Effects of Deoxynivalenol and Mycotoxin Adsorbent Agents on Mitogen-Activated Protein Kinase Signaling Pathways and Inflammation-Associated Gene Expression in Porcine Intestinal Epithelial Cells
Abstract
:1. Introduction
2. Results
2.1. Effect of Deoxynivalenol and Lipopolysaccharide on Phosphorylation of MAPK Signaling Pathways and Inflammation and Tight Junction-Associated Gene Expression
2.2. Effect of Deoxynivalenol in Combination with Mycotoxin Adsorbent Agents on Phosphorylation of MAPK Signaling Pathways and Inflammation and Tight Junction-Associated mRNA Expression
3. Discussion
4. Conclusions
5. Materials and Methods
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bryden, W.L. Mycotoxin contamination of the feed supply chain: Implications for animal productivity and feed security. Anim. Feed Sci. Technol. 2012, 173, 134–158. [Google Scholar] [CrossRef]
- Zain, M.E. Impact of mycotoxins on humans and animals. J. Saudi Chem. Soc. 2011, 15, 129–144. [Google Scholar] [CrossRef] [Green Version]
- Rodrigues, I.; Naehrer, K. Prevalence of mycotoxins in feedstuffs and feed surveyed worldwide in 2009 and 2010. Phytopathol. Mediterr. 2012, 51, 175–192. [Google Scholar]
- Yang, C.K.; Cheng, Y.H.; Tsai, W.T.; Liao, R.M.; Chang, C.S.; Chien, W.C.; Jhang, J.C.; Yu, Y.H. Prevalence of mycotoxins in feed and feed ingredient between 2015 and 2017 in Taiwan. Environ. Sci. Pollut. R. 2019, 26, 23798–23806. [Google Scholar] [CrossRef]
- Maresca, M. From the gut to the brain: Journey and pathophysiological effects of the food-associated trichothecene mycotoxin deoxynivalenol. Toxins 2013, 5, 784–820. [Google Scholar] [CrossRef] [PubMed]
- Pierron, A.; Alassane-Kpembi, I.; Oswald, I.P. Impact of two mycotoxins deoxynivalenol and fumonisin on pig intestinal health. Porc. Health Manag. 2016, 2, 21. [Google Scholar] [CrossRef]
- Becker, C.; Reiter, M.; Pfaffl, M.W.; Meyer, H.H.; Bauer, J.; Meyer, K.H. Expression of immune relevant genes in pigs under the influence of low doses of deoxynivalenol (DON). Mycotoxin Res. 2011, 27, 287–293. [Google Scholar] [CrossRef] [PubMed]
- Alizadeh, A.; Braber, S.; Akbari, P.; Garssen, J.; Fink-Gremmels, J. Deoxynivalenol impairs weight gain and affects markers of gut health after low-dose, short-term exposure of growing pigs. Toxins 2015, 7, 2071–2095. [Google Scholar] [CrossRef]
- Groschwitz, K.R.; Hogan, S.P. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [Green Version]
- Pinton, P.; Braicu, C.; Nougayrede, J.P.; Laffitte, J.; Taranu, I.; Oswald, I.P. Deoxynivalenol impairs porcine intestinal barrier function and decreases the protein expression of claudin-4 through a mitogen-activated protein kinase-dependent mechanism. J. Nutr. 2010, 140, 1956–1962. [Google Scholar] [CrossRef] [Green Version]
- Diesing, A.K.; Nossol, C.; Ponsuksili, S.; Wimmers, K.; Kluess, J.; Walk, N.; Post, A.; Rothkötter, H.J.; Kahlert, S. Gene regulation of intestinal porcine epithelial cells IPEC-J2 is dependent on the site of deoxynivalenol toxicological action. PLoS ONE 2012, 7, e34136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van De Walle, J.; During, A.; Piront, N.; Toussaint, O.; Schneider, Y.J.; Larondelle, Y. Physio-pathological parameters affect the activation of inflammatory pathways by deoxynivalenol in Caco-2 cells. Toxicol. Vitro 2010, 24, 1890–1898. [Google Scholar] [CrossRef]
