Quantification of Protozoa and Viruses from Small Water Volumes
Abstract
:1. Introduction
2. Experimental Section
2.1. Sample Collection and Preparation
Trial | Cryptosporidium per 200 µL | Giardia per 200 µL | Poliovirus per mL | |||
---|---|---|---|---|---|---|
qPCR | IMS/IFA | qPCR | IMS/IFA | qPCR | Plaque Assay | |
A | 240 | 232 | 184 | 128 | − | − |
B | 372 | 102 | 367 | 262 | 634 | − |
C | 452 | − | 384 | − | 834 | 240 |
2.2. Filtration Setup and Procedure
2.3. Elution and Analysis of Protozoa from Top Membrane
2.4. Elution and Analysis of Viruses from Bottom Membrane
2.5. Reverse Transcription and Quantitative PCR Analysis
Target (Ref.) | Sequence 5′–3′ |
---|---|
Giardia spp. [42] | |
Primer G101 | CATCCGCGAGGAGGTCAA |
Primer G102 | GCAGCCATGGTGTCGATCT |
Probe G103 | 6FAM-AAGTCCGCCGACAACATGTACCTAACGA-IB |
Cryptosporidium spp. [42] | |
Primer C104 | CAAATTGATACCGTTTGTCCTTCTG |
Primer C105 | GGCATGTCGATTCTAATTCAGCT |
Probe C106 | 6FAM-TGCCATACATTGTTGTCCTGACAAATTGAAT-IB |
Poliovirus [43] | |
Primer P107 | CCTCCGGCCCCTGAATG |
Primer P108 | ACCGGATGGCCAATCCAA |
Probe P109 | 6FAM-CGACTACTTTGGGTGTCCGTGTTTCC-IB |
Internal control nucleic acid (This study) | |
Primer P110 | CATGATAAGGTTTTGAGCTCTGTGTATTG |
Primer P111 | TCCTTTTTGTGCATAACCTGATTTAA |
Probe P112 | 6FAM- ACATATGTAAAAGAGAGCTTC-MGBNFQ |
3. Results
Trial/Replicate | Percent Recovery | |||
---|---|---|---|---|
Cryptosporidium | Giardia | |||
qPCR | IMS/IFA | qPCR | IMS/IFA | |
A1 | 55 | 61 | 98 | 34 |
A2 | 51 | 52 | 49 | 38 |
B1 | 23 | 116 | 40 | 34 |
B2 | 39 | 145 | 2 | 20 |
B3 | 22 | 83 | 61 | 13 |
C1 | 85 | − | 16 | − |
C2 | 56 | − | 48 | − |
C3 | 52 | − | 25 | − |
C4 | 23 | − | 31 | − |
Average | 45 | 91 | 41 | 28 |
Std. Deviation | 21 | 39 | 26 | 11 |
Trial/Replicate | Poliovirus Percent Recovery | |
---|---|---|
qPCR | Plaque Assay | |
B1 | 86 | − |
B2 | 106 | − |
C1 | 13 | 75 |
C2 | 68 | 41 |
C3 | 22 | 83 |
C4 | 34 | |
Average | 55 | 67 |
Std. Deviation | 37 | 22 |
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Pruss, A.; Kay, D.; Fewtrell, L.; Bartram, J. Estimating the burden of disease from water, sanitation, and hygiene at a global level. Environ. Health Perspect. 2002, 110, 537–542. [Google Scholar] [CrossRef] [PubMed]
- Shuval, H. Estimating the global burden of thalassogenic diseases: Human infectious diseases caused by wastewater pollution of the marine environment. J. Water Health 2003, 1, 53–64. [Google Scholar] [PubMed]
- Fong, T.T.; Lipp, E.K. Enteric viruses of humans and animals in aquatic environments: Health risks, detection, and potential water quality assessment tools. Microbiol. Mol. Biol. Rev. 2005, 69, 357–371. [Google Scholar] [CrossRef] [PubMed]
- Wait, D.A.; Sobsey, M.D. Comparative survival of enteric viruses and bacteria in atlantic ocean seawater. Water Sci. Technol. 2001, 43, 139–142. [Google Scholar] [PubMed]
- Wetz, J.J.; Lipp, E.K.; Griffin, D.W.; Lukasik, J.; Wait, D.; Sobsey, M.D.; Scott, T.M.; Rose, J.B. Presence, infectivity, and stability of enteric viruses in seawater: Relationship to marine water quality in the florida keys. Mar. Pollut. Bull. 2004, 48, 698–704. [Google Scholar] [CrossRef] [PubMed]
