Multiplex One-Step RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses and Bacteria
2.2. Clinical Specimens
2.3. Nucleic Acid Extraction
2.4. Multiplex TaqMan® Reverse Transcription qPCR (RT-qPCR) Assays for the Detection of Canine and Feline Enteric Viruses
2.5. Synthesis of In Vitro Transcribed RNA
2.6. Analytical Parameters Determination and Statistical Analysis
3. Results
3.1. Analytical Specificity of the Singleplex and Multiplex Assays for the Detection of Canine and Feline Enteric Viruses
3.2. Analytical Sensitivity of the Singleplex and Multiplex Assays for the Detection of Canine and Feline Enteric Viruses
3.3. Repeatability and Reproducibility of the Multiplex TaqMan® RT-qPCR Assays for the Detection of Canine and Feline Enteric Viruses
3.4. Assays Validation on Clinical Samples Collected from Dogs with Clinical Signs of Enteric Disease
3.5. Assays Validation on Clinical Samples Collected from Cats with Clinical Signs of Enteric Disease
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z.-L. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [Google Scholar] [CrossRef]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. A New Coronavirus Associated with Human Respiratory Disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef]
- Michelitsch, A.; Allendorf, V.; Conraths, F.J.; Gethmann, J.; Schulz, J.; Wernike, K.; Denzin, N. SARS-CoV-2 Infection and Clinical Signs in Cats and Dogs from Confirmed Positive Households in Germany. Viruses 2023, 15, 837. [Google Scholar] [CrossRef]
- Tan, C.C.S.; Lam, S.D.; Richard, D.; Owen, C.J.; Berchtold, D.; Orengo, C.; Nair, M.S.; Kuchipudi, S.V.; Kapur, V.; van Dorp, L.; et al. Transmission of SARS-CoV-2 from Humans to Animals and Potential Host Adaptation. Nat. Commun. 2022, 13, 2988. [Google Scholar] [CrossRef] [PubMed]
- Barroso-Arévalo, S.; Barneto, A.; Ramos, Á.M.; Rivera, B.; Sánchez, R.; Sánchez-Morales, L.; Pérez-Sancho, M.; Buendía, A.; Ferreras, E.; Ortiz-Menéndez, J.C.; et al. Large-Scale Study on Virological and Serological Prevalence of SARS-CoV-2 in Cats and Dogs in Spain. Transbound. Emerg. Dis. 2022, 69, e759–e774. [Google Scholar] [CrossRef] [PubMed]
- Meekins, D.A.; Gaudreault, N.N.; Richt, J.A. Natural and Experimental SARS-CoV-2 Infection in Domestic and Wild Animals. Viruses 2021, 13, 1993. [Google Scholar] [CrossRef] [PubMed]
- Cerrada-Romero, C.; Berastegui-Cabrera, J.; Camacho-Martínez, P.; Goikoetxea-Aguirre, J.; Pérez-Palacios, P.; Santibáñez, S.; José Blanco-Vidal, M.; Valiente, A.; Alba, J.; Rodríguez-Álvarez, R.; et al. Excretion and Viability of SARS-CoV-2 in Feces and Its Association with the Clinical Outcome of COVID-19. Sci. Rep. 2022, 12, 7397. [Google Scholar] [CrossRef]
- Park, S.; Lee, C.-W.; Park, D.-I.; Woo, H.-Y.; Cheong, H.S.; Shin, H.C.; Ahn, K.; Kwon, M.-J.; Joo, E.-J. Detection of SARS-CoV-2 in Fecal Samples From Patients With Asymptomatic and Mild COVID-19 in Korea. Clin. Gastroenterol. Hepatol. 2021, 19, 1387–1394.e2. [Google Scholar] [CrossRef]