- Vandenbroucke, V.; Croubels, S.; Martel, A.; Verbrugghe, E.; Goossens, J.; Van Deun, K.; Boyen, F.; Thompson, A.; Shearer, N.; De Backer, P.; et al. The mycotoxin deoxynivalenol potentiates intestinal inflammation by Salmonella typhimurium in porcine ileal loops. PLoS ONE 2011, 6, e23871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bracarense, A.P.; Lucioli, J.; Grenier, B.; Drociunas Pacheco, G.; Moll, W.D.; Schatzmayr, G.; Oswald, I.P. Chronic ingestion of deoxynivalenol and fumonisin, alone or in interaction, induces morphological and immunological changes in the intestine of piglets. Br. J. Nutr. 2012, 107, 1776–1786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, H.; Tan, B.E.; Wu, M.M.; Yin, Y.L.; Li, T.J.; Yuan, D.X.; Li, L. Effects of composite antimicrobial peptides in weanling piglets challenged with deoxynivalenol: II. Intestinal morphology and function. J. Anim. Sci. 2013, 91, 4750–4756. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.R.; Harkema, J.R.; Yan, D.; Pestka, J.J. Amplified proinflammatory cytokine expression and toxicity in mice coexposed to lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol). J. Toxicol. Environ. Health Part A 1999, 57, 115–136. [Google Scholar]
- Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Jacobi, S.K.; Zhu, H.; Wu, Z.; Hou, Y. Fish oil enhances intestinal integrity and inhibits TLR4 and NOD2 signaling pathways in weaned pigs after LPS challenge. J. Nutr. 2012, 142, 2017–2024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koltes, D.A.; Gabler, N.K. Characterization of porcine intestinal enteroid cultures under a lipopolysaccharide challenge. J. Anim. Sci. 2016, 94, 335–339. [Google Scholar] [CrossRef]
- Čolović, R.; Puvača, N.; Cheli, F.; Avantaggiato, G.; Greco, D.; Đuragić, O.; Kos, J.; Pinotti, L. Decontamination of mycotoxin-contaminated feedstuffs and compound feed. Toxins 2019, 11, 617. [Google Scholar] [CrossRef] [Green Version]
- Vila-Donat, P.; Marin, S.; Sanchis, V.; Ramos, A.J. A review of the mycotoxin adsorbing agents, with an emphasis on their multi-binding capacity, for animal feed decontamination. Food Chem. Toxicol. 2018, 114, 246–259. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Zhang, Y.; Liu, S.; Wu, Y.; Zhou, Q.; Zhang, Y.; Zheng, X.; Han, Y.; Xie, C.; Liu, N. Adsorption of deoxynivalenol by pillared montmorillonite. Food Chem. 2021, 343, 128391. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.J.; Yang, J.R.; Chen, S.E.; Wu, S.J.; Huang, S.Y.; Lin, J.J.; Chen, L.R.; Tang, P.C. Inhibition of fumonisin B1 cytotoxicity by nanosilicate platelets during mouse embryo development. PLoS ONE 2014, 9, e112290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yiannikouris, A.; André, G.; Poughon, L.; François, J.; Dussap, C.G.; Jeminet, G.; Bertin, G.; Jouany, J.P. Chemical and conformational study of the interactions involved in mycotoxin complexation with β-d-glucans. Biomacromolecules 2006, 7, 1147–1155. [Google Scholar] [CrossRef]
- Joannis-Cassan, C.; Tozlovanu, M.; Hadjeba-Medjdoub, K.; Ballet, N.; Pfohl-Leszkowicz, A. Binding of zearalenone, aflatoxin B1, and ochratoxin A by yeast-based products: A method for quantification of adsorption performance. J. Food Prot. 2011, 74, 1175–1185. [Google Scholar] [CrossRef] [Green Version]
- Kaminska, B. MAPK signalling pathways as molecular targets for anti-inflammatory therapy--from molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta. 2005, 1754, 253–262. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Deng, X.; Zhou, C.; Wu, W.; Zhang, H. Deoxynivalenol induces inflammation in IPEC-J2 cells by activating p38 MAPK and ERK1/2. Toxins 2020, 12, 180–192. [Google Scholar] [CrossRef] [Green Version]
- Kang, R.F.; Li, R.N.; Dai, P.Y.; Li, Z.J.; Li, Y.S.; Li, C.M. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 252, 689–698. [Google Scholar] [CrossRef]
- Liao, P.; Liao, M.; Li, L.; Tan, B.; Yin, Y. Effect of deoxynivalenol on apoptosis, barrier function, and expression levels of genes involved in nutrient transport, mitochondrial biogenesis and function in IPEC-J2 cells. Toxicol. Res. 2017, 6, 866–877. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kahlert, S.; Renner, L.; Kluess, J.; Frahm, J.; Tesch, T.; Bannert, E.; Kersten, S.; Dänicke, S.; Rothkötter, H.J. Effects of deoxynivalenol-feed contamination on circulating LPS in pigs. Innate Immun. 2019, 25, 168–175. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Z.; Xueying, L.; Chunlin, L.; Wen, X.; Rongrong, Z.; Jing, H.; Meilan, J.; Yuwei, X.; Zili, W. Effect of berberine on LPS-induced expression of NF-κB/MAPK signalling pathway and related inflammatory cytokines in porcine intestinal epithelial cells. Innate Immun. 2020, 26, 627–634. [Google Scholar] [CrossRef]
- Klunker, L.R.; Kahlert, S.; Panther, P.; Diesing, A.K.; Reinhardt, N.; Brosig, B.; Kersten, S.; Dänicke, S.; Rothkötter, H.J.; Kluess, J.W. Deoxynivalenol and E.coli lipopolysaccharide alter epithelial proliferation and spatial distribution of apical junction proteins along the small intestinal axis. J. Anim. Sci. 2013, 91, 276–285. [Google Scholar] [CrossRef] [PubMed]
- Springler, A.; Hessenberger, S.; Schatzmayr, G.; Mayer, E. Early activation of MAPK p44/42 is partially involved in DON-induced disruption of the intestinal barrier function and tight junction network. Toxins 2016, 8, 264–283. [Google Scholar] [CrossRef] [Green Version]
- Dänicke, S.; Valenta, H.; Döll, S. On the toxicokinetics and the metabolism of deoxynivalenol (DON) in the pig. Arch. Anim. Nutr. 2004, 58, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.; Breton, S. The MAPK/ERK-signaling pathway regulates the expression and distribution of tight junction proteins in the mouse proximal epididymis. Biol. Reprod. 2016, 94, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Liu, X.; Li, J. Updating techniques on controlling mycotoxins—A review. Food Control 2018, 89, 123–132. [Google Scholar] [CrossRef]
- Ramos, A.J.; Hernandez, E. Prevention of aflatoxicosis in farm animal by means of hydrated sodium calcium aluminosilicate addition to feedstuffs: A review. Anim. Feed Sci. Technol. 1997, 65, 197–206. [Google Scholar] [CrossRef]
- Subramaniam, M.D.; Kim, I.H. Clays as dietary supplements for swine: A review. J. Anim. Sci. Biotechnol. 2015, 6, 38. [Google Scholar] [CrossRef] [Green Version]
- Lindemann, M.D.; Blodgett, D.J.; Kornegay, E.T.; Schurig, G.G. Potential ameliorators of aflatoxicosis in weanling/growing swine. J. Anim. Sci. 1993, 71, 171–178. [Google Scholar] [CrossRef] [Green Version]
- Schell, T.C.; Lindemann, M.D.; Kornegay, E.T.; Blodgett, D.J. Effects of feeding aflatoxin-contaminated diets with and without clay to weanling and growing pigs on performance, liver function, and mineral metabolism. J. Anim. Sci. 1993, 71, 1209–1218. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.P.; Chi, F.; Kim, I.H. Effects of montmorillonite clay on growth performance, nutrient digestibility, vulva size, faecal microflora, and oxidative stress in weaning gilts challenged with zearalenone. Anim. Feed Sci. Technol. 2012, 178, 158–166. [Google Scholar] [CrossRef]