- Bonilla, T.D.; Nowosielski, K.; Cuvelier, M.; Hartz, A.; Green, M.; Esiobu, N.; McCorquodale, D.S.; Fleisher, J.M.; Rogerson, A. Prevalence and distribution of fecal indicator organisms in south florida beach sand and preliminary assessment of health effects associated with beach sand exposure. Mar. Pollut. Bull. 2007, 54, 1472–1482. [Google Scholar] [CrossRef] [PubMed]
- Elmir, S.M.; Wright, M.E.; Abdelzaher, A.; Solo-Gabriele, H.M.; Fleming, L.E.; Miller, G.; Rybolowik, M.; Peter Shih, M.T.; Pillai, S.P.; Cooper, J.A.; et al. Quantitative evaluation of bacteria released by bathers in a marine water. Water Res. 2007, 41, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.C.; Chu, W. PCR detection of pathogenic viruses in southern California urban rivers. J. Appl. Microbiol. 2004, 97, 17–28. [Google Scholar] [CrossRef] [PubMed]
- Pant, A.; Mittal, A.K. Monitoring of pathogenicity of effluents from the uasb based sewage treatment plant. Environ. Monit. Assess. 2007, 133, 43–51. [Google Scholar] [CrossRef] [PubMed]
- Rose, J.B.; Huffman, D.E.; Gennaccaro, A. Risk and control of waterborne cryptosporidiosis. FEMS Microbiol. Rev. 2002, 26, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Goyal, S.M.; Adams, W.N.; O’Malley, M.L.; Lear, D.W. Human pathogenic viruses at sewage sludge disposal sites in the middle atlantic region. Appl. Environ. Microbiol. 1984, 48, 758–763. [Google Scholar] [PubMed]
- Bonilla, T.D.; Nowosielski, K.; Esiobu, N.; McCorquodale, D.S.; Rogerson, A. Species assemblages of enterococcus indicate potential sources of fecal bacteria at a south florida recreational beach. Mar. Pollut. Bull. 2006, 52, 807–810. [Google Scholar] [CrossRef] [PubMed]
- Desmarais, T.R.; Solo-Gabriele, H.M.; Palmer, C.J. Influence of soil on fecal indicator organisms in a tidally influenced subtropical environment. Appl. Environ. Microbiol. 2002, 68, 1165–1172. [Google Scholar] [CrossRef] [PubMed]
- Hartz, A.; Cuvelier, M.; Nowosielski, K.; Bonilla, T.D.; Green, M.; Esiobu, N.; McCorquodale, D.S.; Rogerson, A. Survival potential of Escherichia coli and enterococci in subtropical beach sand: Implications for water quality managers. J. Environ. Qual. 2008, 37, 898–905. [Google Scholar] [CrossRef] [PubMed]
- Solo-Gabriele, H.M.; Wolfert, M.A.; Desmarais, T.R.; Palmer, C.J. Sources of Escherichia coli in a coastal subtropical environment. Appl. Environ. Microbiol. 2000, 66, 230–237. [Google Scholar] [CrossRef] [PubMed]
- Craun, G.F.; Calderon, R.L.; Craun, M.F. Outbreaks associated with recreational water in the united states. Int. J. Environ. Health Res. 2005, 15, 243–262. [Google Scholar] [CrossRef] [PubMed]
- Harwood, V.J.; Levine, A.D.; Scott, T.M.; Chivukula, V.; Lukasik, J.; Farrah, S.R.; Rose, J.B. Validity of the indicator organism paradigm for pathogen reduction in reclaimed water and public health protection. Appl. Environ. Microbiol. 2005, 71, 3163–3170. [Google Scholar] [CrossRef] [PubMed]
- Hlavsa, M.C.; Roberts, V.A.; Anderson, A.R.; Hill, V.R.; Kahler, A.M.; Orr, M.; Garrison, L.E.; Hicks, L.A.; Newton, A.; Hilborn, E.D.; et al. Surveillance for waterborne disease outbreaks and other health events associated with recreational water—United States, 2007–2008. Morb. Mortal. Wkly. Rep. Surveill. Summ. 2011, 60, 1–32. [Google Scholar]
- Adams, D.A.; Gallagher, K.M.; Jajosky, R.A.; Kriseman, J.; Sharp, P.; Anderson, W.J.; Aranas, A.E.; Mayes, M.; Wodajo, M.S.; Onweh, D.H.; et al. Summary of notifiable diseases-United States, 2011. MMWR Morb. Mortal. Wkly. Rep. 2013, 60, 1–117. [Google Scholar] [PubMed]
