Pannexin1 Is Associated with Enhanced Epithelial-To-Mesenchymal Transition in Human Patient Breast Cancer Tissues and in Breast Cancer Cell Lines
Abstract
:1. Introduction
2. Results
2.1. PANX1 Over-Expression Is Correlated With Poorer OS in Breast Cancer Patients
2.2. EMT Pathway Correlates Positively with PANX1 Expression
2.3. PANX1 Channel Permeability Inhibition Reduces Cell Viability and Induces Cell Cycle Arrest in Breast Cancer Cell Lines
2.4. Pharmacological Inhibition or Genetic Ablation of PANX1 Channels Abrogate Ethidium Bromide (EtBr) Dye Uptake by PANX1 Channels
2.5. Pharmacological Inhibition or Genetic Ablation of PANX1 Channels Reverse EMT in Breast Cancer Cells
2.6. Pharmacological Inhibition or Genetic Ablation of PANX1 Channels Reduce the Metastatic Potential of Breast Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. CRISPR/Cas9 Mediated Targeting of Human PANX1
4.3. In Silico Gene Expression Analysis
4.3.1. Transcriptomic Datasets
4.3.2. Gene Set Enrichment Analysis (GSEA)
4.3.3. Proteomic Analysis
4.4. Survival Analysis
4.5. Patients and Specimens
4.6. Cell Viability Assay
4.7. Cell Cycle Analysis
4.8. Gene Expression Analysis by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
4.9. Protein Expression Analysis by Western Blotting
4.10. Invasion and Proliferation Assays
4.11. Gelatin Zymography
4.12. Dye Uptake Assay
4.13. Protein Localization by Immunofluorescence
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global cancer incidence and mortality rates and trends—An update. Cancer Epidemiol. Prev. Biomark. 2016, 25, 16–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perou, C.M.; Sorlie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; Rees, C.A.; Pollack, J.R.; Ross, D.T.; Johnsen, H.; Akslen, L.A.; et al. Molecular portraits of human breast tumours. Nature 2000, 406, 747–752. [Google Scholar] [CrossRef] [PubMed]
- Sorlie, T.; Perou, C.M.; Tibshirani, R.; Aas, T.; Geisler, S.; Johnsen, H.; Hastie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA 2001, 98, 10869–10874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prat, A.; Parker, J.S.; Karginova, O.; Fan, C.; Livasy, C.; Herschkowitz, J.I.; He, X.; Perou, C.M. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res. BCR 2010, 12, R68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reis-Filho, J.S.; Pusztai, L. Gene expression profiling in breast cancer: Classification, prognostication, and prediction. Lancet (Lond. Engl. ) 2011, 378, 1812–1823. [Google Scholar] [CrossRef]
- Prat, A.; Perou, C.M. Deconstructing the molecular portraits of breast cancer. Mol. Oncol. 2011, 5, 5–23. [Google Scholar] [CrossRef]
- Nguyen, D.X.; Bos, P.D.; Massagué, J. Metastasis: From dissemination to organ-specific colonization. Nat. Rev. Cancer 2009, 9, 274. [Google Scholar] [CrossRef]
- Valastyan, S.; Weinberg, R.A. Tumor metastasis: Molecular insights and evolving paradigms. Cell 2011, 147, 275–292. [Google Scholar] [CrossRef] [Green Version]
- Budczies, J.; von Winterfeld, M.; Klauschen, F.; Bockmayr, M.; Lennerz, J.K.; Denkert, C.; Wolf, T.; Warth, A.; Dietel, M.; Anagnostopoulos, I. The landscape of metastatic progression patterns across major human cancers. Oncotarget 2015, 6, 570. [Google Scholar] [CrossRef] [Green Version]
- Patanaphan, V.; Salazar, O.M.; Risco, R. Breast cancer: Metastatic patterns and their prognosis. South. Med. J. 1988, 81, 1109–1112. [Google Scholar] [CrossRef]
- Lu, X.; Kang, Y. Organotropism of breast cancer metastasis. J. Mammary Gland Biol. Neoplasia 2007, 12, 153. [Google Scholar] [CrossRef] [PubMed]