- Li, P.R.; Wei, J.C.; Chiu, Y.F.; Su, H.L.; Peng, F.C.; Lin, J.J. Evaluation on cytotoxicity and genotoxicity of the exfoliated silicate nanoclay. ACS Appl. Mater. Interfaces 2010, 2, 1608–1613. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.W.; Huang, J.T.; Chen, C.C.; Tang, P.C.; Huang, J.W.; Lin, J.J.; Huang, S.Y.; Chen, S.E. Evaluation of efficacy and toxicity of exfoliated silicate nanoclays as a feed additive for fumonisin detoxification. J. Agric. Food Chem. 2017, 65, 6564–6571. [Google Scholar] [CrossRef] [PubMed]
- Kong, C.; Shin, S.Y.; Kim, B.G. Evaluation of mycotoxin sequestering agents for aflatoxin and deoxynivalenol: An in vitro approach. SpringerPlus 2014, 3, 346. [Google Scholar] [CrossRef] [Green Version]
- Shehata, S.; Richter, W.; Schuster, M.; Lindermayer, H. Effect of deoxynivalenol (DON) on growing pigs and its modification by modified yeast cell wall or modified yeast cell wall and bentonite. Mycotoxin Res. 2004, 20, 42–48. [Google Scholar] [CrossRef]
- Holanda, D.M.; Yiannikouris, A.; Kim, S.W. Investigation of the efficacy of a postbiotic yeast cell wall-based blend on newly-weaned pigs under a dietary challenge of multiple mycotoxins with emphasis on deoxynivalenol. Toxins 2020, 12, 504. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Kim, J.; Kim, D.; Moon, Y. Mycotoxin detoxifiers attenuate deoxynivalenol-induced pro-inflammatory barrier insult in porcine enterocytes as an in vitro evaluation model of feed mycotoxin reduction. Toxicol. Vitro 2017, 38, 108–116. [Google Scholar] [CrossRef]
Gene | GenBank Accession Number | Sequence (5′–3′) |
---|---|---|
inos | NM_001143690 | F 1: ACCACGGAACCTAATGATGG |
R: GAGTTGGAGAGGGAGGGAGAT | ||
cox-2 | NM_214321 | F: ATGATCTACCCGCCTCACAC |
R: AAAAGCAGCTCTGGGTCAAA | ||
il-6 | NM_214399 | F: GCTATGAACTCCCTCTCCACA |
R: GCTATGAACTCCCTCTCCACA | ||
claudin 1 | NM_001244539 | F: GATTTACTCCTACGCTGGTGAC |
R: CACAAAGATGGCTATTAGTCCC | ||
claudin 3 | NM_001160075 | F: GCCAAAGCCAAGATCCTCTAC |
R: AGCATCTGGGTGGACTGGT | ||
occludin | NM_001163647 | F: GTAGTCGGGTTCGTTTCC |
R: GACCTGATTGCCTAGAGTGT | ||
β-actin | XM_021086047 | F: GCCAGGTCATCACCATCGG |
R: GTAGAGGTCCTTGCGGATGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Y.-H.; Lai, Y.-H.; Hsiao, F.S.-H.; Cheng, Y.-H. Effects of Deoxynivalenol and Mycotoxin Adsorbent Agents on Mitogen-Activated Protein Kinase Signaling Pathways and Inflammation-Associated Gene Expression in Porcine Intestinal Epithelial Cells. Toxins 2021, 13, 301. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050301
Yu Y-H, Lai Y-H, Hsiao FS-H, Cheng Y-H. Effects of Deoxynivalenol and Mycotoxin Adsorbent Agents on Mitogen-Activated Protein Kinase Signaling Pathways and Inflammation-Associated Gene Expression in Porcine Intestinal Epithelial Cells. Toxins. 2021; 13(5):301. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050301
Chicago/Turabian StyleYu, Yu-Hsiang, Yi-Han Lai, Felix Shih-Hsiang Hsiao, and Yeong-Hsiang Cheng. 2021. "Effects of Deoxynivalenol and Mycotoxin Adsorbent Agents on Mitogen-Activated Protein Kinase Signaling Pathways and Inflammation-Associated Gene Expression in Porcine Intestinal Epithelial Cells" Toxins 13, no. 5: 301. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050301