Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Source of Plants, Whiteflies, and Virus Culture
2.2. Detection of CCYV from High-Throughput Sequencing Data and RT-PCR
2.3. Transmission of CCYV to Wild Radish and Back Transmission to Cucurbits
2.4. Estimation of Copy Numbers of CCYV
2.5. Host Plant Suitability for Whiteflies
3. Results
3.1. Detection of Cucurbit Chlorotic Yellows Virus on Field Samples and Its Characteristics
3.2. Transmission of Cucurbit Chlorotic Yellows Virus to Wild Radish
3.3. Back Transmission of CCYV from Wild Radish to Known Cucurbit Hosts
3.4. Host Plant Suitability for Whiteflies
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schroeder, J. Wild radish (Raphanus raphanistrum) control in soft red winter wheat (Triticum aestivum). Weed Sci. 1989, 37, 112–116. [Google Scholar] [CrossRef]
- Cheam, A.H. Seed production and seed dormancy in wild radish (Raphanus raphanistrum) and some possibilities of improving control. Weed Res. 1986, 26, 405–413. [Google Scholar] [CrossRef]
- Holm, L.G.; Plucknett, D.L.; Pancho, J.V.; Herberger, J.P. The world’s worst weeds: Distribution and biology. Q. Rev. Biol. 1977, 53, 319. Available online: https://0-www-journals-uchicago-edu.brum.beds.ac.uk/doi/10.1086/410688 (accessed on 2 February 2022).
- Mekenian, M.R.; Willemsen, R.W. Germination characteristics of Raphanus raphanistrum I. laboratory studies. Bull. Torrey Bot. Club. 1975, 102, 243–252. [Google Scholar] [CrossRef]
- Webster, T.M.; MacDonald, G.E. A survey of weeds in various crops in Georgia. Weed Technol. 2001, 15, 771–790. Available online: http://0-www-jstor-org.brum.beds.ac.uk/stable/3988560 (accessed on 2 February 2022). [CrossRef]
- Norsworthy, J.; Malik, M.; Riley, M.; Bridges, W. Time of emergence affects survival and development of wild radish (Raphanus raphanistrum) in South Carolina. Weed Sci. 2010, 58, 402–407. [Google Scholar] [CrossRef] [Green Version]
- Culpepper, A.S.; Vance, J.C. Controlling Ryegrass and Wild Radish in 2020–2021 Wheat. Circular 1027. 2021. Available online: http://www.extension.uga.edu (accessed on 2 January 2022).
- Okuda, M.; Okazaki, S.; Yamasaki, S.; Okuda, S.; Sugiyama, M. Host range and complete genome sequence of cucurbit chlorotic yellows virus, a new member of the genus Crinivirus. Phytopathology 2010, 100, 560–566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kheireddine, A.; Sáez, C.; Sifres, A.; Picó, B.; López, C. First report of cucurbit chlorotic yellows virus infecting cucumber and zucchini in Algeria. Plant Dis. 2020, 104, 1264. [Google Scholar] [CrossRef]
- Gyoutoku, Y.; Okazaki, S.; Furuta, A.; Etoh, T.; Mizobe, M.; Kuno, K.; Hayashida, S.; Okuda, M. Chlorotic yellows disease of melon caused by cucurbit chlorotic yellows virus, a new crinivirus. Jpn. J. Phytopathol. 2009, 75, 109–111. [Google Scholar] [CrossRef] [Green Version]
- Bananej, K.; Menzel, W.; Vahdat, A.; Winter, S. First report of cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis. 2013, 97, 1005. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Rout, B.M.; Choudhary, S.; Sureja, A.K.; Baranwal, V.K.; Pant, R.P.; Kaur, B.; Jain, R.K.; Basavaraj, Y.B. First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India. Plant Dis. 2021. [Google Scholar] [CrossRef] [PubMed]
