence Detection of DNA, Adenosine-5 ‘-Triphosphate (ATP), and Telomerase Activity by Zinc(II)-Protoporphyrin IX/G-Quadruplex Labels. Anal. Chem. 2012, 84, 4789–4797. [Google Scholar] [CrossRef] [PubMed]
- Tan, X.H.; Wang, Y.; Armitage, B.A.; Bruchez, M.P. Label-free Molecular Beacons for Biomolecular Detection. Anal. Chem. 2014, 86, 10864–10869. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Gao, W.; Tian, Z.R.; Yang, C.; Lu, L.H.; Mergny, J.L.; Leung, C.H.; Ma, D.L. Luminescence switch-on detection of protein tyrosine kinase-7 using a G-quadruplex-selective probe. Chem. Sci. 2015, 6, 4284–4290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.; Zhao, J.H.; Lu, S.S.; Sun, J.; Yang, X.R. A duplex connection can further illuminate G-quadruplex/crystal violet complex. Chem. Commun. 2019, 55, 1911–1914. [Google Scholar] [CrossRef] [PubMed]
- Bock, L.C.; Griffin, L.C.; Latham, J.A.; Vermaas, E.H.; Toole, J.J. Selection of Single-Stranded-DNA Molecules That Bind and Inhibit Human Thrombin. Nature 1992, 355, 564–566. [Google Scholar] [CrossRef]
- Padmanabhan, K.; Padmanabhan, K.P.; Ferrara, J.D.; Sadler, J.E.; Tulinsky, A. The Structure of Alpha-Thrombin Inhibited by a 15-Mer Single-Stranded-DNA Aptamer. J. Biol. Chem. 1993, 268, 17651–17654. [Google Scholar]
- Ikebukuro, K.; Okumura, Y.; Sumikura, K.; Karube, I. A novel method of screening thrombin-inhibiting DNA aptamers using an evolution-mimicking algorithm. Nucleic Acids Res. 2005, 33, e108. [Google Scholar] [CrossRef] [Green Version]
- Mazurov, A.V.; Titaeva, E.V.; Khaspekova, S.G.; Storojilova, A.N.; Spiridonova, V.A.; Kopylov, A.M.; Dobrovolsky, A.B. Characteristics of a New DNA Aptamer, Direct Inhibitor of Thrombin. B Exp. Biol. Med. 2011, 150, 422–425. [Google Scholar] [CrossRef]
- Krauss, I.R.; Spiridonova, V.; Pica, A.; Napolitano, V.; Sica, F. Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding. Nucleic Acids Res. 2016, 44, 983–991. [Google Scholar]
- Zavyalova, E.; Samoylenkova, N.; Revishchin, A.; Turashev, A.; Gordeychuk, I.; Golovin, A.; Kopylov, A.; Pavlova, G. The Evaluation of Pharmacodynamics and Pharmacokinetics of Anti-thrombin DNA Aptamer RA-36. Front Pharm. 2017, 8, 922. [Google Scholar] [CrossRef] [Green Version]