- Vaselli, N.M.; Setiabudi, W.; Subramaniam, K.; Adams, E.R.; Turtle, L.; Iturriza-Gómara, M.; Solomon, T.; Cunliffe, N.A.; French, N.; Hungerford, D.; et al. Investigation of SARS-CoV-2 Faecal Shedding in the Community: A Prospective Household Cohort Study (COVID-LIV) in the UK. BMC Infect. Dis. 2021, 21, 784. [Google Scholar] [CrossRef]
- Wong, M.C.; Huang, J.; Lai, C.; Ng, R.; Chan, F.K.L.; Chan, P.K.S. Detection of SARS-CoV-2 RNA in Fecal Specimens of Patients with Confirmed COVID-19: A Meta-Analysis. J. Infect. 2020, 81, e31–e38. [Google Scholar] [CrossRef]
- Guo, M.; Tao, W.; Flavell, R.A.; Zhu, S. Potential Intestinal Infection and Faecal–Oral Transmission of SARS-CoV-2. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 269–283. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Xiao, A.; Zhang, J.; Moniz, K.; Endo, N.; Armas, F.; Bushman, M.; Chai, P.R.; Duvallet, C.; Erickson, T.B.; et al. Wastewater Surveillance of SARS-CoV-2 across 40 U.S. States from February to June 2020. Water Res. 2021, 202, 117400. [Google Scholar] [CrossRef] [PubMed]
- Galani, A.; Aalizadeh, R.; Kostakis, M.; Markou, A.; Alygizakis, N.; Lytras, T.; Adamopoulos, P.G.; Peccia, J.; Thompson, D.C.; Kontou, A.; et al. SARS-CoV-2 Wastewater Surveillance Data Can Predict Hospitalizations and ICU Admissions. Sci. Total Environ. 2022, 804, 150151. [Google Scholar] [CrossRef] [PubMed]
- McClary-Gutierrez, J.S.; Mattioli, M.C.; Marcenac, P.; Silverman, A.I.; Boehm, A.B.; Bibby, K.; Balliet, M.; De Los Reyes, F.L.; Gerrity, D.; Griffith, J.F.; et al. SARS-CoV-2 Wastewater Surveillance for Public Health Action. Emerg. Infect. Dis. 2021, 27, e210753. [Google Scholar] [CrossRef] [PubMed]
- de Souza Barbosa, A.B.; Kmetiuk, L.B.; de Carvalho, O.V.; Brandão, A.P.D.; Doline, F.R.; Lopes, S.R.R.S.; Meira, D.A.; de Souza, E.M.; da Silva Trindade, E.; Baura, V.; et al. Infection of SARS-CoV-2 in Domestic Dogs Associated with Owner Viral Load. Res. Vet. Sci. 2022, 153, 61–65. [Google Scholar] [CrossRef]
- Padilla-Blanco, M.; Vega, S.; Enjuanes, L.; Morey, A.; Lorenzo, T.; Marín, C.; Ivorra, C.; Maiques, E.; Rubio, V.; Rubio-Guerri, C. Detection of SARS-CoV-2 in a Dog with Hemorrhagic Diarrhea. BMC Vet. Res. 2022, 18, 370. [Google Scholar] [CrossRef]
- Pascucci, I.; Paniccià, M.; Giammarioli, M.; Biagetti, M.; Duranti, A.; Campomori, P.; Smilari, V.; Ancora, M.; Scialabba, S.; Secondini, B.; et al. SARS-CoV-2 Delta VOC in a Paucisymptomatic Dog, Italy. Pathogens 2022, 11, 514. [Google Scholar] [CrossRef]
- Sit, T.H.C.; Brackman, C.J.; Ip, S.M.; Tam, K.W.S.; Law, P.Y.T.; To, E.M.W.; Yu, V.Y.T.; Sims, L.D.; Tsang, D.N.C.; Chu, D.K.W.; et al. Infection of Dogs with SARS-CoV-2. Nature 2020, 586, 776–778. [Google Scholar] [CrossRef]
- Lenz, O.C.; Marques, A.D.; Kelly, B.J.; Rodino, K.G.; Cole, S.D.; Perera, R.A.P.M.; Weiss, S.R.; Bushman, F.D.; Lennon, E.M. SARS-CoV-2 Delta Variant (AY.3) in the Feces of a Domestic Cat. Viruses 2022, 14, 421. [Google Scholar] [CrossRef]
- Neira, V.; Brito, B.; Agüero, B.; Berrios, F.; Valdés, V.; Gutierrez, A.; Ariyama, N.; Espinoza, P.; Retamal, P.; Holmes, E.C.; et al. A Household Case Evidences Shorter Shedding of SARS-CoV-2 in Naturally Infected Cats Compared to Their Human Owners. Emerg. Microbes Infect. 2021, 10, 376–383. [Google Scholar] [CrossRef]
- Sailleau, C.; Dumarest, M.; Vanhomwegen, J.; Delaplace, M.; Caro, V.; Kwasiborski, A.; Hourdel, V.; Chevaillier, P.; Barbarino, A.; Comtet, L.; et al. First Detection and Genome Sequencing of SARS-CoV-2 in an Infected Cat in France. Transbound. Emerg. Dis. 2020, 67, 2324–2328. [Google Scholar] [CrossRef]
- Akhtardanesh, B.; Jajarmi, M.; Shojaee, M.; Salajegheh Tazerji, S.; Khalili Mahani, M.; Hajipour, P.; Gharieb, R. Molecular Screening of SARS-CoV-2 in Dogs and Cats from Households with Infected Owners Diagnosed with COVID-19 during Delta and Omicron Variant Waves in Iran. Vet. Med. Sci. 2023, 9, 82–90. [Google Scholar] [CrossRef]
- Gaudreault, N.N.; Trujillo, J.D.; Carossino, M.; Meekins, D.A.; Morozov, I.; Madden, D.W.; Indran, S.V.; Bold, D.; Balaraman, V.; Kwon, T.; et al. SARS-CoV-2 Infection, Disease and Transmission in Domestic Cats. Emerg. Microbes Infect. 2020, 9, 2322–2332. [Google Scholar] [CrossRef]
- Lyoo, K.-S.; Lee, H.; Lee, S.-G.; Yeom, M.; Lee, J.-Y.; Kim, K.-C.; Yang, J.-S.; Song, D. Experimental Infection and Transmission of SARS-CoV-2 Delta and Omicron Variants among Beagle Dogs. Emerg. Infect. Dis. 2023, 29, 782–785. [Google Scholar] [CrossRef]
- Hubbard, K.; Skelly, B.J.; McKelvie, J.; Wood, J.L.N. Risk of Vomiting and Diarrhoea in Dogs. Vet. Rec. 2007, 161, 755–757. [Google Scholar] [CrossRef]
- Duijvestijn, M.; Mughini-Gras, L.; Schuurman, N.; Schijf, W.; Wagenaar, J.A.; Egberink, H. Enteropathogen Infections in Canine Puppies: (Co-)Occurrence, Clinical Relevance and Risk Factors. Vet. Microbiol. 2016, 195, 115–122. [Google Scholar] [CrossRef]
- Marks, S.L.; Willard, M.D. Diarrhea in Kittens. In Consultations in Feline Internal Medicine; Elsevier: St. Louis, MO, USA, 2006; pp. 133–143. [Google Scholar] [CrossRef]
- Decaro, N.; Desario, C.; Billi, M.; Mari, V.; Elia, G.; Cavalli, A.; Martella, V.; Buonavoglia, C. Western European Epidemiological Survey for Parvovirus and Coronavirus Infections in Dogs. Vet. J. 2011, 187, 195–199. [Google Scholar] [CrossRef]
- Sykes, J.E. Canine Parvovirus Infections and Other Viral Enteritides. In Canine and Feline Infectious Diseases; Saunders: Philadelphia, PA, USA, 2014; pp. 141–151. [Google Scholar] [CrossRef]
- da Fontoura Budaszewski, R.; Pinto, L.D.; Weber, M.N.; Caldart, E.T.; Alves, C.D.B.T.; Martella, V.; Ikuta, N.; Lunge, V.R.; Canal, C.W. Genotyping of Canine Distemper Virus Strains Circulating in Brazil from 2008 to 2012. Virus Res. 2014, 180, 76–83. [Google Scholar] [CrossRef]
- Li, C.; Guo, D.; Wu, R.; Kong, F.; Zhai, J.; Yuan, D.; Sun, D. Molecular Surveillance of Canine Distemper Virus in Diarrhoetic Puppies in Northeast China from May 2014 to April 2015. J. Vet. Med. Sci. 2018, 80, 1029–1033. [Google Scholar] [CrossRef]
- Pratelli, A.; Martella, V.; Elia, G.; Tempesta, M.; Guarda, F.; Capucchio, M.T.; Carmichael, L.E.; Buonavoglia, C. Severe Enteric Disease in an Animal Shelter Associated with Dual Infections by Canine Adenovirus Type 1 and Canine Coronavirus. J. Vet. Med. B Infect. Dis. Vet. Public Health 2001, 48, 385–392. [Google Scholar] [CrossRef]
- Felten, S.; Klein-Richers, U.; Unterer, S.; Bergmann, M.; Leutenegger, C.M.; Pantchev, N.; Balzer, J.; Zablotski, Y.; Hofmann-Lehmann, R.; Hartmann, K. Role of Feline Coronavirus as Contributor to Diarrhea in Cats from Breeding Catteries. Viruses 2022, 14, 858. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, N.C.; Allen, C.E.; Lyons, L.A. Pathogenesis of Feline Enteric Coronavirus Infection. J. Feline Med. Surg. 2008, 10, 529–541. [Google Scholar] [CrossRef] [PubMed]
- Parrish, C.R. 3 Pathogenesis of Feline Panleukopenia Virus and Canine Parvovirus. Baillieres Clin. Haematol. 1995, 8, 57–71. [Google Scholar] [CrossRef]
- Stuetzer, B.; Hartmann, K. Feline Parvovirus Infection and Associated Diseases. Vet. J. 2014, 201, 150–155. [Google Scholar] [CrossRef] [PubMed]
- Charoenkul, K.; Janetanakit, T.; Bunpapong, N.; Boonyapisitsopa, S.; Tangwangvivat, R.; Suwannakarn, K.; Theamboonlers, A.; Poovorawan, Y.; Amonsin, A. Molecular Characterization Identifies Intra-host Recombination and Zoonotic Potential of Canine Rotavirus among Dogs from Thailand. Transbound. Emerg. Dis. 2021, 68, 1240–1252. [Google Scholar] [CrossRef] [PubMed]
- Martella, V.; Pratelli, A.; Elia, G.; Decaro, N.; Tempesta, M.; Buonavoglia, C. Isolation and Genetic Characterization of Two G3P5A[3] Canine Rotavirus Strains in Italy. J. Virol. Methods 2001, 96, 43–49. [Google Scholar] [CrossRef]
- Wu, F.-T.; Bányai, K.; Lin, J.-S.; Wu, H.-S.; Hsiung, C.A.; Huang, Y.-C.; Hwang, K.-P.; Jiang, B.; Gentsch, J.R. Putative Canine Origin of Rotavirus Strain Detected in a Child with Diarrhea, Taiwan. Vector Borne Zoonotic Dis. 2012, 12, 170–173. [Google Scholar] [CrossRef]
- Elnifro, E.M.; Ashshi, A.; Cooper, R.J.; Klapper, P.E. Multiplex PCR: Optimization and Application in Diagnostic Virology. Clin. Microbiol. Rev. 2000, 13, 559–570. [Google Scholar] [CrossRef]
- Beuret, C. Simultaneous Detection of Enteric Viruses by Multiplex Real-Time RT-PCR. J. Virol. Methods 2004, 115, 1–8. [Google Scholar] [CrossRef]
- Carossino, M.; Barrandeguy, M.E.; Erol, E.; Li, Y.; Balasuriya, U.B.R. Development and Evaluation of a One-Step Multiplex Real-Time TaqMan® RT-QPCR Assay for the Detection and Genotyping of Equine G3 and G14 Rotaviruses in Fecal Samples. Virol. J. 2019, 16, 49. [Google Scholar] [CrossRef]
- Jiang, Y.; Fang, L.; Shi, X.; Zhang, H.; Li, Y.; Lin, Y.; Qiu, Y.; Chen, Q.; Li, H.; Zhou, L.; et al. Simultaneous Detection of Five Enteric Viruses Associated with Gastroenteritis by Use of a PCR Assay: A Single Real-Time Multiplex Reaction and Its Clinical Application. J. Clin. Microbiol. 2020, 52, 1266–1268. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Zhang, W.; Ye, R.; Pan, Z.; Li, G.; Su, S. One-Step Multiplex TaqMan Probe-Based Method for Real-Time PCR Detection of Four Canine Diarrhea Viruses. Mol. Cell. Probes 2020, 53, 101618. [Google Scholar] [CrossRef] [PubMed]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Strother, K.; Wolfson, W.; Balasuriya, U.B.R. Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine in-Fectious Respiratory Disease Complex. Viruses 2023, 15, 1881. [Google Scholar] [CrossRef]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Development and Validation of Multiplex One-Step QPCR/RT-QPCR Assays for Simultaneous Detection of SARS-CoV-2 and Pathogens Associated with Feline Respiratory Disease Complex. PLoS ONE, 2023; under review. [Google Scholar]
- Carossino, M.; Balasuriya, U.B.R.; Thieulent, C.J.; Barrandeguy, M.E.; Vissani, M.A.; Parreño, V. Quadruplex Real-Time TaqMan® RT-QPCR Assay for Differentiation of Equine Group A and B Rotaviruses and Identification of Group A G3 and G14 Genotypes. Viruses 2023, 15, 1626. [Google Scholar] [CrossRef]
- Freeman, M.M.; Kerin, T.; Hull, J.; McCaustland, K.; Gentsch, J. Enhancement of Detection and Quantification of Rotavirus in Stool Using a Modified Real-Time RT-PCR Assay. J. Med. Virol. 2008, 80, 1489–1496. [Google Scholar] [CrossRef]
- Decaro, N.; Elia, G.; Martella, V.; Desario, C.; Campolo, M.; Trani, L.D.; Tarsitano, E.; Tempesta, M.; Buonavoglia, C. A Real-Time PCR Assay for Rapid Detection and Quantitation of Canine Parvovirus Type 2 in the Feces of Dogs. Vet. Microbiol. 2005, 105, 19–28. [Google Scholar] [CrossRef]
- Decaro, N.; Pratelli, A.; Campolo, M.; Elia, G.; Martella, V.; Tempesta, M.; Buonavoglia, C. Quantitation of Canine Coronavirus RNA in the Faeces of Dogs by TaqMan RT-PCR. J. Virol. Methods 2004, 119, 145–150. [Google Scholar] [CrossRef]
- Dowgier, G.; Mari, V.; Losurdo, M.; Larocca, V.; Colaianni, M.L.; Cirone, F.; Lucente, M.S.; Martella, V.; Buonavoglia, C.; Decaro, N. A Duplex Real-Time PCR Assay Based on TaqMan Technology for Simultaneous Detection and Differentiation of Canine Adenovirus Types 1 and 2. J. Virol. Methods 2016, 234, 1–6. [Google Scholar] [CrossRef]
- Gut, M.; Leutenegger, C.M.; Huder, J.B.; Pedersen, N.C.; Lutz, H. One-Tube Fluorogenic Reverse Transcription-Polymerase Chain Reaction for the Quantitation of Feline Coronaviruses. J. Virol. Methods 1999, 77, 37–46. [Google Scholar] [CrossRef]
- Burd, E.M. Validation of Laboratory-Developed Molecular Assays for Infectious Diseases. Clin. Microbiol. Rev. 2010, 23, 550–576. [Google Scholar] [CrossRef]
- Stavisky, J.; Pinchbeck, G.L.; German, A.J.; Dawson, S.; Gaskell, R.M.; Ryvar, R.; Radford, A.D. Prevalence of Canine Enteric Coronavirus in a Cross-Sectional Survey of Dogs Presenting at Veterinary Practices. Vet. Microbiol. 2010, 140, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Tekes, G.; Thiel, H.-J. Chapter Six—Feline Coronaviruses: Pathogenesis of Feline Infectious Peritonitis. In Advances in Virus Research; Ziebuhr, J., Ed.; Coronaviruses; Academic Press: Cambridge, MA, USA, 2016; Volume 96, pp. 193–218. [Google Scholar]
- Decaro, N.; Buonavoglia, C. Canine Parvovirus—A Review of Epidemiological and Diagnostic Aspects, with Emphasis on Type 2c. Vet. Microbiol. 2012, 155, 1–12. [Google Scholar] [CrossRef]
- Ohshima, T.; Mochizuki, M. Evidence for Recombination between Feline Panleukopenia Virus and Canine Parvovirus Type 2. J. Vet. Med. Sci. 2009, 71, 403–408. [Google Scholar] [CrossRef] [PubMed]
- Battilani, M.; Balboni, A.; Giunti, M.; Prosperi, S. Co-Infection with Feline and Canine Parvovirus in a Cat. Vet. Ital. 2013, 49, 127–129. [Google Scholar]
- Mira, F.; Puleio, R.; Schirò, G.; Condorelli, L.; Di Bella, S.; Chiaramonte, G.; Purpari, G.; Cannella, V.; Balboni, A.; Randazzo, V.; et al. Study on the Canine Adenovirus Type 1 (CAdV-1) Infection in Domestic Dogs in Southern Italy. Pathogens 2022, 11, 1254. [Google Scholar] [CrossRef]
- da Rocha Gizzi, A.B.; Oliveira, S.T.; Leutenegger, C.M.; Estrada, M.; Kozemjakin, D.A.; Stedile, R.; Marcondes, M.; Biondo, A.W. Presence of Infectious Agents and Co-Infections in Diarrheic Dogs Determined with a Real-Time Polymerase Chain Reaction-Based Panel. BMC Vet. Res. 2014, 10, 23. [Google Scholar] [CrossRef]
- Parashar, U.D.; Gibson, C.J.; Bresee, J.S.; Glass, R.I. Rotavirus and Severe Childhood Diarrhea. Emerg. Infect. Dis. 2006, 12, 304–306. [Google Scholar] [CrossRef] [PubMed]
- Vlasova, A.N.; Amimo, J.O.; Saif, L.J. Porcine Rotaviruses: Epidemiology, Immune Responses and Control Strategies. Viruses 2017, 9, 48. [Google Scholar] [CrossRef]
- Kopper, J.J. Equine Rotaviral Diarrhea. Vet. Clin. N. Am. Equine Pract. 2023, 39, 47–54. [Google Scholar] [CrossRef]
- De Grazia, S.; Giammanco, G.M.; Martella, V.; Ramirez, S.; Colomba, C.; Cascio, A.; Arista, S. Rare AU-1-Like G3P[9] Human Rotaviruses with a Kun-Like NSP4 Gene Detected in Children with Diarrhea in Italy. J. Clin. Microbiol. 2008, 46, 357–360. [Google Scholar] [CrossRef]
- De Grazia, S.; Martella, V.; Giammanco, G.M.; Gòmara, M.I.; Ramirez, S.; Cascio, A.; Colomba, C.; Arista, S. Canine-Origin G3P[3] Rotavirus Strain in Child with Acute Gastroenteritis. Emerg. Infect. Dis. 2007, 13, 1091–1093. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Wang, L.; Sakthivel, S.K.; Whitaker, B.; Murray, J.; Kamili, S.; Lynch, B.; Malapati, L.; Burke, S.A.; Harcourt, J.; et al. US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg. Infect. Dis. 2020, 26, 1654–1665. [Google Scholar] [CrossRef] [PubMed]
- Deng, X.; Zhang, J.; Su, J.; Liu, H.; Cong, Y.; Zhang, L.; Zhang, K.; Shi, N.; Lu, R.; Yan, X. A Multiplex PCR Method for the Simultaneous Detection of Three Viruses Associated with Canine Viral Enteric Infections. Arch. Virol. 2018, 163, 2133–2138. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Yu, J.; Mu, Y.; Xie, X.; Wang, R.; Wu, H.; Liu, X.; Xu, F.; Wang, J.; Wang, Y. Development of a TaqMan-Based Multiplex Real-Time PCR for Simultaneous Detection of Four Feline Diarrhea-Associated Viruses. Front. Vet. Sci. 2022, 9, 1005759. [Google Scholar] [CrossRef]
Pathogens | Reference Strain | Source |
---|---|---|
SARS-CoV-2 USA-WA1/2020 | NR-52281 | BEI Resources |
SARS-CoV-2 Alpha (B.1.1.7) | NR-54020 | BEI Resources |
SARS-CoV-2 Beta (B.1.351) | NR-55282 | BEI Resources |
SARS-CoV-2 Delta (B.1.617.2) | NR-55671 | BEI Resources |
SARS-CoV-2 Omicron (B.1.1.529) | NR-56461 | BEI Resources |
Canine Distemper Virus (CDV) Lederle Avirulent | NR-3845 | BEI Resources |
Canine Parvovirus (CPV) | VR-953TM | ATCC® |
Canine Enteric Coronavirus (CECoV), UCD1 | NR-868 | BEI Resources |
Canine Adenovirus 1 (CAdV-1) | VR-293TM | ATCC® |
Canine Rotavirus (CRV) | VR-964 TM | ATCC® |
Feline Panleukopenia Virus (FPV) | VR-648TM | ATCC® |
Feline Coronavirus (FCoV) | L1911562 | LADDL |
Feline Infectious Peritonitis Virus (FIPV) | NR-43287 | BEI Resources |
Canine Adenovirus 2 (CAdV-2) | VR-800TM | ATCC® |
Canine Respiratory Coronavirus (CRCoV) | VSL-1471 | Cornell University a |
Canine Parainfluenza Virus (CPiV) | VR-399TM | ATCC® |
Canine Herpesvirus 1 (CHV-1) | VR-522TM | ATCC® |
Canine Pneumovirus (CPnV) | 124423 | LADDL |
Canine Influenza A H3N2 | VLS-1355 | Cornell University a |
Canine Influenza A H3N8 | A/Ca/FL/15592/04 | Cornell University b |
Felid Herpesvirus 1 (FHV-1) | VR-814TM | ATCC® |
Feline Calicivirus (FCV) | VR-782TM | ATCC® |
Target (Gene) | Oligonucleotide ID | Primers and Probe Sequences (5′-3′) | Nucleotide Position | Product Size (bp) | GenBank Accession # | Reference |
---|---|---|---|---|---|---|
SARS-CoV-2 (Nucleocapsid) | 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT | 28,287–28,306 | 72 | MN985325.1 | [42] |
2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG | 28,358–28,335 | ||||
2019-nCoV_N1-P | FAM-ACCCCGCATTACGTTTGGTGGACC-QSY | 28,309–28,332 | ||||
CDV (Phosphoprotein) | CDV_P-F | ACTATTGAGAGACCTCCAGCTGAAA | 1296–1320 | 79 | AB028914.1 | [45] |
CDV_P-R | TGCGGTATCCTTCGGTTTGT | 1374–1355 | ||||
CDV_P-P | JUN-CCGATTGCCGAGCTAGACTCTTTGTCA-QSY | 1352–1326 | ||||
CPV/FPV (VP2) | CPV-For | AAACAGGAATTAACTATACTAATATATTTA | 4102–4131 | 93 | M38245.1 | [49] |
CPV-Rev | AAATTTGACCATTTGGATAAACT | 4194–4172 | ||||
CPV-Pb | VIC-TGGTCCTTTAACTGCATTAAATAATGTACC-QSY | 4139–4168 | ||||
CECoV (ORF5) | CcoV-For | TTGATCGTTTTTATAACGGTTCTACAA | 26,449–26,475 | 99 | JQ404409.1 | [50] |
CcoV-Rev | AATGGGCCATAATAGCCACATAAT | 26,547–26,524 | ||||
CcoV-Pb | FAM-ACCTCAATTTAGCTGGTTCGTGTATGGCATT-QSY | 26,484–26,514 | ||||
CAdV-1 (Hexon) | CAV-F | AGTAATGGAAACCTAGGGG | 17,681–17,699 17,760–17,743 17,710–17,734 | 80 | U55001.1 | [51] |
CAV-R | TCTGTGTTTCTGTCTTGC | |||||
CAV1-Pb | ABY-TCAATCGTCTCAACTAAATGCCGTG-QSY | |||||
RVA (NSP3) | NVP3-FDeg | AYCATCTWCACRTGACCCTC | 992–1011 | 87 | MT364832.1 | [42,48] with modification |
NVP3-R1 | GGTCACATAACGCCCCTATA | 1078–1059 | ||||
NVP3-Probe | JUN-ATGAGCACAATAGTTAAAAGCTAACACTGTCAA-QSY | 1013–1045 | ||||
FCoV/FIPV (ORF7b) | FCoV1128f | GATTTGATTTGGCAATGCTAGATTT | 29,150–29,170 | 102 | FJ938059.1 | [52] |
FCoV1229r | AACAATCACTAGATCCAGACGTTAGCT | 29,251–29,225 | ||||
FCoV1200p | ABY-TCCATTGTTGGCTCGTCATAGCGGA-QSY | 29,198–29,222 |
Panel | Target | Parameter | Slope | Linearity (R2) | Efficiency (E [%]) | LOD95% (Copies/µL) | Detection Rate Limit (Copies/µL) | Ct Cut-Off |
---|---|---|---|---|---|---|---|---|
CEA_1 | CAdV-1 (H) | Singleplex | −3.343 | 0.9984 | 99.13 | 25 | 100 | 31 |
4-plex | −3.169 | 0.9992 | 106.80 | 6 | 10 | 38 | ||
CECoV (ORF5) | Singleplex | −3.377 | 0.9994 | 97.75 | 4 | 10 | 36 | |
4-plex | −3.180 | 0.9991 | 106.28 | 6 | 10 | 40 | ||
CDV (P) | Singleplex | −3.255 | 0.9971 | 102.87 | 4 | 10 | 36 | |
4-plex | −3.154 | 0.9993 | 107.52 | 5 | 10 | 38 | ||
CPV (VP2) | Singleplex | −3.368 | 0.9990 | 98.11 | 4 | 10 | 36 | |
4-plex | −3.225 | 0.9990 | 104.21 | 14 | 100 | 32 | ||
CEA_2 | SARS-CoV-2 (N1) | Singleplex | −3.369 | 0.9999 | 98.07 | <1 | 10 | 40 |
2-plex | −3.321 | 0.9998 | 100.04 | 5 | 10 | 35 | ||
RVA (NSP3) | Singleplex | −3.275 | 0.9969 | 102.00 | 14 | 100 | 34 | |
2-plex | −3.374 | 0.9991 | 97.87 | 14 | 100 | 33 | ||
FEA_1 | FCoV (ORF7b) | Singleplex | −3.372 | 0.9999 | 97.95 | 11 | 100 | 35 |
4-plex | −3.332 | 0.9991 | 99.58 | 14 | 100 | 38 | ||
SARS-CoV-2 (N1) | Singleplex | −3.369 | 0.9999 | 98.07 | <1 | 1 | 40 | |
4-plex | −3.313 | 0.9999 | 100.37 | 6 | 10 | 35 | ||
RVA (NSP3) | Singleplex | −3.275 | 0.9969 | 102.00 | 14 | 100 | 34 | |
4-plex | −3.191 | 0.9966 | 105.77 | 35 | 100 | 33 | ||
FPV (VP2) | Singleplex | −3.333 | 0.9999 | 99.54 | <1 | 1 | 40 | |
4-plex | −3.416 | 0.9979 | 96.22 | 8 | 10 | 39 |
Panel | Target | Intra-Run Variability CV (%) # | Inter-Run Variability CV (%) # | ||||
---|---|---|---|---|---|---|---|
105 Copies/µL | 104 Copies/µL | 103 Copies/µL | 105 Copies/µL | 104 Copies/µL | 103 Copies/µL | ||
CEA_1 | CAdV-1 (H) | 0.93 | 1.40 | 2.61 | 1.11 | 1.16 | 1.84 |
CECoV (ORF5) | 0.73 | 0.99 | 2.88 | 0.89 | 2.66 | 3.57 | |
CDV (P) | 1.54 | 2.12 | 3.84 | 0.75 | 1.36 | 2.65 | |
CPV (VP2) | 1.17 | 1.15 | 3.14 | 0.83 | 0.83 | 2.48 | |
CEA_2 | SARS-CoV-2 (N1) | 1.38 | 2.67 | 2.59 | 0.45 | 1.13 | 1.93 |
RVA (NSP3) | 2.38 | 1.00 | 1.45 | 1.16 | 2.61 | 3.05 | |
FEA_1 | FCoV (ORF7b) | 0.71 | 1.34 | 1.17 | 0.79 | 1.15 | 1.90 |
SARS-CoV-2 (N1) | 0.57 | 0.79 | 1.20 | 0.81 | 1.78 | 2.05 | |
RVA (NSP3) | 3.55 | 3.62 | 2.71 | 2.80 | 2.44 | 2.99 | |
FPV (VP2) | 0.90 | 0.94 | 0.87 | 1.53 | 0.39 | 0.30 |
Viruses | No. of Positive (n = 8/27) | Positive (%) (29.6%) |
---|---|---|
CDV | 2 | 7.4 |
CPV | 1 | 3.7 |
CECoV | 4 | 14.8 |
CadV-1 | 0 | 0 |
RVA | 0 | 0 |
SARS-CoV-2 | 1 | 3.7 |
Viruses | Positive (n = 11/31) | Positive (%) (35.5%) |
---|---|---|
FCoV | 4 | 12.9 |
FPV | 6 | 19.4 |
RVA | 0 | 0 |
SARS-CoV-2 | 1 | 3.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Multiplex One-Step RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats. Viruses 2023, 15, 1890. https://0-doi-org.brum.beds.ac.uk/10.3390/v15091890
Thieulent CJ, Carossino M, Peak L, Wolfson W, Balasuriya UBR. Multiplex One-Step RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats. Viruses. 2023; 15(9):1890. https://0-doi-org.brum.beds.ac.uk/10.3390/v15091890
Chicago/Turabian StyleThieulent, Côme J., Mariano Carossino, Laura Peak, Wendy Wolfson, and Udeni B. R. Balasuriya. 2023. "Multiplex One-Step RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats" Viruses 15, no. 9: 1890. https://0-doi-org.brum.beds.ac.uk/10.3390/v15091890