- Orfanidou, C.; Maliogka, V.I.; Katis, N.I. First report of cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis. 2014, 98, 1446. [Google Scholar] [CrossRef] [PubMed]
- Jailani, A.A.K.; Iriarte, F.; Hochmuth, B.; Willis, S.M.; Warren, M.W.; Dey, K.K.; Velez-Climent, M.; McVay, J.; Bag, S.; Paret, M.L. First report of cucurbit chlorotic yellows virus affecting watermelon in USA. Plant Dis. 2021. [Google Scholar] [CrossRef]
- Kavalappara, S.R.; Milner, H.; Sparks, A.N.; McGregor, C.; Wintermantel, W.M.; Bag, S. First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia. Plant Dis. 2021. [Google Scholar] [CrossRef] [PubMed]
- Mondal, S.; Hladky, J.L.; Melanson, S.R.; Sikora, J.E.; Wintermantel, W.M. First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in cucurbit crops in Alabama. Plant Dis. 2021. [Google Scholar] [CrossRef] [PubMed]
- Wintermantel, W.M.; Hladky, L.L.J.; Fashing, P.; Ando, K.; McCreight, J.D. First report of cucurbit chlorotic yellows virus infecting melon in the New World. Plant Dis. 2019, 103, 778. [Google Scholar] [CrossRef]
- Tzanetakis, I.E.; Martin, R.R.; Wintermantel, W.M. Epidemiology of criniviruses: An emerging problem in world agriculture. Front. Microbiol. 2013, 4, 119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okuda, S.; Okuda, M.; Sugiyama, M.; Sakata, Y.; Takeshita, M.; Iwai, H. Resistance in melon to cucurbit chlorotic yellows virus, a whitefly-transmitted crinivirus. Eur. J. Plant Pathol. 2013, 135, 313–321. [Google Scholar] [CrossRef]
- Peng, J.; Huang, Y. The occurrence of cucurbit chlorotic yellows virus disease in Taiwan and evaluation of the virus infected fruit quality and yield. Phytopathology 2011, 101, S139–S140. [Google Scholar] [CrossRef] [Green Version]
- Adkins, S.; Webster, C.G.; Kousik, C.S.; Webb, S.E.; Roberts, P.D.; Stansly, P.A.; Turechek, W.W. Ecology and management of whitefly-transmitted viruses of vegetable crops in Florida. Virus Res. 2011, 159, 110–114. [Google Scholar] [CrossRef] [PubMed]
- Kavalappara, S.R.; Milner, H.; Konakalla, N.C.; Morgan, K.; Sparks, A.N.; McGregor, C.; Culbreath, A.K.; Wintermantel, W.M.; Bag, S. High throughput sequencing-aided survey reveals widespread mixed infections of whitefly-transmitted viruses in cucurbits in Georgia, USA. Viruses 2021, 13, 988. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, R.; Riley, D.; Diffie, S.; Sparks, A.; Adkins, S. Whitefly population dynamics and evaluation of whitefly-transmitted tomato yellow leaf curl virus (TYLCV)-resistant tomato genotypes as whitefly and TYLCV reservoirs. J. Econ. Entomol. 2012, 105, 1447–1456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weakley, S.A. Flora of the Southern and Mid-Atlantic States; The University of North Carolina Herbarium: Chapel Hill, NC, USA, 2015; Available online: https://www.herbarium.unc.edu/FloraArchives/WeakleyFlora_2015-05-29.pdf (accessed on 2 February 2022).