- Troisi, R.; Napolitano, V.; Spiridonova, V.; Krauss, I.R.; Sica, F. Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer. Nucleic Acids Res. 2018, 46, 12177–12185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turaev, A.V.; Tsvetkov, V.B.; Tankevich, M.V.; Smirnov, I.P.; Aralov, A.V.; Pozmogova, G.E.; Varizhuk, A.M. Benzothiazole-based cyanines as fluorescent “light-up” probes for duplex and quadruplex DNA. Biochimie 2019, 162, 216–228. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Suslov, N.B.; Li, N.S.; Shelke, S.A.; Evans, M.E.; Koldobskaya, Y.; Rice, P.A.; Piccirilli, J.A. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore. Nat. Chem. Biol. 2014, 10, 686–691. [Google Scholar] [CrossRef] [PubMed]
- Butovskaya, E.; Heddi, B.; Bakalar, B.; Richter, S.N.; Phan, A.T. Major G-Quadruplex Form of HIV-1 LTR Reveals a (3+1) Folding Topology Containing a Stem-Loop. J. Am. Chem. Soc. 2018, 140, 13654–13662. [Google Scholar] [CrossRef] [Green Version]
- Warner, K.D.; Chen, M.C.; Song, W.J.; Strack, R.L.; Thorn, A.; Jaffrey, S.R.; Ferre-D’Amare, A.R. Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat. Struct. Mol. Biol. 2014, 21, 658–663. [Google Scholar] [CrossRef]
- Trachman, R.J.; Autour, A.; Jeng, S.C.Y.; Abdolahzadeh, A.; Andreoni, A.; Cojocaru, R.; Garipov, R.; Dolgosheina, E.V.; Knutson, J.R.; Ryckelynck, M.; et al. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nat. Chem. Biol. 2019, 15, 472–479. [Google Scholar] [CrossRef]
- Dai, J.X.; Carver, M.; Punchihewa, C.; Jones, R.A.; Yang, D.Z. Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: Insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res. 2007, 35, 4927–4940. [Google Scholar] [CrossRef] [Green Version]
- Ambrus, A.; Chen, D.; Dai, J.X.; Bialis, T.; Jones, R.A.; Yang, D.Z. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 2006, 34, 2723–2735. [Google Scholar] [CrossRef] [Green Version]
Code | Sequence (5′→3′) | Tm °C |
---|---|---|
TBA15 | GGTTGGTGTGGTTGG | 53 ± 1 |
TBA25 | TGGTAGGTTGGTGTGGTTGGGGCCA | 45 ± 2; 65 ± 2 a |
TBA31 | CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG | 54 ± 3; 66 ± 1 a |
TBA63 | ATAAAATAAAAAATTACACTGGTAGGTTGGTGTGGTTGGGGCCAGTGTAATTTTTTATTTTAT | 57 ± 3; 67 ± 1 a |
ON1 | ATAAAATAAAAAATTACACTGG | 57 ± 1 |
ON2 | CCAGTGTAATTTTTTATTTTAT | |
ON15 | r(GGUUGGUGUGGUUGG) | 47 ± 2 |
ON31 | r(CACUGGUAGGUUGGUGUGGUUGGGGCCAGUG) | 63 ± 1 |
LTR-III | GGGAGGCGTGGCCTGGGCGGGACTGGGG | 71 ± 2 |
Tel23a | AGGGTTAGGGTTAGGGTTAGGGT | 69 ± 1 |
Compound # | Fluorescence Intensity Enhancement | ||||||||
---|---|---|---|---|---|---|---|---|---|
TBA31 | TBA 15 | TBA25 | TBA63 | ON1+2 | ON31 | ON15 | LTR-III | Tel23a | |
1a | 7.9 ± 0.08 | 2.2 ± 0.09 | 15.9 ± 0.24 | 2.3 ± 0.07 | 1.1 ± 0.08 | 2.7 ± 0.05 | 1.7 ± 0.03 | 3.0 ± 0.08 | 2.5 ± 0.05 |
1b | 7.4 ± 0.08 | 2.0 ± 0.08 | 11.8 ± 0.20 | 2.9 ± 0.12 | 1.2 ± 0.06 | 2.7 ± 0.12 | 1.7 ± 0.08 | 5.2 ± 0.06 | 3.5 ± 0.10 |