- Bodenstine, T.M.; Welch, D.R. Metastasis suppressors and the tumor microenvironment. Cancer Microenviron. 2008, 1, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geiger, T.R.; Peeper, D.S. Metastasis mechanisms. Biochim. Biophys. Acta (Bba)-Rev. Cancer 2009, 1796, 293–308. [Google Scholar] [CrossRef] [PubMed]
- Chaffer, C.L.; Weinberg, R.A. A perspective on cancer cell metastasis. Science 2011, 331, 1559–1564. [Google Scholar] [CrossRef]
- Goodenough, D.A.; Goliger, J.A.; Paul, D.L. Connexins, connexons, and intercellular communication. Annu. Rev. Biochem. 1996, 65, 475–502. [Google Scholar] [CrossRef]
- Goodenough, D.A.; Paul, D.L. Beyond the gap: Functions of unpaired connexon channels. Nat. Rev. Mol. Cell Biol. 2003, 4, 285. [Google Scholar] [CrossRef]
- Panchina, Y.; Kelmanson, I.; Matz, M.; Lukyanov, K.; Usman, N.; Lukyanov, S. A ubiquitous family of putative gap junction molecules. Curr. Biol. 2000, 10, R473–R474. [Google Scholar] [CrossRef] [Green Version]
- Baranova, A.; Ivanov, D.; Petrash, N.; Pestova, A.; Skoblov, M.; Kelmanson, I.; Shagin, D.; Nazarenko, S.; Geraymovych, E.; Litvin, O. The mammalian pannexin family is homologous to the invertebrate innexin gap junction proteins. Genomics 2004, 83, 706–716. [Google Scholar] [CrossRef]
- Chekeni, F.B.; Elliott, M.R.; Sandilos, J.K.; Walk, S.F.; Kinchen, J.M.; Lazarowski, E.R.; Armstrong, A.J.; Penuela, S.; Laird, D.W.; Salvesen, G.S. Pannexin 1 channels mediate ‘find–me’signal release and membrane permeability during apoptosis. Nature 2010, 467, 863. [Google Scholar] [CrossRef] [Green Version]
- Bao, L.; Locovei, S.; Dahl, G. Pannexin membrane channels are mechanosensitive conduits for ATP. FEBS Lett. 2004, 572, 65–68. [Google Scholar] [CrossRef] [Green Version]
- Ishikawa, M.; Iwamoto, T.; Nakamura, T.; Doyle, A.; Fukumoto, S.; Yamada, Y. Pannexin 3 functions as an ER Ca2+ channel, hemichannel, and gap junction to promote osteoblast differentiation. J. Cell Biol. 2011, 193, 1257–1274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Penuela, S.; Bhalla, R.; Gong, X.-Q.; Cowan, K.N.; Celetti, S.J.; Cowan, B.J.; Bai, D.; Shao, Q.; Laird, D.W. Pannexin 1 and pannexin 3 are glycoproteins that exhibit many distinct characteristics from the connexin family of gap junction proteins. J. Cell Sci. 2007, 120, 3772–3783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dahl, G.; Locovei, S. Pannexin: To gap or not to gap, is that a question? IUBMB Life 2006, 58, 409–419. [Google Scholar] [CrossRef] [PubMed]
- Locovei, S.; Bao, L.; Dahl, G. Pannexin 1 in erythrocytes: Function without a gap. Proc. Natl. Acad. Sci. USA 2006, 103, 7655–7659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Penuela, S.; Gehi, R.; Laird, D.W. The biochemistry and function of pannexin channels. Biochim. Biophys. Acta (BBA)-Biomembr. 2013, 1828, 15–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silverman, W.R.; de Rivero Vaccari, J.P.; Locovei, S.; Qiu, F.; Carlsson, S.K.; Scemes, E.; Keane, R.W.; Dahl, G. The pannexin 1 channel activates the inflammasome in neurons and astrocytes. J. Biol. Chem. 2009, 284, 18143–18151. [Google Scholar] [CrossRef] [Green Version]
- Jiang, J.X.; Penuela, S. Connexin and pannexin channels in cancer. Bmc Cell Biol. 2016, 17, S12. [Google Scholar] [CrossRef] [Green Version]
- Graham, S.V.; Jiang, J.X.; Mesnil, M. Connexins and Pannexins: Important Players in Tumorigenesis, Metastasis and Potential Therapeutics. Int. J. Mol. Sci. 2018, 19, 1645. [Google Scholar] [CrossRef] [Green Version]
