Levistolide A Inhibits PEDV Replication via Inducing ROS Generation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses, Cells, Antibodies, Chemicals, and Other Reagents
2.2. Cell Counting Kit-8 Assay
2.3. TCID50 Assay
2.4. Indirect Immunofluorescence Assay
2.5. Western Bolt
2.6. Real-Time PCR for RNA Detection
2.7. Cellular Reactive Oxygen Species Assay
2.8. Significant Difference Analysis
3. Results
3.1. Cytotoxicity of Levistolide A
3.2. Antiviral Activity of Levistolide A against PEDV
3.3. Inhibitory Effect of Levistolide A on the Production of PEDV RNA and Protein
3.4. Levistolide A Exhibited an Inhibitory Effect on the PEDV-Invading Cells
3.5. Anti-PEDV Activity of Levistolide A Was Associated with Inducing ROS Generation
3.6. Levisrolide A Induced Endoplasmic Reticulum Stress in Vero Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Lv, C.; Xiao, Y.; Li, X.; Tian, K. Porcine epidemic diarrhea virus: Current insights. Virus Adapt. Treat. 2016, 2016, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ma, Z.; Li, Y.; Gao, S.; Xiao, S. Porcine epidemic diarrhea virus: Molecular mechanisms of attenuation and vaccines. Microb. Pathog. 2020, 149, 104553. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Park, B. Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 2012, 44, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Su, M.; Li, C.; Qi, S.; Yang, D.; Sun, D. A molecular epidemiological investigation of PEDV in China: Characterization of co-infection and genetic diversity of S1-based genes. Transbound. Emerg. Dis. 2019, 67, 1129–1140. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Fang, L.; Xiao, S. Porcine epidemic diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef]
- Sun, R.Q.; Cai, R.J.; Chen, Y.Q.; Liang, P.S.; Song, C.X. Outbreak of Porcine Epidemic Diarrhea in Suckling Piglets, China. Emerg. Infect. Dis. 2012, 18, 161–163. [Google Scholar] [CrossRef]
- Langel, S.N.; Paim, F.C.; Lager, K.M.; Vlasova, A.N.; Saif, L.J. Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts. Virus Res. 2016, 226, 93–107. [Google Scholar] [CrossRef] [Green Version]
- Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [Green Version]
- He, W.-Q.; Lv, W.-S.; Zhang, Y.; Qu, Z.; Wei, R.-R.; Zhang, L.; Liu, C.H.; Zhou, X.X.; Li, W.R.; Huang, X.T.; et al. Study on Pharmacokinetics of Three Preparations from Levistolide A by LC-MS-MS. J. Chromatogr. Sci. 2015, 53, 1265–1273. [Google Scholar] [CrossRef]
- Chen, F.; Wang, T.; Wang, J.; Wang, Z.-Q.; Qian, M. Levistolide A overcomes P-glycoprotein-mediated drug resistance in human breast carcinoma cells. Acta Pharmacol. Sin. 2008, 29, 458–464. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.; Zhang, Y.; Wang, L.; Lee, S. Levistolide A Induces Apoptosis via ROS-Mediated ER Stress Pathway in Colon Cancer Cells. Cell. Physiol. Biochem. 2017, 42, 929–938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, Y.; Niu, W.; Zhang, T.; Wang, J.; Cao, J.; Chen, H.; Wang, R.; An, H. Levistolide A synergistically enhances doxorubicin induced apoptosis of k562/dox cells by decreasing MDR1 expression through the ubiquitin pathway. Oncol. Rep. 2018, 41, 1198–1208. [Google Scholar] [CrossRef] [Green Version]
- Qu, X.; Guan, P.; Han, L.; Wang, Z.; Huang, X. Levistolide A Attenuates Alzheimer’s Pathology Through Activation of the PPARgamma Pathway. Neurother. J. Am. Soc. Exp. NeuroTher. 2021, 18, 326–339. [Google Scholar] [CrossRef]