1c | 7.5 ± 0.16 | 2.3 ± 0.04 | 14.9 ± 0.21 | 2.8 ± 0.09 | 1.1 ± 0.04 | 3.2 ± 0.10 | 1.8 ± 0.06 | 5.1 ± 0.14 | 3.4 ± 0.08 |
1d | 9.9 ± 0.12 | 2.5 ± 0.03 | 23.0 ± 0.25 | 3.2 ± 0.03 | 1.1 ± 0.07 | 3.1 ± 0.10 | 2.4 ± 0.09 | 3.9 ± 0.08 | 3.7 ± 0.14 |
1e | 12.3 ± 0.13 | 2.6 ± 0.05 | 20.6 ± 0.29 | 2.8 ± 0.10 | 1.1 ± 0.05 | 3.6 ± 0.07 | 2.0 ± 0.05 | 8.1 ± 0.11 | 4.7 ± 0.07 |
1f | 7.9 ± 0.17 | 2.0 ± 0.09 | 8.8 ± 0.18 | 1.8 ± 0.07 | 1.1 ± 0.08 | 2.5 ± 0.03 | 1.5 ± 0.09 | 4.2 ± 0.10 | 2.8 ± 0.02 |
2 | 10.1 ± 0.16 | 2.4 ± 0.02 | 8.7 ± 0.17 | 1.4 ± 0.05 | 1.5 ± 0.02 | 6.2 ± 0.12 | 6.1 ± 0.10 | 3.4 ± 0.13 | 2.6 ± 0.05 |
3 | 18.8 ± 0.28 | 2.1 ± 0.12 | 19.1 ± 0.21 | 12.1 ± 0.15 | 4.0 ± 0.09 | 6.2 ± 0.14 | 2.1 ± 0.03 | 3.4 ± 0.12 | 12.4 ± 0.19 |
4 | 16.5 ± 0.18 | 3.3 ± 0.13 | 11.4 ± 0.18 | 4.2 ± 0.13 | 1.2 ± 0.03 | 6.8 ± 0.13 | 2.6 ± 0.09 | 14.9 ± 0.20 | 6.2 ± 0.12 |
5a | 12.4 ± 0.20 | 3.3 ± 0.06 | 10.1 ± 0.10 | 5.6 ± 0.12 | 1.3 ± 0.04 | 3.6 ± 0.07 | 1.9 ± 0.07 | 2.7 ± 0.10 | 2.0 ± 0.02 |
5b | 12.1 ± 0.15 | 3.0 ± 0.06 | 10.6 ± 0.13 | 2.0 ± 0.07 | 1.1 ± 0.04 | 3.3 ± 0.03 | 1.4 ± 0.11 | 2.3 ± 0.06 | 2.7 ± 0.01 |
6 | 20.5 ± 0.22 | 2.9 ± 0.11 | 31.7 ± 0.40 | 4.8 ± 0.13 | 1.9 ± 0.02 | 19.0 ± 0.25 | 7.1 ± 0.09 | 4.9 ± 0.09 | 7.1 ± 0.16 |
7 | 8.2 ± 0.09 | 2.0 ± 0.10 | 14.3 ± 0.20 | 2.3 ± 0.09 | 1.1 ± 0.06 | 4.6 ± 0.13 | 2.1 ± 0.03 | 2.9 ± 0.05 | 2.1 ± 0.05 |
8 | 9.2 ± 0.12 | 2.3 ± 0.06 | 18.1 ± 0.18 | 2.4 ± 0.05 | 1.2 ± 0.04 | 11.0 ± 0.13 | 4.7 ± 0.11 | 1.8 ± 0.07 | 3.5 ± 0.07 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zaitseva, S.O.; Baleeva, N.S.; Zatsepin, T.S.; Myasnyanko, I.N.; Turaev, A.V.; Pozmogova, G.E.; Khrulev, A.A.; Varizhuk, A.M.; Baranov, M.S.; Aralov, A.V. Short Duplex Module Coupled to G-Quadruplexes Increases Fluorescence of Synthetic GFP Chromophore Analogues. Sensors 2020, 20, 915. https://0-doi-org.brum.beds.ac.uk/10.3390/s20030915
Zaitseva SO, Baleeva NS, Zatsepin TS, Myasnyanko IN, Turaev AV, Pozmogova GE, Khrulev AA, Varizhuk AM, Baranov MS, Aralov AV. Short Duplex Module Coupled to G-Quadruplexes Increases Fluorescence of Synthetic GFP Chromophore Analogues. Sensors. 2020; 20(3):915. https://0-doi-org.brum.beds.ac.uk/10.3390/s20030915
Chicago/Turabian StyleZaitseva, Snizhana O., Nadezhda S. Baleeva, Timofei S. Zatsepin, Ivan N. Myasnyanko, Anton V. Turaev, Galina E. Pozmogova, Alexei A. Khrulev, Anna M. Varizhuk, Mikhail S. Baranov, and Andrey V. Aralov. 2020. "Short Duplex Module Coupled to G-Quadruplexes Increases Fluorescence of Synthetic GFP Chromophore Analogues" Sensors 20, no. 3: 915. https://0-doi-org.brum.beds.ac.uk/10.3390/s20030915