Protective Effect of Cicer arietinum L. (Chickpea) Ethanol Extract in the Dextran Sulfate Sodium-Induced Mouse Model of Ulcerative Colitis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of C. arietinum Ethanol Extract (CEE)
2.2. Sample Preparation and HPLC-PDA-ESI-MS Analysis
2.3. Animals
2.4. Induction of Colitis
2.5. Disease Activity Index (DAI) Measurement
2.6. Hematoxylin and Eosin (H&E) Staining
2.7. Western Blot Analysis
2.8. Myeloperoxidase (MPO) Activity Assay
2.9. Quantitative Real-Time Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. Identification of Phytochemical Composition by HPLC-PDA-ESI-MS in CEE
3.2. CEE Administration Recovered the Symptoms of DSS-Induced Colitis Mice
3.3. CEE Ameliorated Histological Damage in DSS-Induced Colitis
3.4. CEE Attenuated mRNA Expression Levels of Cytokines in DSS-Treated Mice Colonic Tissue
3.5. CEE Attenuated the Protein Expression Levels of Cyclooxygenase (COX)-2 and Inducible Nitric Oxide Synthase (iNOS) and the Activation of NF-κB and STAT3 in Colon Tissue from DSS-Treated Mice
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Nguyen, P.M.; Putoczki, T.L.; Ernst, M. Stat3-activating cytokines: A therapeutic opportunity for inflammatory bowel disease? J. Interferon Cytokine Res. 2015, 35, 340–350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, Z.; Zhou, Q.; Wen, K.; Wu, B.; Sun, X.; Wang, X.; Chen, Y. Huangkui lianchang decoction ameliorates dss-induced ulcerative colitis in mice by inhibiting the nf-kappab signaling pathway. Evid. Based Complement. Alternat. Med. 2019, 2019, 1040847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ng, S.C.; Kaplan, G.G.; Tang, W.; Banerjee, R.; Adigopula, B.; Underwood, F.E.; Tanyingoh, D.; Wei, S.C.; Lin, W.C.; Lin, H.H.; et al. Population density and risk of inflammatory bowel disease: A prospective population-based study in 13 countries or regions in asia-pacific. Am. J. Gastroenterol. 2019, 114, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Shen, P.; Zhang, Z.; He, Y.; Gu, C.; Zhu, K.; Li, S.; Li, Y.; Lu, X.; Liu, J.; Zhang, N.; et al. Magnolol treatment attenuates dextran sulphate sodium-induced murine experimental colitis by regulating inflammation and mucosal damage. Life Sci. 2018, 196, 69–76. [Google Scholar] [CrossRef]
- Gu, P.; Zhu, L.; Liu, Y.; Zhang, L.; Liu, J.; Shen, H. Protective effects of paeoniflorin on tnbs-induced ulcerative colitis through inhibiting nf-kappab pathway and apoptosis in mice. Int. Immunopharmacol. 2017, 50, 152–160. [Google Scholar] [CrossRef]
- Eissa, N.; Hussein, H.; Mesgna, R.; Bonin, S.; Hendy, G.N.; Metz-Boutigue, M.H.; Bernstein, C.N.; Ghia, J.E. Catestatin regulates epithelial cell dynamics to improve intestinal inflammation. Vaccines 2018, 6, 67. [Google Scholar] [CrossRef] [Green Version]
- Zheng, L.; Zhang, Y.L.; Dai, Y.C.; Chen, X.; Chen, D.L.; Dai, Y.T.; Tang, Z.P. Jianpi qingchang decoction alleviates ulcerative colitis by inhibiting nuclear factor-kappab activation. World J. Gastroenterol. 2017, 23, 1180–1188. [Google Scholar] [CrossRef]
- Sugimoto, K. Role of stat3 in inflammatory bowel disease. World J. Gastroenterol. 2008, 14, 5110–5114. [Google Scholar] [CrossRef] [Green Version]
- Varol, I.S.; Kardes, Y.M.; Irik, H.A.; Kirnak, H.; Kaplan, M. Supplementary irrigations at different physiological growth stages of chickpea (Cicer arietinum L.) change grain nutritional composition. Food Chem. 2020, 303, 125402. [Google Scholar] [CrossRef]
- Chassaing, B.; Aitken, J.D.; Malleshappa, M.; Vijay-Kumar, M. Dextran sulfate sodium (dss)-induced colitis in mice. Curr. Protoc. Immunol. 2014, 104. [Google Scholar] [CrossRef]
- Zia-Ul-Haq, M.; I, S.; Ahmad, S.; Imran, M.; Niaz, A.; Bhanger, M.I. Nutritional and compositional study of desi chickpea (Cicer arietinum L.) cultivars grown in Punjab, Pakistan. Food Chem. 2007, 105, 1357–1363. [Google Scholar] [CrossRef]
- Lu, N.; Wang, L.; Cao, H.; Liu, L.; Van Kaer, L.; Washington, M.K.; Rosen, M.J.; Dube, P.E.; Wilson, K.T.; Ren, X.; et al. Activation of the epidermal growth factor receptor in macrophages regulates cytokine production and experimental colitis. J. Immunol. 2014, 192, 1013–1023. [Google Scholar] [CrossRef] [PubMed]
- Biton, I.E.; Stettner, N.; Brener, O.; Erez, A.; Harmelin, A.; Garbow, J.R. Assessing mucosal inflammation in a dss-induced colitis mouse model by mr colonography. Tomography 2018, 4, 4–13. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.J.; Shajib, M.S.; Manocha, M.M.; Khan, W.I. Investigating intestinal inflammation in dss-induced model of ibd. J. Vis. Exp. 2012. [CrossRef] [PubMed] [Green Version]
- Ruoyu Liu, Y.Y.; Qiang, L.; Liao, X.; Zhao, Y. The fragmentation pathway of the nucleosides under the electrospray ionization multi-stage mass spectrometry. Life Sci. J. 2008, 5, 37–40. [Google Scholar]
- Piraud, M.; Vianey-Saban, C.; Petritis, K.; Elfakir, C.; Steghens, J.P.; Morla, A.; Bouchu, D. Esi-ms/ms analysis of underivatised amino acids: A new tool for the diagnosis of inherited disorders of amino acid metabolism. Fragmentation study of 79 molecules of biological interest in positive and negative ionisation mode. Rapid Commun. Mass Spectrom. 2003, 17, 1297–1311. [Google Scholar] [CrossRef]
- Nunes, T.; Bernardazzi, C.; de Souza, H.S. Cell death and inflammatory bowel diseases: Apoptosis, necrosis, and autophagy in the intestinal epithelium. Biomed. Res. Int. 2014, 2014, 218493. [Google Scholar] [CrossRef]
- Pandurangan, A.K.; Ismail, S.; Saadatdoust, Z.; Esa, N.M. Allicin alleviates dextran sodium sulfate- (dss-) induced ulcerative colitis in balb/c mice. Oxid Med. Cell Longev. 2015, 2015, 605208. [Google Scholar] [CrossRef]
- Choudhary, S.; Keshavarzian, A.; Yong, S.; Wade, M.; Bocckino, S.; Day, B.J.; Banan, A. Novel antioxidants zolimid and aeol11201 ameliorate colitis in rats. Dig. Dis. Sci. 2001, 46, 2222–2230. [Google Scholar] [CrossRef]
- Akanda, M.R.; Nam, H.H.; Tian, W.; Islam, A.; Choo, B.K.; Park, B.Y. Regulation of jak2/stat3 and nf-kappab signal transduction pathways; veronica polita alleviates dextran sulfate sodium-induced murine colitis. Biomed. Pharmacother. 2018, 100, 296–303. [Google Scholar] [CrossRef]
- Hong, J.Y.; Chung, K.S.; Shin, J.S.; Park, G.; Jang, Y.P.; Lee, K.T. Anti-colitic effects of ethanol extract of persea americana mill. Through suppression of pro-inflammatory mediators via nf-kappab/stat3 inactivation in dextran sulfate sodium-induced colitis mice. Int. J. Mol. Sci. 2019, 20, 177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okayasu, I.; Hatakeyama, S.; Yamada, M.; Ohkusa, T.; Inagaki, Y.; Nakaya, R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990, 98, 694–702. [Google Scholar] [CrossRef]
- da Silva, A.P.; Ellen, R.P.; Sorensen, E.S.; Goldberg, H.A.; Zohar, R.; Sodek, J. Osteopontin attenuation of dextran sulfate sodium-induced colitis in mice. Lab. Investig. 2009, 89, 1169–1181. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wera, O.; Lancellotti, P.; Oury, C. The dual role of neutrophils in inflammatory bowel diseases. J. Clin. Med. 2016, 5, 118. [Google Scholar] [CrossRef]
- Wang, Z.; Wu, X.; Wang, C.L.; Wang, L.; Sun, C.; Zhang, D.B.; Liu, J.L.; Liang, Y.N.; Tang, D.X.; Tang, Z.S. Tryptanthrin protects mice against dextran sulfate sodium-induced colitis through inhibition of tnf-alpha/nf-kappab and il-6/stat3 pathways. Molecules 2018, 23, 1062. [Google Scholar] [CrossRef] [Green Version]
- Ji, Y.; Dai, Z.; Sun, S.; Ma, X.; Yang, Y.; Tso, P.; Wu, G.; Wu, Z. Hydroxyproline attenuates dextran sulfate sodium-induced colitis in mice: Involvment of the nf-kappab signaling and oxidative stress. Mol. Nutr. Food Res. 2018, 62, e1800494. [Google Scholar] [CrossRef]
- Dae Park, D.; Yum, H.W.; Zhong, X.; Kim, S.H.; Kim, S.H.; Kim, D.H.; Kim, S.J.; Na, H.K.; Sato, A.; Miura, T.; et al. Perilla frutescens extracts protects against dextran sulfate sodium-induced murine colitis: Nf-kappab, stat3, and nrf2 as putative targets. Front. Pharmacol. 2017, 8, 482. [Google Scholar] [CrossRef] [Green Version]
- Mijan, M.A.; Lim, B.O. Diets, functional foods, and nutraceuticals as alternative therapies for inflammatory bowel disease: Present status and future trends. World J. Gastroenterol. 2018, 24, 2673–2685. [Google Scholar] [CrossRef]
- Farombi, E.O.; Adedara, I.A.; Ajayi, B.O.; Ayepola, O.R.; Egbeme, E.E. Kolaviron, a natural antioxidant and anti-inflammatory phytochemical prevents dextran sulphate sodium-induced colitis in rats. Basic Clin. Pharmacol. Toxicol. 2013, 113, 49–55. [Google Scholar] [CrossRef]
- Sobczak, M.; Zakrzewski, P.K.; Cygankiewicz, A.I.; Mokrowiecka, A.; Chen, C.; Salaga, M.; Malecka-Panas, E.; Kordek, R.; Krajewska, W.M.; Fichna, J. Anti-inflammatory action of a novel orally available peptide 317 in mouse models of inflammatory bowel diseases. Pharmacol. Rep. 2014, 66, 741–750. [Google Scholar] [CrossRef]
- Chen, P.; Zhou, X.; Zhang, L.; Shan, M.; Bao, B.; Cao, Y.; Kang, A.; Ding, A. Anti-inflammatory effects of huangqin tang extract in mice on ulcerative colitis. J. Ethnopharmacol. 2015, 162, 207–214. [Google Scholar] [CrossRef] [PubMed]
DAI Score | Weight Loss (%) | Stool Consistency | Hematochezia |
---|---|---|---|
0 | None | Normal | No bleeding |
1 | 1–5 | ||
2 | 5–10 | Loose stools | Slight bleeding |
3 | 10–20 | ||
4 | >20 | Diarrhea | Gross bleeding |
Gene | Sequence | |
---|---|---|
F4/80 | Forward | AGGACTGGAAGCCCATAGCCAA |
Reverse | GCATCTAGCAATGGACAGCTG | |
IL-6 | Forward | GAGGATACCACTCCCAACAGACC |
Reverse | AAGTGCATCATCGTTGTTCATACA | |
IL-1β | Forward | ACCTGCTGGTGTGTGACGTT |
Reverse | TCGTTGCTTGGTTCTCCTTG | |
TNF-α | Forward | AGCACAGAAAGCATGATCCG |
Reverse | CTGATGAGAGGGAGGCCATT | |
β-actin | Forward | ATCACTATTGGCAACGAGCG |
Reverse | ATCACTATTGGCAACGAGCG |
Compound | Rt (min) | Precursor Ion (m/z) | Molecular Formula | λ Max (nm) |
---|---|---|---|---|
| 22.93 | 268.10628 [M + H]+ | C10H14N5O4 | 258 |
| 24.03 | 152.04912 [M + H]+ | C5H6N5O | 254 |
| 25.05 | 284.09571 [M + H]+ | C10H14N5O5 | 252 |
| 42.62 | 205.10663 [M + H]+ | C11H13N2O2 | 219,249 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, M.; Chung, K.-S.; Hwang, S.-J.; Yoon, Y.S.; Jang, Y.P.; Lee, J.K.; Lee, K.-T. Protective Effect of Cicer arietinum L. (Chickpea) Ethanol Extract in the Dextran Sulfate Sodium-Induced Mouse Model of Ulcerative Colitis. Nutrients 2020, 12, 456. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12020456
Kim M, Chung K-S, Hwang S-J, Yoon YS, Jang YP, Lee JK, Lee K-T. Protective Effect of Cicer arietinum L. (Chickpea) Ethanol Extract in the Dextran Sulfate Sodium-Induced Mouse Model of Ulcerative Colitis. Nutrients. 2020; 12(2):456. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12020456
Chicago/Turabian StyleKim, Mia, Kyung-Sook Chung, Se-Jung Hwang, Ye Seul Yoon, Young Pyo Jang, Jong Kil Lee, and Kyung-Tae Lee. 2020. "Protective Effect of Cicer arietinum L. (Chickpea) Ethanol Extract in the Dextran Sulfate Sodium-Induced Mouse Model of Ulcerative Colitis" Nutrients 12, no. 2: 456. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12020456