- Beck, J.J.; Stermitz, F.R. Addition of methyl thioglycolate and benzylamine to (Z)-ligustilide, a bioactive unsaturated lactone constituent of several herbal medicines. An improved synthesis of (Z)-ligustilide. J. Nat. Prod. 1995, 58, 1047–1055. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhang, M.; Zheng, H.; Zhou, P.; Liu, Z.; Jongkaewwattana, A.; Luo, R.; He, Q. Construction of a Recombinant Porcine Epidemic Diarrhea Virus Encoding Nanoluciferase for High-Throughput Screening of Natural Antiviral Products. Viruses 2021, 13, 1866. [Google Scholar] [CrossRef] [PubMed]
- Fung, T.S.; Liu, D.X. Human Coronavirus: Host-Pathogen Interaction. Annu. Rev. Microbiol. 2019, 73, 529–557. [Google Scholar] [CrossRef] [Green Version]
- Sun, P.; Jin, J.; Wang, L.; Wang, J.; Xu, X. Porcine epidemic diarrhea virus infections induce autophagy in Vero cells via ROS-dependent endoplasmic reticulum stress through PERK and IRE1 pathways. Vet. Microbiol. 2020, 253, 108959. [Google Scholar] [CrossRef]
- Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [Google Scholar] [CrossRef]
- Hafiz, Z.; Geum, L.; Hyung-Ryong, K.; Han-Jung, C. Endoplasmic Reticulum Stress and Associated ROS. Int. J. Mol. Sci. 2016, 17, 327. [Google Scholar]
- Wang, Y.; Li, J.R.; Sun, M.X.; Ni, B.; Huan, C.; Huang, L.; Li, C.; Fan, H.J.; Ren, X.F.; Mao, X. Triggering unfolded protein response by 2-Deoxy-D-glucose inhibits porcine epidemic diarrhea virus propagation. Antivir. Res. 2014, 106, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Zhu, T.; Du, S.; Cao, D.; Pei, Z.; Guo, Y.; Shao, H.; Wang, H.; Wang, K.; Hu, G. Isolation and identification of a variant subtype G 2b porcine epidemic diarrhea virus and S gene sequence characteristic. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2019, 71, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhao, P.; Guo, L.; Liu, Y.; Du, Y.; Ren, S.; Li, J.; Zhang, Y.; Fan, Y.; Huang, B. Porcine Epidemic Diarrhea Virus Variants with High Pathogenicity, China. Emerg. Infect. Dis. 2013, 19, 2048–2049. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016, 226, 20–39. [Google Scholar] [CrossRef] [Green Version]
- Arabyan, E.; Kotsynyan, A.; Hakobyan, A.; Zakaryan, H. Antiviral agents against African swine fever virus. Virus Res. 2019, 270, 197669. [Google Scholar] [CrossRef]
- Chen, Y.; Luo, Q.; Li, S.; Li, C.; Yang, Y. Antiviral activity against porcine epidemic diarrhea virus of Pogostemon cablin polysaccharide. J. Ethnopharmacol. 2020, 259, 113009. [Google Scholar] [CrossRef]
- Song, J.; Shim, J.; Choi, H. Quercetin 7-rhamnoside reduces porcine epidemic diarrhea virus replication via independent pathway of viral induced reactive oxygen species. Virol. J. 2011, 8, 460. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Chen, J.; Wei, X.; Hua, H.; Hu, R.; Ding, N.; Zhang, J.; Song, D.; Ye, Y.; Tang, Y.; et al. Antiviral Activities of Carbazole Derivatives against Porcine Epidemic Diarrhea Virus In Vitro. Viruses 2021, 13, 2527. [Google Scholar] [CrossRef]
- Li, Z.; Cao, H.; Cheng, Y.; Zhang, X.; Han, H. Inhibition of Porcine Epidemic Diarrhea Virus Replication and Viral 3C-Like Protease by Quercetin. Int. J. Mol. Sci. 2020, 21, 8095. [Google Scholar] [CrossRef]
- Li, D.; Li, Y.; Liu, Y.; Chen, Y.; Zhang, G. Isolation and Identification of a Recombinant Porcine Epidemic Diarrhea Virus With a Novel Insertion in S1 Domain. Front. Microbiol. 2021, 12, 667084. [Google Scholar] [CrossRef]
- Jing, S.; Qunjing, L.; Chunyan, S.; Yuanmei, M.; Haijian, H.; Sheng, J.; Yingshan, Z.; Yuan, W.; Shaobo, B.; Lin, S. Isolation and characterization of Chinese porcine epidemic diarrhea virus with novel mutations and deletions in the S gene. Vet. Microbiol. 2018, 221, 81–89. [Google Scholar]