- Karanis, P.; Kourenti, C.; Smith, H. Waterborne transmission of protozoan parasites: A worldwide review of outbreaks and lessons learnt. J. Water Health 2007, 5, 1–38. [Google Scholar] [PubMed]
- Payment, P.; Plante, R.; Cejka, P. Removal of indicator bacteria, human enteric viruses, Giardia cysts, and Cryptosporidium oocysts at a large wastewater primary treatment facility. Can. J. Microbiol. 2001, 47, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Dziuban, E.J.; Liang, J.L.; Craun, G.F.; Hill, V.; Yu, P.A.; Painter, J.; Moore, M.R.; Calderon, R.L.; Roy, S.L.; Beach, M.J.; et al. Surveillance for waterborne disease and outbreaks associated with recreational water–United States, 2003–2004. Morb. Mortal. Wkly. Rep. Surveill. Summ. 2006, 55, 1–30. [Google Scholar]
- Yoder, J.S.; Blackburn, B.G.; Craun, G.F.; Hill, V.; Levy, D.A.; Chen, N.; Lee, S.H.; Calderon, R.L.; Beach, M.J. Surveillance for waterborne-disease outbreaks associated with recreational water–United States, 2001–2002. Morb. Mortal. Wkly. Rep. Surveill. Summ. 2004, 53, 1–22. [Google Scholar]
- Yavuz, B.M.; Jones, R.M.; DeFlorio-Barker, S.; Vannoy, E.; Dorevitch, S. Receiver-operating characteristics analysis: A new approach to predicting the presence of pathogens in surface waters. Environ. Sci. Technol. 2014, 48, 5628–5635. [Google Scholar] [CrossRef] [PubMed]
- Abdelzaher, A.M.; Wright, M.E.; Ortega, C.; Solo-Gabriele, H.M.; Miller, G.; Elmir, S.; Newman, X.; Shih, P.; Bonilla, J.A.; Bonilla, T.D.; et al. Presence of pathogens and indicator microbes at a non-point source subtropical recreational marine beach. Appl. Environ. Microbiol. 2010, 76, 724–732. [Google Scholar] [CrossRef] [PubMed]
- Dorevitch, S.; Doi, M.; Hsu, F.C.; Lin, K.T.; Roberts, J.D.; Liu, L.C.; Gladding, R.; Vannoy, E.; Li, H.; Javor, M.; et al. A comparison of rapid and conventional measures of indicator bacteria as predictors of waterborne protozoan pathogen presence and density. J. Environ. Monit.: JEM 2011, 13, 2427–2435. [Google Scholar] [CrossRef] [PubMed]
- APHA. Standard Methods for the Examination of Water and Wastewater, 20th ed.; American Public Health Association/American Water Works Association/Water Environment Federation: Washington, DC, USA, 2005. [Google Scholar]
- Ortega, C.; Solo-Gabriele, H.M.; Abdelzaher, A.; Wright, M.; Deng, Y.; Stark, L.M. Correlations between microbial indicators, pathogens, and environmental factors in a subtropical estuary. Mar. Pollut. Bull. 2009, 58, 1374–1381. [Google Scholar] [CrossRef] [PubMed]
- Hill, V.R.; Polaczyk, A.L.; Hahn, D.; Narayanan, J.; Cromeans, T.L.; Roberts, J.M.; Amburgey, J.E. Development of a rapid method for simultaneous recovery of diverse microbes in drinking water by ultrafiltration with sodium polyphosphate and surfactants. Appl. Environ. Microbiol. 2005, 71, 6878–6884. [Google Scholar] [CrossRef] [PubMed]
- Morales-Morales, H.A.; Vidal, G.; Olszewski, J.; Rock, C.M.; Dasgupta, D.; Oshima, K.H.; Smith, G.B. Optimization of a reusable hollow-fiber ultrafilter for simultaneous concentration of enteric bacteria, protozoa, and viruses from water. Appl. Environ. Microbiol. 2003, 69, 4098–4102. [Google Scholar] [CrossRef] [PubMed]
- Hill, V.R.; Kahler, A.M.; Jothikumar, N.; Johnson, T.B.; Hahn, D.; Cromeans, T.L. Multistate evaluation of an ultrafiltration-based procedure for simultaneous recovery of enteric microbes in 100-liter tap water samples. Appl. Environ. Microbiol. 2007, 73, 4218–4225. [Google Scholar] [CrossRef] [PubMed]
- Hill, V.R.; Polaczyk, A.L.; Kahler, A.M.; Cromeans, T.L.; Hahn, D.; Amburgey, J.E. Comparison of hollow-fiber ultrafiltration to the usepa viradel technique and usepa method 1623. J. Environ. Qual. 2009, 38, 822–825. [Google Scholar] [CrossRef] [PubMed]
- Olszewski, J.; Winona, L.; Oshima, K.H. Comparison of 2 ultrafiltration systems for the concentration of seeded viruses from environmental waters. Can. J. Microbiol. 2005, 51, 295–303. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, R.C.; Oshima, K.H. Hollow-fiber ultrafiltration of Cryptosporidium parvum oocysts from a wide variety of 10-L surface water samples. Can. J. Microbiol. 2002, 48, 542–549. [Google Scholar] [CrossRef] [PubMed]
- Haramoto, E.; Katayama, H.; Asami, M.; Akiba, M. Development of a novel method for simultaneous concentration of viruses and protozoa from a single water sample. J. Virol. Methods 2012, 182, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Sassoubre, L.M.; Love, D.C.; Silverman, A.I.; Nelson, K.L.; Boehm, A.B. Comparison of enterovirus and adenovirus concentration and enumeration methods in seawater from southern california, USA and Baja Malibu, Mexico. J. Water Health 2012, 10, 419–430. [Google Scholar] [CrossRef] [PubMed]
- Abdelzaher, A.M.; Solo-Gabriele, H.M.; Palmer, C.J.; Scott, T.M. Simultaneous concentration of enterococci and coliphage from marine waters using a dual layer filtration system. J. Environ. Qual. 2009, 38, 2468–2473. [Google Scholar] [CrossRef] [PubMed]
- Abdelzaher, A.M.; Solo-Gabriele, H.M.; Wright, M.E.; Palmer, C.J. Sequential concentration of bacteria and viruses from marine waters using a dual membrane system. J. Environ. Qual. 2008, 37, 1648–1655. [Google Scholar] [CrossRef] [PubMed]
- Hsu, B.M.; Huang, C. Ims method performance analyses for Giardia in water under differing conditions. Environ. Monit. Assess. 2007, 131, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Katayama, H.; Shimasaki, A.; Ohgaki, S. Development of a virus concentration method and its application to detection of enterovirus and norwalk virus from coastal seawater. Appl. Environ. Microbiol. 2002, 68, 1033–1039. [Google Scholar] [CrossRef] [PubMed]
- Quintero-Betancourt, W.; Gennaccaro, A.L.; Scott, T.M.; Rose, J.B. Assessment of methods for detection of infectious Cryptosporidium oocysts and Giardia cysts in reclaimed effluents. Appl. Environ. Microbiol. 2003, 69, 5380–5388. [Google Scholar] [CrossRef] [PubMed]
- Guy, R.A.; Payment, P.; Krull, U.J.; Horgen, P.A. Real-time pcr for quantification of Giardia and Cryptosporidium in environmental water samples and sewage. Appl. Environ. Microbiol. 2003, 69, 5178–5185. [Google Scholar] [CrossRef] [PubMed]
- DeLeon, R.; Shieh, Y.S.; Baric, R.S.; Sobsey, M.D. Detection of Enteroviruses and Hepatitis a Virus in Environmental Samples by Gene Probes and Polymerase Chain Reaction, Proceedings of Water Quality Conference, San Diego, 1990; American Water Works Association: San Diego, CA, USA, 1990; pp. 839–845.
- Knap, A.; Dewailly, E.; Furgal, C.; Galvin, J.; Baden, D.; Bowen, R.E.; Depledge, M.; Duguay, L.; Fleming, L.E.; Ford, T.; et al. Indicators of ocean health and human health: Developing a research and monitoring framework. Environ. Health Perspect. 2002, 110, 839–845. [Google Scholar] [CrossRef] [PubMed]
- Byappanahalli, M.; Fujioka, R. Indigenous soil bacteria and low moisture may limit but allow faecal bacteria to multiply and become a minor population in tropical soils. Water Sci. Technol. 2004, 50, 27–32. [Google Scholar] [PubMed]
- Francy, D.S.; Stelzer, E.A.; Brady, A.M.; Huitger, C.; Bushon, R.N.; Ip, H.S.; Ware, M.W.; Villegas, E.N.; Gallardo, V.; Lindquist, H.D. Comparison of filters for concentrating microbial indicators and pathogens in lake water samples. Appl. Environ. Microbiol. 2013, 79, 1342–1352. [Google Scholar] [CrossRef] [PubMed]
- Keserue, H.A.; Fuchslin, H.P.; Egli, T. Rapid detection and enumeration of Giardia lamblia cysts in water samples by immunomagnetic separation and flow cytometric analysis. Appl. Environ. Microbiol. 2011, 77, 5420–5427. [Google Scholar] [CrossRef] [PubMed]
- Abdelzaher, A.M.; Wright, M.E.; Ortega, C.; Hasan, A.R.; Shibata, T.; Solo-Gabriele, H.M.; Kish, J.; Withum, K.; He, G.; Elmir, S.M.; et al. Daily measures of microbes and human health at a non-point source marine beach. J. Water Health 2011, 9, 443–457. [Google Scholar] [CrossRef] [PubMed]
- Chigor, V.N.; Sibanda, T.; Okoh, A.I. Assessment of the risks for human health of adenoviruses, hepatitis a virus, rotaviruses and enteroviruses in the buffalo river and three source water dams in the eastern cape. Food Environ. Virol. 2014, 6, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.S.; Lee, C.; Marion, J.; Wang, Q.; Saif, L.; Lee, J. Occurrence of human enteric viruses at freshwater beaches during swimming season and its link to water inflow. Sci. Total Environ. 2014, 472, 757–766. [Google Scholar] [CrossRef] [PubMed]
- Lechevallier, M.W.; Norton, W.D. Giardia and Cryptosporidium in raw and finished water. J. Amer. Water Works Assoc. 1995, 87, 54–68. [Google Scholar]
- Rose, J.B.; Gerba, C.P.; Jakubowski, W. Survey of potable water-supplies for Cryptosporidium and Giardia. Environ. Sci. Technol. 1991, 25, 1393–1400. [Google Scholar] [CrossRef]
- Betancourt, W.Q.; Duarte, D.C.; Vasquez, R.C.; Gurian, P.L. Cryptosporidium and Giardia in tropical recreational marine waters contaminated with domestic sewage: Estimation of bathing-associated disease risks. Mar. Pollut. Bull. 2014, 85, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Kumar, T.; Onichandran, S.; Lim, Y.A.; Sawangjaroen, N.; Ithoi, I.; Andiappan, H.; Salibay, C.C.; Dungca, J.Z.; Chye, T.T.; Sulaiman, W.Y.; et al. Comparative study on waterborne parasites between malaysia and thailand: A new insight. Amer. J. Trop. Med. Hyg. 2014, 90, 682–689. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bonilla, J.A.; Bonilla, T.D.; Abdelzaher, A.M.; Scott, T.M.; Lukasik, J.; Solo-Gabriele, H.M.; Palmer, C.J. Quantification of Protozoa and Viruses from Small Water Volumes. Int. J. Environ. Res. Public Health 2015, 12, 7118-7132. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph120707118
Bonilla JA, Bonilla TD, Abdelzaher AM, Scott TM, Lukasik J, Solo-Gabriele HM, Palmer CJ. Quantification of Protozoa and Viruses from Small Water Volumes. International Journal of Environmental Research and Public Health. 2015; 12(7):7118-7132. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph120707118
Chicago/Turabian StyleBonilla, J. Alfredo, Tonya D. Bonilla, Amir M. Abdelzaher, Troy M. Scott, Jerzy Lukasik, Helena M. Solo-Gabriele, and Carol J. Palmer. 2015. "Quantification of Protozoa and Viruses from Small Water Volumes" International Journal of Environmental Research and Public Health 12, no. 7: 7118-7132. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph120707118