- Lai, C.P.; Bechberger, J.F.; Thompson, R.J.; MacVicar, B.A.; Bruzzone, R.; Naus, C.C. Tumor-suppressive effects of pannexin 1 in C6 glioma cells. Cancer Res. 2007, 67, 1545–1554. [Google Scholar] [CrossRef] [Green Version]
- Furlow, P.W.; Zhang, S.; Soong, T.D.; Halberg, N.; Goodarzi, H.; Mangrum, C.; Wu, Y.G.; Elemento, O.; Tavazoie, S.F. Mechanosensitive pannexin-1 channels mediate microvascular metastatic cell survival. Nat. Cell Biol. 2015, 17, 943. [Google Scholar] [CrossRef] [Green Version]
- Stewart, M.K.; Plante, I.; Penuela, S.; Laird, D.W. Loss of Panx1 Impairs Mammary Gland Development at Lactation: Implications for Breast Tumorigenesis. PLoS ONE 2016, 11, e0154162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cowan, K.N.; Langlois, S.; Penuela, S.; Cowan, B.J.; Laird, D.W. Pannexin1 and Pannexin3 exhibit distinct localization patterns in human skin appendages and are regulated during keratinocyte differentiation and carcinogenesis. Cell Commun. Adhes. 2012, 19, 45–53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, X.; Langlois, S.; St-Pierre, M.E.; Barre, J.F.; Grynspan, D.; Purgina, B.; Cowan, K.N. Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function. Oncogenesis 2018, 7, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741. [Google Scholar] [CrossRef] [Green Version]
- Thiery, J.P. Epithelial–mesenchymal transitions in development and pathologies. Curr. Opin. Cell Biol. 2003, 15, 740–746. [Google Scholar] [CrossRef]
- Thiery, J.P.; Lim, C.T. Tumor dissemination: An EMT affair. Cancer Cell 2013, 23, 272–273. [Google Scholar] [CrossRef] [Green Version]
- Gotzmann, J.; Mikula, M.; Eger, A.; Schulte-Hermann, R.; Foisner, R.; Beug, H.; Mikulits, W. Molecular aspects of epithelial cell plasticity: Implications for local tumor invasion and metastasis. Mutat. Res. Rev. Mutat. Res. 2004, 566, 9–20. [Google Scholar] [CrossRef]
- Reichert, M.; Müller, T.; Hunziker, W. The PDZ Domains of Zonula Occludens-1 Induce an Epithelial to Mesenchymal Transition of Madin-Darby Canine Kidney I Cells EVIDENCE FOR A ROLE OF β-CATENIN/Tcf/Lef SIGNALING. J. Biol. Chem. 2000, 275, 9492–9500. [Google Scholar] [CrossRef] [Green Version]
- Birchmeier, C.; Birchmeier, W.; Brand-Saberi, B. Epithelial-mesenchymal transitions in cancer progression. Cells Tissues Organs 1996, 156, 217–226. [Google Scholar] [CrossRef]
- Christiansen, J.J.; Rajasekaran, A.K. Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma invasion and metastasis. Cancer Res. 2006, 66, 8319–8326. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zhou, B.P. Epithelial-mesenchymal transition in breast cancer progression and metastasis. Chin. J. Cancer 2011, 30, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Morel, A.P.; Lievre, M.; Thomas, C.; Hinkal, G.; Ansieau, S.; Puisieux, A. Generation of breast cancer stem cells through epithelial-mesenchymal transition. PLoS ONE 2008, 3, e2888. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.A.; Kraut, N.; Beug, H. Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr. Opin. Cell. Biol. 2005, 17, 548–558. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Tillo, E.; de Barrios, O.; Siles, L.; Cuatrecasas, M.; Castells, A.; Postigo, A. beta-catenin/TCF4 complex induces the epithelial-to-mesenchymal transition (EMT)-activator ZEB1 to regulate tumor invasiveness. Proc. Natl. Acad. Sci. USA 2011, 108, 19204–19209. [Google Scholar] [CrossRef] [Green Version]
- Yook, J.I.; Li, X.Y.; Ota, I.; Hu, C.; Kim, H.S.; Kim, N.H.; Cha, S.Y.; Ryu, J.K.; Choi, Y.J.; Kim, J.; et al. A Wnt-Axin2-GSK3beta cascade regulates Snail1 activity in breast cancer cells. Nat. Cell Biol. 2006, 8, 1398–1406. [Google Scholar] [CrossRef]
- Peinado, H.; Olmeda, D.; Cano, A. Snail, Zeb and bHLH factors in tumour progression: An alliance against the epithelial phenotype? Nat. Rev. Cancer 2007, 7, 415–428. [Google Scholar] [CrossRef]
- Olmeda, D.; Jorda, M.; Peinado, H.; Fabra, A.; Cano, A. Snail silencing effectively suppresses tumour growth and invasiveness. Oncogene 2007, 26, 1862–1874. [Google Scholar] [CrossRef] [Green Version]
- Silverman, W.; Locovei, S.; Dahl, G. Probenecid, a gout remedy, inhibits pannexin 1 channels. Am. J. Physiol. Cell Physiol. 2008, 295, C761–C767. [Google Scholar] [CrossRef] [Green Version]
- Pelegrin, P.; Surprenant, A. Pannexin-1 mediates large pore formation and interleukin-1beta release by the ATP-gated P2X7 receptor. EMBO J. 2006, 25, 5071–5082. [Google Scholar] [CrossRef] [Green Version]
- Aasen, T.; Mesnil, M.; Naus, C.C.; Lampe, P.D.; Laird, D.W. Gap junctions and cancer: Communicating for 50 years. Nat. Rev. Cancer 2016, 16, 775. [Google Scholar] [CrossRef] [Green Version]
- Payton, B.; Bennett, M.V.; Pappas, G. Permeability and structure of junctional membranes at an electrotonic synapse. Science 1969, 166, 1641–1643. [Google Scholar] [CrossRef] [PubMed]
- Goodenough, D.A. Bulk isolation of mouse hepatocyte gap junctions: Characterization of the principal protein, connexin. J. Cell Biol. 1974, 61, 557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruch, R.J. Role of gap junctions in cellular growth control and neoplasia: Evidence and mechanisms. In Current Topics in Membranes; Elsevier: Amsterdam, The Netherlands, 1999; Volume 49, pp. 535–554. [Google Scholar]
- Ruch, R.J. Intercellular communication, homeostasis, and toxicology. Toxicol. Sci. 2002, 68, 265–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carystinos, G.D.; Bier, A.; Batist, G. The role of connexin-mediated cell–cell communication in breast cancer metastasis. J. Mammary Gland Biol. Neoplasia 2001, 6, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Boucher, J.; Monvoisin, A.; Vix, J.; Mesnil, M.; Thuringer, D.; Debiais, F.; Cronier, L. Connexins, important players in the dissemination of prostate cancer cells. Biochim. Biophys. Acta (BBA)-Biomembr. 2018, 1860, 202–215. [Google Scholar] [CrossRef] [PubMed]
- McLachlan, E.; Shao, Q.; Wang, H.-l.; Langlois, S.; Laird, D.W. Connexins act as tumor suppressors in three-dimensional mammary cell organoids by regulating differentiation and angiogenesis. Cancer Res. 2006, 66, 9886–9894. [Google Scholar] [CrossRef] [Green Version]
- Penuela, S.; Kelly, J.J.; Churko, J.M.; Barr, K.J.; Berger, A.C.; Laird, D.W. Panx1 regulates cellular properties of keratinocytes and dermal fibroblasts in skin development and wound healing. J. Investig. Dermatol. 2014, 134, 2026–2035. [Google Scholar] [CrossRef] [Green Version]
- Celetti, S.J.; Cowan, K.N.; Penuela, S.; Shao, Q.; Churko, J.; Laird, D.W. Implications of pannexin 1 and pannexin 3 for keratinocyte differentiation. J. Cell Sci. 2010, 123, 1363–1372. [Google Scholar] [CrossRef] [Green Version]
- Adamson, S.E.; Leitinger, N. The role of pannexin1 in the induction and resolution of inflammation. FEBS Lett. 2014, 588, 1416–1422. [Google Scholar] [CrossRef] [Green Version]
- D’hondt, C.; Ponsaerts, R.; De Smedt, H.; Vinken, M.; De Vuyst, E.; De Bock, M.; Wang, N.; Rogiers, V.; Leybaert, L.; Himpens, B. Pannexin channels in ATP release and beyond: An unexpected rendezvous at the endoplasmic reticulum. Cell. Signal. 2011, 23, 305–316. [Google Scholar] [CrossRef]
- Yanguas, S.C.; Willebrords, J.; Johnstone, S.R.; Maes, M.; Decrock, E.; De Bock, M.; Leybaert, L.; Cogliati, B.; Vinken, M. Pannexin1 as mediator of inflammation and cell death. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2017, 1864, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Gest, C.; Joimel, U.; Huang, L.; Pritchard, L.-L.; Petit, A.; Dulong, C.; Buquet, C.; Hu, C.-Q.; Mirshahi, P.; Laurent, M. Rac3 induces a molecular pathway triggering breast cancer cell aggressiveness: Differences in MDA-MB-231 and MCF-7 breast cancer cell lines. BMC Cancer 2013, 13, 63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huijbers, I.J.; Ali, R.B.; Pritchard, C.; Cozijnsen, M.; Kwon, M.C.; Proost, N.; Song, J.Y.; de Vries, H.; Badhai, J.; Sutherland, K. Rapid target gene validation in complex cancer mouse models using re-derived embryonic stem cells. EMBO Mol. Med. 2014, 6, 212–225. [Google Scholar] [CrossRef] [PubMed]
- Ransford, G.A.; Fregien, N.; Qiu, F.; Dahl, G.; Conner, G.E.; Salathe, M. Pannexin 1 contributes to ATP release in airway epithelia. Am. J. Respir. Cell Mol. Biol. 2009, 41, 525–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, W.; Hui, H.; Pelegrin, P.; Surprenant, A. Pharmacological characterization of pannexin-1 currents expressed in mammalian cells. J. Pharmacol. Exp. Ther. 2009, 328, 409–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ebert, R.; Meissner-Weigl, J.; Zeck, S.; Määttä, J.; Auriola, S.; de Sousa, S.C.; Mentrup, B.; Graser, S.; Rachner, T.D.; Hofbauer, L.C. Probenecid as a sensitizer of bisphosphonate-mediated effects in breast cancer cells. Mol. Cancer 2014, 13, 265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mawhinney, L.J.; de Rivero Vaccari, J.P.; Dale, G.A.; Keane, R.W.; Bramlett, H.M. Heightened inflammasome activation is linked to age-related cognitive impairment in Fischer 344 rats. BMC Neurosci. 2011, 12, 123. [Google Scholar] [CrossRef] [Green Version]
- Zhu, W.; Leber, B.; Andrews, D.W. Cytoplasmic O-glycosylation prevents cell surface transport of E-cadherin during apoptosis. EMBO J. 2001, 20, 5999–6007. [Google Scholar] [CrossRef] [Green Version]
- Micalizzi, D.S.; Farabaugh, S.M.; Ford, H.L. Epithelial-mesenchymal transition in cancer: Parallels between normal development and tumor progression. J. Mammary Gland Biol. Neoplasia 2010, 15, 117–134. [Google Scholar] [CrossRef] [Green Version]
- Taube, J.H.; Herschkowitz, J.I.; Komurov, K.; Zhou, A.Y.; Gupta, S.; Yang, J.; Hartwell, K.; Onder, T.T.; Gupta, P.B.; Evans, K.W. Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proc. Natl. Acad. Sci. USA 2010, 107, 15449–15454. [Google Scholar] [CrossRef] [Green Version]
- Barrallo-Gimeno, A.; Nieto, M.A. The Snail genes as inducers of cell movement and survival: Implications in development and cancer. Development 2005, 132, 3151–3161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Massagué, J. TGFβ in cancer. Cell 2008, 134, 215–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikushima, H.; Miyazono, K. TGFβ signalling: A complex web in cancer progression. Nat. Rev. Cancer 2010, 10, 415. [Google Scholar] [CrossRef] [PubMed]
- Bierie, B.; Moses, H.L. Tumour microenvironment: TGFβ: The molecular Jekyll and Hyde of cancer. Nat. Rev. Cancer 2006, 6, 506. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hung, S.-C.; Choi, C.H.; