Campylobacter and Salmonella in Scavenging Indigenous Chickens in Rural Central Tanzania: Prevalence, Antimicrobial Resistance, and Genomic Features
Abstract
:1. Introduction
2. Materials and Methods
2.1. Participating Households and Sample Size Determination
2.2. Sample Collection
2.3. Data Analysis
2.4. Molecular Methods Used to Determine Prevalence of Campylobacter and Salmonella
2.4.1. DNA Extraction
2.4.2. PCR Based Detection of Campylobacter
2.4.3. PCR Based Detection of Salmonella
2.5. Salmonella Antimicrobial Susceptibility Test and Sequencing
2.5.1. Salmonella Isolation and PCR Identification
2.5.2. Antimicrobial Susceptibility Testing
2.5.3. DNA Extraction from Salmonella PCR Positive Isolates
2.5.4. Whole-Genome Sequencing of the Salmonella Isolates
2.5.5. Primary and Secondary Analysis of Sequencing Data
3. Results
3.1. Prevalence of Campylobacter and Salmonella
3.2. Salmonella Genome Sequence Quality
3.3. Salmonella Serovars
3.4. Antimicrobial Susceptibility and Antimicrobial Resistance Genes
3.5. Virulence Genes
3.6. Plasmid Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gibb, H.J.; Barchowsky, A.; Bellinger, D.; Michael, P.B.; Carrington, C.; Havelaar, A.H.; Oberoi, S.; Zang, Y.; O’Leary, K.; Devleesschauwer, B. Estimates of the 2015 global and regional Estimates of the 2015 global and regional disease burden from four foodborne metals—Arsenic, cadmium, lead and methylmercury. Environ. Res. 2019, 174, 188–194. [Google Scholar] [CrossRef]
- Havelaar, A.H.; Kirk, M.D.; Torgerson, P.R.; Gibb, H.J.; Hald, T.; Lake, R.J.; Praet, N.; Bellinger, D.C.; de Silva, N.R.; Gargouri, N.; et al. World Health Organization global estimates and regional comparisons of the burden of foodborne disease in 2010. PLoS Med. 2015, 12, e1001923. [Google Scholar] [CrossRef] [Green Version]
- EFSA and ECDC. European Food Safety Authority and European Centre for Disease Prevention and Control, 2019. The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, 5926. [Google Scholar] [CrossRef]
- Epps, S.V.R.; Harvey, R.B.; Hume, M.E.; Phillips, T.D.; Anderson, R.C.; Nisbet, D.J. Foodborne Campylobacter: Infections, metabolism, pathogenesis and reservoirs. Int. J. Environ. Res. Public Health 2013, 10, 6292–6304. [Google Scholar] [CrossRef] [Green Version]
- Gast, R.K.; Guraya, R.; Guard, J.; Holt, P.S. The relationship between the numbers of Salmonella Enteritidis, Salmonella Heidelberg, or Salmonella Hadar colonizing reproductive tissues of experimentally infected laying hens and deposition inside eggs. Avian Dis. 2011, 55, 243–247. [Google Scholar] [CrossRef]
- Okamura, M.; Kamijima, Y.; Miyamoto, T.; Tani, H.; Sasai, K.; Baba, E. Differences among six Salmonella serovars in abilities to colonize reproductive organs and to contaminate eggs in laying hens. Avian Dis. 2001, 45, 61–69. [Google Scholar] [CrossRef]
- Mdegela, R.H.; Nonga, H.E.; Ngowi, H.A.; Kazwala, R.R. Prevalence of thermophilic Campylobacter infections in humans, chickens and crows in Morogoro, Tanzania. J. Vet. Med. Ser. B 2006, 53, 116–121. [Google Scholar] [CrossRef] [PubMed]
- Peng, S. The Prevalence of the Salmonella Pathogen in Rural Tanzania; Royal Veterinary College, University of London: London, UK, 2017; Volume 64. [Google Scholar]
- Black, A.P.; Kirk, M.D.; Millard, G. Campylobacter outbreak due to chicken consumption at an Australian Capital Territory restaurant. Commun. Dis. Intell. Q. Rep. 2006, 30, 373–377. [Google Scholar] [PubMed]
- Dallman, T.; Inns, T.; Jombart, T.; Ashton, P.; Loman, N.; Chatt, C.; Messelhaeusser, U.; Rabsch, W.; Simon, S.; Nikisins, S.; et al. Phylogenetic structure of European Salmonella Enteritidis outbreak correlates with national and international egg distribution network. Microb. Genom. 2016, 2, e000070. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tompkins, B.J.; Wirsing, E.; Devlin, V.; Kamhi, L.; Temple, B.; Weening, K.; Cavallo, S.; Allen, L.; Goode, B.; Fitzgerald, C.; et al. Multistate outbreak of Campylobacter jejuni infections associated with undercooked chicken livers—Northeastern United States, 2012. Morb. Mortal. Wkly. Rep. 2013, 62, 874–876. [Google Scholar]
- Coker, A.O.; Isokpehi, R.D.; Thomas, B.N.; Amisu, K.O.; Obi, C.L. Human campylobacteriosis in developing countries. Emerg. Infect. Dis. 2002, 8, 237–243. [Google Scholar] [CrossRef] [PubMed]
- Galate, L.; Bangde, S. Campylobacter—A foodborne pathogen. Int. J. Sci. Res. 2013, 4, 2319–7064. [Google Scholar]
- de Bruyn, J.; Thomson, P.C.; Darnton-Hill, I.; Bagnol, B.; Maulaga, W.; Alders, R.G. Does village chicken-keeping contribute to young children’s diets and growth? A longitudinal observational study in rural Tanzania. Nutrients 2018, 10, 1799. [Google Scholar] [CrossRef] [Green Version]
- Ngoso, B.E.; Namkinga, L.A.; Nkwengulila, G. Molecular characterization of diarrheagenic bacteria isolated from stool of under-five children in Dar Es Salaam, Tanzania. J. Biol. Life Sci. 2016, 7, 71–84. [Google Scholar] [CrossRef] [Green Version]
- Blomberg, B.; Manji, K.P.; Urassa, W.K.; Tamim, B.S.; Mwakagile, D.S.M.; Jureen, R.; Msangi, V.; Tellevik, M.G.; Holberg-Petersen, M.; Harthug, S.; et al. Antimicrobial resistance predicts death in Tanzanian children with bloodstream infections: A prospective cohort study. BMC Infect. Dis. 2007, 7, 43. [Google Scholar] [CrossRef] [Green Version]
- George, M.; Amos, B.; Seidlein, L.; Hendriksen, I.; Mwambuli, A.; Kimera, J.; Mallahiyo, R.; Kim, D.R.; Ochiai, R.L.; Clemens, J.D.; et al. Invasive Salmonellosis among children admitted to a rural Tanzanian hospital and a comparison with previous studies. PLoS ONE 2010, 5, e9244. [Google Scholar] [CrossRef]
- Komba, E.V.; Mdegela, R.H.; Msoffe, P.L.; Nielsen, L.N.; Ingmer, H. Prevalence, antimicrobial resistance and risk factors for thermophilic Campylobacter infections in symptomatic and asymptomatic humans in Tanzania. Zoonoses Public Health 2015, 62, 557–568. [Google Scholar] [CrossRef] [PubMed]
- Ilić, K.; Jakovljević, E.; Škodrić-Trifunović, V. Social-economic factors and irrational antibiotic use as reasons for antibiotic resistance of bacteria causing common childhood infections in primary healthcare. Eur. J. Pediatrics 2012, 171, 767–777. [Google Scholar] [CrossRef]
- Threlfall, E.J. Epidemic Salmonella typhimurium DT 104—A truly international multiresistant clone. J. Antimicrob. Chemother. 2000, 46, 7–10. [Google Scholar] [CrossRef]
- McMillan, E.A.; Gupta, S.K.; Williams, L.E.; Jové, T.; Hiott, L.M.; Woodley, T.A.; Barrett, J.B.; Jackson, C.R.; Wasilenko, J.L.; Simmons, M.; et al. Antimicrobial resistance genes, cassettes, and plasmids present in Salmonella enterica associated with United States food animals. Front. Microbiol. 2019, 10, 1–17. [Google Scholar] [CrossRef]
- Wannaprasat, W.; Padungtod, P.; Chuanchuen, R. Class 1 integrons and virulence genes in Salmonella enterica isolates from pork and humans. Int. J. Antimicrob. Agents 2011, 37, 457–461. [Google Scholar] [CrossRef]
- Leon, I.M.; Lawhon, S.D.; Norman, K.N.; Threadgill, D.S.; Ohta, N.; Vinasco, J.; Scott, H.M. Serotype diversity and antimicrobial resistance among Salmonella enterica isolates from patients at an equine referral hospital. Appl. Environ. Microbiol. 2018, 84, e02817–e02829. [Google Scholar] [CrossRef] [Green Version]
- Thieme, O.; Sonaiya, F.; Rota, A.; Guèye, E.F.; Dolberg, F.; Alders, R. Defining Family Poultry Production Systems and Their Contribution to Livelihoods. Decision Tools for Family Poultry Development; FAO Animal Production and Health Guidelines No. 16; FAO: Rome, Italy, 2014; pp. 3–8. [Google Scholar]
- Alders, R.; Aongolo, A.; Bagnol, B.; De Bruyn, J.; Kimboka, S.; Kock, R.; Li, M.; Maulaga, W.; Mcchonchie, R.; Mor, S.; et al. Using a one health approach to promote food and nutrition security in Tanzania and Zambia. Planet@Risk 2014, 2, 187–190. [Google Scholar]
- Valles, M.G. Ecology of Campylobacteriosis in a Tanzanian Rural Village; The Royal Veterinary Collage, University of London: London, UK, 2014. [Google Scholar]
- StataCorp. Stata Statistical Software: Release 14; College Station: StataCorp, TX, USA, 2015. [Google Scholar]
- Linton, D.; Lawson, A.J.; Owen, R.J.; Stanley, J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568–2572. [Google Scholar] [CrossRef] [Green Version]
- Cortez, A.L.; Carvalho, A.C.; Ikuno, A.A.; Burger, K.P.; Vidal-Martins, A.M. Identification of Salmonella spp. isolates from chicken abattoirs by multiplex-PCR. Res. Vet. Sci. 2006, 81, 340–344. [Google Scholar] [CrossRef]
- WHO; GFN. A WHO Network (Global Foodborne Infections Network) for Building Capacity to Detect, Control and Prevent Foodborne and Other Enteric Infections from Farm to Table. Laboratory Protocol for Isolation of Salmonella spp. from Food and Animal Faeces; World Health Organization: Geneva, Switzerland, 2010; Volume 17. [Google Scholar]
- Englen, M.D.; Kelley, L.C. A rapid DNA isolation procedure for the identification of Campylobacter jejuni by the polymerase chain reaction. Lett. Appl. Microbiol. 2000, 31, 421–426. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing. Twenty-Fifth Informational Supplement (M100-S25). 2015. Available online: http://shopping.netsuite.com/s.nl/c.1253739/it.A/id.1899/.f (accessed on 10 November 2016).
- Jacob, P.; Mdegela, R.H.; Nonga, H.E. Comparison of Cape Town and Skirrow’s Campylobacter isolation protocols in humans and broilers in Morogoro, Tanzania. Trop. Anim. Health Prod. 2011, 43, 1007–1013. [Google Scholar] [CrossRef]
- Urfer, E.; Rossier, P.; Méan, F.; Krending, M.J.; Burnens, A.; Bille, J.; Francioli, P.; Zwahlen, A. Outbreak of Salmonella braenderup gastroenteritis due to contaminated meat pies: Clinical and molecular epidemiology. Clin. Microbiol. Infect. 2000, 6, 536–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, S.K.; Nalluswami, K.; Snider, C.; Perch, M.; Balasegaram, M.; Burmeister, D.; Lockett, J.; Sandt, C.; Hoekstra, R.M.; Montgomery, S. Outbreak of Salmonella Braenderup infections associated with Roma tomatoes, northeastern United States, 2004: A useful method for subtyping exposures in field investigations. Epidemiol. Infect. 2007, 135, 1165–1173. [Google Scholar] [CrossRef] [PubMed]
- Victoria State Government. Surveillance of Notifiable Conditions in Victoria; Department of Health and Human Services Victoria: Victoria, Australia, 2019; p. 7.
- Mikoleit, M.; Van Duyne, M.S.; Halpin, J.; McGlinchey, B.; Fields, P.I. Variable expression of O:61 in Salmonella group C2. J. Clin. Microbiol. 2012, 50, 4098–4099. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonose, T.; Smith, A.M.; Keddy, K.H.; Sooka, A.; Howell, V.; Jacobs, C.A.; Haffejee, S.; Govender, P. Human infections due to Salmonella Blockley, a rare serotype in South Africa: A case report. BMC Res. Notes 2012, 5, 1–3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fell, G.; Hamouda, O.; Lindner, R.; Rehmet, S.; Liesegang, A.; Prager, R.; Gericke, B.; Petersen, L. An outbreak of Salmonella Blockley infections following smoked eel consumption in Germany. Epidemiol. Infect. 2000, 125, 9–12. [Google Scholar] [CrossRef] [PubMed]
- Wilson, I.G.; Whitehead, E. Emergence of Salmonella Blockley, possible association with long-term reactive arthritis, and antimicrobial resistance. Pathog. Dis. 2006, 46, 3–7. [Google Scholar]
- Helms, M.; Ethelberg, S.; Mølbak, K.; Group, D.T.S. International Salmonella Typhimurium DT104 infections, 1992–2001. Emerg. Infect. Dis. 2005, 11, 859–867. [Google Scholar] [CrossRef] [PubMed]
- Allard, M.W.; Luo, Y.; Strain, E.; Pettengill, J.; Timme, R.; Wang, C.; Li, C.; Keys, C.E.; Zheng, J.; Stones, R.; et al. On the evolutionary history, population genetics and diversity among isolates of Salmonella Enteritidis PFGE pattern JEGX01.0004. PLoS ONE 2013, 8, e55254. [Google Scholar]
- Jones, R.M.; Wu, H.; Wentworth, C.; Luo, L.; Collier-Hyams, L.; Neish, A.S. Salmonella AvrA coordinates suppression of host immune and apoptotic defenses via JNK pathway blockade. Cell Host Microbe 2008, 3, 233–244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, Y.; Saxena, A.; Kumar, R.; Saxena, M.K. Virulence system of Salmonella with special reference to Salmonella enterica. In Salmonella A Re-Emerging Pathogen; Mascellino, M.T., Ed.; IntechOpen: London, UK, 2018; p. 120. [Google Scholar]
- Lawley, T.D.; Chan, K.; Thompson, L.J.; Kim, C.C.; Govoni, G.R.; Monack, D.M. Genome-wide screen for Salmonella genes required for long-term systemic infection of the mouse. PLoS Pathog. 2006, 2, e11. [Google Scholar] [CrossRef] [Green Version]
- Suez, J.; Porwollik, S.; Dagan, A.; Marzel, A.; Schorr, Y.I.; Desai, P.T.; Agmon, V.; McClelland, M.; Rahav, G.; Gal-Mor, O. Virulence gene profiling and pathogenicity characterization of non-typhoidal Salmonella accounted for invasive disease in humans. PLoS ONE 2013, 8, e58449. [Google Scholar] [CrossRef] [Green Version]
- Rychlik, I.; Gregorova, D.; Hradecka, H. Distribution and function of plasmids in Salmonella enterica. Vet. Microbiol. 2006, 112, 1–10. [Google Scholar] [CrossRef]
- Silva, C.; Puente, J.L.; Calva, E. Salmonella virulence plasmid: Pathogenesis and ecology. Pathog. Dis. 2017, 75, ftx070. [Google Scholar] [CrossRef]
- Hoffmann, M.; Pettengill, J.B.; Gonzalez-Escalona, N.; Miller, J.; Ayers, S.L.; Zhao, S.; Allard, M.W.; McDermott, P.F.; Brown, E.W.; Monday, S.R. Comparative sequence analysis of multidrug-resistant IncA/C plasmids from Salmonella enterica. Front. Microbiol. 2017, 8, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Abdel Aziz, S.A.; Abdel-Latef, G.K.; Shany, S.A.S.; Rouby, S.R. Molecular detection of integron and antimicrobial resistance genes in multidrug resistant Salmonella isolated from poultry, calves and human in Beni-Suef governorate, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2018, 7, 535–542. [Google Scholar] [CrossRef]