- Huan, C.; Pan, H.; Fu, S.; Xu, W.; Liu, X. Characterization and evolution of the coronavirus porcine epidemic diarrhoea virus HLJBY isolated in China. Transbound. Emerg. Dis. 2020, 67, 65–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Temeeyasen, G.; Srijangwad, A.; Tripipat, T.; Tipsombatboon, P.; Piriyapongsa, J.; Phoolcharoen, W.; Chuanasa, T.; Tantituvanont, A.; Nilubol, D. Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand. Infect. Genet. Evol. 2014, 21, 205–213. [Google Scholar] [CrossRef] [PubMed]
- Vui, D.T.; Tung, N.; Inui, K.; Slater, S.; Nilubol, D. Complete Genome Sequence of Porcine Epidemic Diarrhea Virus in Vietnam. Genome Announc. 2014, 2, e00753-14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Y.W.; Dickerman, A.W.; Pieyro, P.; Li, L.; Meng, X.J. Origin, Evolution, and Genotyping of Emergent Porcine Epidemic Diarrhea Virus Strains in the United States. Mbio 2013, 4, e00737-13. [Google Scholar] [CrossRef] [Green Version]
- Guo, Y.; Duan, M.; Wang, X.; Gao, J.; Guan, Z.; Zhang, M. Early Events in Rabies Virus Infection—Attachment, Entry, and Intracellular Trafficking. Virus Res. 2019, 263, 217–225. [Google Scholar] [CrossRef]
- Ming, L. Influenza virus entry. Adv. Exp. Med. Biol. 2012, 726, 201. [Google Scholar]
- Graziano, V.R.; Wei, J.; Wilen, C.B. Norovirus Attachment and Entry. Viruses 2019, 11, 495. [Google Scholar] [CrossRef] [Green Version]
- Zeisel, M.B.; Felmlee, D.J.; Baumert, T.F. Hepatitis C Virus Entry. J. Biol. Chem. 2013, 369, 87–112. [Google Scholar]
- Koehler, M.; Delguste, M.; Sieben, C.; Gillet, L.; Alsteens, D. Initial Step of Virus Entry: Virion Binding to Cell-Surface Glycans. Annu. Rev. Virol. 2020, 7, 143–165. [Google Scholar] [CrossRef]
- Fehr, A.R.; Perlman, S. Coronaviruses: An Overview of Their Replication and Pathogenesis. Methods Mol. Biol. 2015, 1282, 1–23. [Google Scholar] [PubMed] [Green Version]
- Altmeyer, R. Virus Attachment and Entry Offer Numerous Targets for Antiviral Therapy. Curr. Pharm. Des. 2004, 10, 3701–3712. [Google Scholar] [CrossRef] [PubMed]
- Muruganantham, S. In vitro screening of anti-hbv properties of selected indian medicinal plants from kolli hills, namakkal district of tamilnadu, india. World J. Pharm. Pharm. Sci. 2015, 4, 909–915. [Google Scholar]
- Wu, W.; Li, R.; Li, X.; He, J.; Jiang, S.; Liu, S.; Yang, J. Quercetin as an Antiviral Agent Inhibits Influenza A Virus (IAV) Entry. Viruses 2016, 8, 6. [Google Scholar] [CrossRef] [PubMed]
- Lopes, B.; da Costa, M.F.; Genova Ribeiro, A.; da Silva, T.F.; Lima, C.S.; Caruso, I.P.; de Araujo, G.C.; Kubo, L.H.; Iacovelli, F.; Falconi, M.; et al. Quercetin pentaacetate inhibits in vitro human respiratory syncytial virus adhesion. Virus Res. 2020, 276, 197805. [Google Scholar] [CrossRef]
- Sun, Y.; Li, C.; Li, Z.; Shangguan, A.; Jiang, J.; Zeng, W.; Zhang, S.; He, Q. Quercetin as an antiviral agent inhibits the Pseudorabies virus in vitro and in vivo. Virus Res. 2021, 305, 198556. [Google Scholar] [CrossRef]
- Sabrina, L.; Carole, B. Griffithsin: An Antiviral Lectin with Outstanding Therapeutic Potential. Viruses 2016, 8, 296. [Google Scholar]
- Choi, H.-J.; Kim, J.-H.; Lee, C.-H.; Ahn, Y.-J.; Song, J.-H.; Baek, S.-H.; Kwon, D.-H. Antiviral activity of quercetin 7-rhamnoside against porcine epidemic diarrhea virus. Antivir. Res. 2009, 81, 77–81. [Google Scholar] [CrossRef]
- Yuan, C.; Huang, X.; Zhai, R.; Ma, Y.; Xu, A.; Zhang, P.; Yang, Q. In Vitro Antiviral Activities of Salinomycin on Porcine Epidemic Diarrhea Virus. Viruses 2021, 13, 580. [Google Scholar] [CrossRef]
- Tong, T.; Hu, H.; Zhou, J.; Deng, S.; Zhang, X.; Tang, W.; Fang, L.; Xiao, S.; Liang, J. Glycyrrhizic-Acid-Based Carbon Dots with High Antiviral Activity by Multisite Inhibition Mechanisms. Small 2020, 16, 1906206. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Bai, J.; Liu, X.; Wang, M.; Wang, X.; Jiang, P. Tomatidine inhibits porcine epidemic diarrhea virus replication by targeting 3CL protease. Vet. Res. 2020, 51, 136. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Luo, R.; He, Q.; Kuppeveld, F.V.; Rottier, P.; Bosch, B.J. Aminopeptidase N is not required for porcine epidemic diarrhea virus cell entry. Virus Res. 2017, 235, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, C.-M.; Wang, B.; Zhou, J.; Huang, Y.-W. Aminopeptidase-N-independent entry of porcine epidemic diarrhea virus into Vero or porcine small intestine epithelial cells. Virology 2018, 517, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Chen, Y.; Shi, J. Reactive Oxygen Species (ROS)-Based Nanomedicine. Chem. Rev. 2019, 119, 4881–4985. [Google Scholar] [CrossRef]
- D’Autréaux, B.; Toledano, M.B. ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell Biol. 2007, 8, 813–824. [Google Scholar] [CrossRef]
- Ron, M. ROS Are Good. Trends Plant Sci. 2016, 22, 11–19. [Google Scholar]
- Arcanjo, A.; Logullo, J.; Menezes, C.; Giangiarulo, T.; Morrot, A. The Emerging Role of Neutrophil Extracellular Traps in Severe Acute Respiratory Syndrome Coronavirus 2 (COVID-19). Sci. Rep. 2020, 10, 19630. [Google Scholar] [CrossRef]
- Montani, M.G.; Santarelli, R.; Granato, M.; Gonnella, R.; Torrisi, M.R.; Faggioni, A.; Cirone, M. EBV reduces autophagy, intracellular ROS and mitochondria to impair monocyte survival and differentiation. Autophagy 2018, 15, 652–667. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Lan, P.; Hou, X.; Han, Q.; Lu, N.; Li, T.; Jiao, C.; Zhang, J.; Zhang, C.; Tian, Z. HBV inhibits LPS-induced NLRP3 inflammasome activation and IL-1β production via suppressing the NF-kappa B pathway and ROS production. J. Hepatol. J. Eur. Assoc. Study Liver 2017, 66, 693–702. [Google Scholar]
- Xia, N.; Wang, H.; Liu, X.; Shao, Q.; Zhu, J. African Swine Fever Virus Structural Protein p17 Inhibits Cell Proliferation through ER Stress—ROS Mediated Cell Cycle Arrest. Viruses 2020, 13, 21. [Google Scholar] [CrossRef]
- Wang, R.; Zhu, Y.; Lin, X.; Ren, C.; Zhao, J.; Wang, F.; Gao, X.; Xiao, R.; Zhao, L.; Chen, H. Influenza M2 protein regulates MAVS-mediated signaling pathway through interacting with MAVS and increasing ROS production. Autophagy 2019, 15, 1163–1181. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5′–3′) |
---|---|
PEDV F | CGTACAGGTAAGTCAATTAC |
PEDV R | GATGAAGCATTGACTGAA |
PEDV probe-M | FAM-TTCGTCACAGTCGCCAAGG-TAMRA |
ACTB-F | CTACACCGCTACCAGTTCGC |
ACTB-R | TAGGAGTCCTTCTGGCCCAT |
GADD34-F | GTCAGGACCTGTGATCGCTT |
GADD34-R | CCATGTGTCTGGGCGGTG |
ATF4-F | CCAACAACGGCAAGGAGGATG |
ATF4-R | GGGCATCAAAGTCGAACTCC |
GRP78-F | CTTCGGCGTGAGGTGGAAAA |
GRP78-R | ACCGGAACAGATCCATGTTGA |
DDIT3-F | GGAACCTGAGGAGAGAGTGTTC |
DDIT3-R | CTGCCATCTCTGCAGTTGGA |
B2M-F | GCGGAATATAAGTGGAGGCGT |
B2M-R | ATCTTTGGAGCACGCTGGATA |
XBP1-F | CGGCCTTGTAGTTGAGAACCA |
XBP1-R | TCACTCCATTCCCCTTGGCTT |
TGEV-F | ACGCCGTATAGTGCAGATGG |
TGEV-R | AGTTGCACTTTTGCCGCATT |
PDCoV-F | AAGGATGCGCTCAATACGGT |
PDCoV-R | TGTCTGCTGGCAGAGTTACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, W.; Ren, J.; Li, Z.; Jiang, C.; Sun, Q.; Li, C.; Li, W.; Li, W.; He, Q. Levistolide A Inhibits PEDV Replication via Inducing ROS Generation. Viruses 2022, 14, 258. https://0-doi-org.brum.beds.ac.uk/10.3390/v14020258
Zeng W, Ren J, Li Z, Jiang C, Sun Q, Li C, Li W, Li W, He Q. Levistolide A Inhibits PEDV Replication via Inducing ROS Generation. Viruses. 2022; 14(2):258. https://0-doi-org.brum.beds.ac.uk/10.3390/v14020258
Chicago/Turabian StyleZeng, Wei, Jingping Ren, Zhonghua Li, Changsheng Jiang, Qi Sun, Chang Li, Wan Li, Wentao Li, and Qigai He. 2022. "Levistolide A Inhibits PEDV Replication via Inducing ROS Generation" Viruses 14, no. 2: 258. https://0-doi-org.brum.beds.ac.uk/10.3390/v14020258