- Pecman, A.; Kutnjak, D.; Gutiérrez-Aguirre, I.; Adams, I.; Fox, A.; Boonham, N.; Ravnikar, M. Next generation sequencing for detection and discovery of plant viruses and viroids: Comparison of two approaches. Front. Microbiol. 2017, 8, 1998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Orfanidou, C.; Katsiani, A.; Papayiannis, L.; Katis, N.I.; Maliogka, V.I. Interplay of cucurbit yellow stunting disorder virus with cucurbit chlorotic yellows virus and transmission dynamics by Bemisia tabaci MED. Plant Dis. 2021, 105, 416–424. [Google Scholar] [CrossRef] [PubMed]
- Webb, S.E.; Adkins, S.; Reitz, S.R. Semipersistent whitefly transmission of squash vein yellowing virus, causal agent of viral watermelon vine decline. Plant Dis. 2012, 96, 839–844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rotenberg, D.; Krishna Kumar, N.K.; Ullman, D.E.; Montero-Astúa, M.; Willis, D.K.; German, T.L.; Whitfield, A.E. Variation in tomato spotted wilt virus titer in Frankliniella occidentalis and its association with frequency of transmission. Phytopathology 2009, 99, 404–410. [Google Scholar] [CrossRef] [Green Version]
- Sparks, T.C.; Riley, D.G.; Simmons, A.M.; Guo, L. Comparison of toxicological bioassays for whiteflies. Insects 2020, 11, 789. [Google Scholar] [CrossRef]
- Riley, D.G.; Nava-Camberos, U.; Allen, J. Population dynamics of Bemisia in agricultural systems. In Bemisia 1995: Taxonomy, Biology, Damage, Control and Management; Gerling, D., Mayer, R.T., Eds.; Intercept Ltd.: Andover, UK, 1995; pp. 93–109. [Google Scholar]
- Lapidot, M.; Friedmann, M.; Pilowsky, M.; Ben-Joseph, R.; Cohen, S. Effect of host plant resistance to tomato yellow leaf curl virus (TYLCV) on virus acquisition and transmission by its whitefly vector. Phytopathology 2001, 91, 1209–1213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Legarrea, S.; Barman, A.; Diffie, S.; Srinivasan, R. Virus accumulation and whitefly performance modulate the role of alternate host species as inoculum sources of tomato yellow leaf curl virus. Plant Dis. 2020, 104, 2958–2966. [Google Scholar] [CrossRef] [PubMed]
- Adkins, S.; Webb, S.E.; Baker, C.A.; Kousik, C.S. Squash vein yellowing virus detection using nested polymerase chain reaction demonstrates that the cucurbit weed Momordica charantia is a reservoir host. Plant Dis. 2008, 92, 1119–1123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arli-Sokmen, M.; Mennan, H.; Sevik, M.A.; Ecevit, O. Occurrence of viruses in field-grown pepper crops and some of their reservoir weed hosts in Samsun, Turkey. Phytoparasitica 2005, 33, 347–358. [Google Scholar] [CrossRef]
- Bedford, I.; Kelly, A.; Banks, G.; Briddon, R.; Cenis, J.; Markham, P. Solanum nigrum: An indigenous weed reservoir for a tomato yellow leaf curl geminivirus in southern Spain. Eur. J. Plant Pathol. 1998, 104, 221–222. [Google Scholar] [CrossRef]
- Cervantes, F.A.; Alvarez, J.M. Role of hairy nightshade in the transmission of different potato virus Y strains on Solanum tuberosum (L.). Plant Health Prog. 2010, 11, 38. [Google Scholar] [CrossRef]
- Duffus, J.E. Role of weeds in the incidence of virus diseases. Annu. Rev. Phytopathol. 1971, 9, 319–340. [Google Scholar] [CrossRef] [Green Version]
- Izadpanah, K.; Zaki-Aghl, M.; Zhang, Y.P.; Daubert, S.D.; Rowhani, A. Bermuda grass as a potential reservoir host for grapevine fanleaf virus. Plant Dis. 2003, 87, 1179–1182. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.A.C. Using epidemiological information to develop effective integrated virus disease management strategies. Virus Res. 2004, 100, 5–30. [Google Scholar] [CrossRef]
- Shrestha, D.; McAuslane, H.J.; Adkins, S.; Smith, N.; Webb, S.E. Transmission of squash vein yellowing virus to and from cucurbit weeds and effects on sweetpotato whitefly (Hemiptera: Aleyrodidae) behavior. Environ. Entomol. 2016, 45, 967–973. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wisler, G.C.; Duffus, J.E. Transmission properties of whitefly-borne criniviruses and their impact on virus epidemiology. In Virus-Insect-Plant Interactions; Harris, K.F., Smith, O.P., Duffus, J.E., Eds.; Academic Press: San Diego, CA, USA, 2001; pp. 293–308. [Google Scholar] [CrossRef]
- Wisler, G.C.; Norris, R.F. Interactions between weeds and cultivated plants as related to management of plant pathogens. Weed Sci. 2005, 53, 914–917. [Google Scholar] [CrossRef]
- Boubourakas, I.N.; Avgelis, A.D.; Kyriakopoulou, P.E.; Katis, N.I. Occurrence of yellowing viruses (beet pseudo-yellows virus, cucurbit yellow stunting disorder virus and cucurbit aphid-borne yellows virus) affecting cucurbits in Greece. Plant Pathol. 2006, 55, 276–283. [Google Scholar] [CrossRef]
- Orfanidou, C.G.; Baltzi, A.; Dimou, N.A.; Katis, N.I.; Maliogka, V.I. Cucurbit chlorotic yellows virus: Insights into its natural host range, genetic variability, and transmission parameters. Plant Dis. 2017, 101, 2053–2058. [Google Scholar] [CrossRef] [PubMed]
- Tugume, A.K.; Mukasa, S.B.; Valkonen, J.P.T. Mixed infections of four viruses, the incidence and phylogenetic relationships of sweet potato chlorotic fleck virus (Betaflexiviridae) isolates in wild species and sweet potatoes in Uganda and evidence of distinct isolates in East Africa. PLoS ONE 2016, 11, e0167769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Assay | Primer Name | Sequence 5′-3′ | Tm (°C) | Amplicon Size | References |
---|---|---|---|---|---|
RT-PCR | CCYV-RDRP-1515F | CTCCGATAGATCATCCCAAATC | 62 | 953 | [15] |
CCYV-RDRP-1515R | TCACCAGAAACTCCACAATCTC | ||||
RT-qPCR | CCYV-F | GGTTTACACACCCGGTGAGTTT | 62 | 91 | [28] |
CCYV-R | TGAAATTAGGGCTTGCTTCCA |
Inoculated Plant Species | Symptoms 1 | RT-qPCR Detection (No of Plants Positive/Inoculated) | |
---|---|---|---|
Transmissions to wild radish | Wild radish; Raphanus raphanistrum (Mass exposure) | IC, Y | 7/10 |
Wild radish; R. raphanistrum (Clip cage inoculation) | IC, Y | 5/5 | |
Back transmissions to cucurbit hosts of CCYV | Yellow squash; Cucurbita pepo | IC, Y | 5/5 |
Green squash; C. pepo | IC, Y | 5/5 | |
Watermelon; Citrullus lanatus | IC, Y | 5/5 | |
Cantaloupe; Cucumis melo var. cantalupensis | IC, Y | 5/5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kavalappara, S.R.; Riley, D.G.; Cremonez, P.S.G.; Perier, J.D.; Bag, S. Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus. Viruses 2022, 14, 593. https://0-doi-org.brum.beds.ac.uk/10.3390/v14030593
Kavalappara SR, Riley DG, Cremonez PSG, Perier JD, Bag S. Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus. Viruses. 2022; 14(3):593. https://0-doi-org.brum.beds.ac.uk/10.3390/v14030593
Chicago/Turabian StyleKavalappara, Saritha R., David G. Riley, Paulo S. G. Cremonez, Jermaine D. Perier, and Sudeep Bag. 2022. "Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus" Viruses 14, no. 3: 593. https://0-doi-org.brum.beds.ac.uk/10.3390/v14030593