- Chopra, I.; Roberts, M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef] [Green Version]
- Fluit, A.C.; Florijn, A.; Verhoef, J.; Milatovic, D. Presence of tetracycline resistance determinants and susceptibility to tigecycline and minocycline. Antimicrob. Agents Chemother. 2005, 49, 1636–1638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hassan, A.-R.H.A.; Salam, H.S.H.; Abdel-Latef, G.K. Serological identification and antimicrobial resistance of Salmonella isolates from broiler carcasses and human stools in Beni-Suef, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2016, 5, 202–207. [Google Scholar] [CrossRef] [Green Version]
Assay | Amplification Conditions | Primers (5′-3′) | Expected Product Size | ||
---|---|---|---|---|---|
Step | Temperature | Time | |||
C. coli/C. jejuni 16S rRNA gene-based PCR | Initial denaturation | 94 °C | 30 s | CCCJ609F (AATCTAATGGCTTAACCATTA) CCCJ1442R (GTAACTAGTTTAGTATTCCGG) | 854 bp |
Denaturation | 94 °C | 1 min | |||
Annealing | 58 °C | 1 min | |||
Extension | 72 °C | 1 min | |||
Final extension | 72 °C | 7 min | |||
C. jejuni hippuricase gene-based PCR | Initial denaturation | 94 °C | 30 s | HIP400F (GAAGAGGGTTTGGGTG) HIP1134R (AGCTAGCTTCGCATAACTTG) | 735 bp |
Denaturation | 94 °C | 1 min | |||
Annealing | 66 °C | 1 min | |||
Extension | 72 °C | 1 min | |||
Final extension | 72 °C | 7 min | |||
Salmonella spp. invA gene-based PCR | Initial denaturation | 94 °C | 30 s | invA-1 (TTGTTACGGCTATTTTGACCA) invA-2 (CTGACTGCTACCTTGCTGATG) | 521 bp |
Denaturation | 94 °C | 1 min | |||
Annealing | 55 °C | 1 min | |||
Extension | 72 °C | 1 min | |||
Final extension | 72 °C | 7 min |
Seasonal Prevalence (%) | ||||||||
---|---|---|---|---|---|---|---|---|
Campylobacter | Salmonella | |||||||
Wards | Dry Season | Rainy Season | Dry Season | Rainy Season | ||||
Sanza | 5.7 | (n = 172) | 7.1 | (n = 126) | 10.5 | (n = 172) | 16.7 | (n = 126) |
Majiri | 11.8 | (n = 110) | 9.0 | (n = 100) | 10.9 | (n = 110) | 14.0 | (n = 100) |
Iwondo | 6.7 | (n = 134) | 8.0 | (n = 138) | 11.9 | (n = 134) | 17.4 | (n = 138) |
Prevalence (%), by Ward | Wards Variations p-Value | Seasonal Variations p-Value | |||
---|---|---|---|---|---|
Variable | Sanza | Majiri | Iwondo | ||
Campylobacter | 0.629 | ||||
Dry season | 5.7 | 11.8 | 6.7 | 0.073 | |
Rainy season | 7.1 | 9.0 | 8.0 | 0.877 | |
Salmonella | 0.483 | ||||
Dry season | 10.5 | 10.9 | 11.9 | 0.919 | |
Rainy season | 16.7 | 14.0 | 17.4 | 0.771 | |
Mixed infections (Campylobacter and Salmonella) | 0.635 | ||||
Dry season | 3.5 | 7.3 | 3.7 | 0.315 | |
Rainy season | 2.4 | 6.0 | 5.1 | 0.363 | |
Campylobacter jejuni | 0.747 | ||||
Dry season | 3.5 | 5.5 | 2.2 | 0.425 | |
Rainy season | 2.4 | 6.0 | 4.4 | 0.380 | |
Campylobacter coli | 0.576 | ||||
Dry season | 1.2 | 6.4 | 4.5 | 0.042 | |
Rainy season | 4.8 | 3.0 | 3.6 | 0.836 |
Laboratory ID | Household ID Number | Ward | Village | Serovars | Resistance Profile | Sequence Type * | Resistance Gene | Plasmids |
---|---|---|---|---|---|---|---|---|
1 | 537 | Sanza | Ntope | S. II 35:g,m,s,t:- | STR (I) | New 1 | None | None |
2 | 173 | Majiri | Mpandagani | S. II 35:g,m,s,t:- | Pansusceptible | New 2 | None | IncI1_1_Alpha |
3 | 678 | Majiri | Kinangali | S. II 35:g,m,s,t:- | STR (I) | New 3 | None | None |
4 | 678 | Majiri | Kinangali | S. II 35:g,m,s,t:- | KAN (I) | New 4 | None | None |
5 | 678 | Majiri | Kinangali | S. II 35:g,m,s,t:- | Pansusceptible | New 5 | None | None |
14 | 438 | Sanza | Ikasi | S. II 35:g,m,s,t:- | Pansusceptible | New 6 | None | None |
8 | 33 | Sanza | Ntope | S. II 35:g,m,s,t:- | Pansusceptible | New 7 | None | None |
16 | 286 | Iwondo | Iwondo I | S. II 35:g,m,s,t:- | Pansusceptible | New 8 | None | None |
17 | 286 | Iwondo | Iwondo I | S. II 35:g,m,s,t:- | AMP (R), STR (I) | New 9 | None | None |
18 | 633 | Sanza | Sanza | S. II 35:g,m,s,t:- | KAN (I), STR (I) | New 10 | None | IncI1_1_Alpha |
9 | 516 | Majiri | Majiri | S. Ball | Pansusceptible | New 11 | FosA7 | IncFIB(pB171)_1_pB171, IncFIB(pCTU3)_1_pCTU3, IncFII(pECLA)_1_pECLA, IncFII(S)_1 |
10 | 516 | Majiri | Majiri | S. Ball | Pansusceptible | New 12 | FosA7 | IncFIB(pB171)_1_pB171, IncFIB(pCTU3)_1_pCTU3, IncFII(pECLA)_1_pECLA, IncFII(S)_1 |
11 | 611 | Sanza | Ikasi | S. Ball | Pansusceptible | New 13 | FosA7 | IncFIB(pB171)_1_pB171, IncFII(pECLA)_1_pECLA, IncFIB(pCTU3)_1_pCTU3, IncFII(S)_1 |
24 | 285 | Iwondo | Igoji II | S. Ball | STR (I) | New 14 | None | IncFIB(pB171)_1_pB171, IncFIB(pCTU3)_1_pCTU3, IncFII(pECLA)_1_pECLA, IncFII(S)_1 |
13 | 117 | Iwondo | Chamanda | S.Typhimurium | Pansusceptible | 19 | None | IncFIB(S)_1, IncFII(S)_1 |
15 | 577 | Sanza | Ikasi | S. Haardt/Blockley | Pansusceptible | New 15 | None | ColRNAI_1 |
6 | 466 | Sanza | Ikasi | S. Braenderup | KAN (I), STR (I) | 22 | None | None |
7 | 33 | Sanza | Ntope | S. Enteritidis/ Gallinarum | Pansusceptible | 78 | None | IncFII(S)_1, IncFII(pECLA)_1_pECLA, ColRNAI_1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rukambile, E.; Sintchenko, V.; Muscatello, G.; Wang, Q.; Kiiru, J.; Maulaga, W.; Magidanga, B.; Banda, G.; Kock, R.; Alders, R. Campylobacter and Salmonella in Scavenging Indigenous Chickens in Rural Central Tanzania: Prevalence, Antimicrobial Resistance, and Genomic Features. Microbiol. Res. 2021, 12, 440-454. https://0-doi-org.brum.beds.ac.uk/10.3390/microbiolres12020030
Rukambile E, Sintchenko V, Muscatello G, Wang Q, Kiiru J, Maulaga W, Magidanga B, Banda G, Kock R, Alders R. Campylobacter and Salmonella in Scavenging Indigenous Chickens in Rural Central Tanzania: Prevalence, Antimicrobial Resistance, and Genomic Features. Microbiology Research. 2021; 12(2):440-454. https://0-doi-org.brum.beds.ac.uk/10.3390/microbiolres12020030
Chicago/Turabian StyleRukambile, Elpidius, Vitali Sintchenko, Gary Muscatello, Qinning Wang, John Kiiru, Wende Maulaga, Bishop Magidanga, Grace Banda, Richard Kock, and Robyn Alders. 2021. "Campylobacter and Salmonella in Scavenging Indigenous Chickens in Rural Central Tanzania: Prevalence, Antimicrobial Resistance, and Genomic Features" Microbiology Research 12, no. 2: 440-454. https://0-doi-org.brum.beds.ac.uk/10.3390/microbiolres12020030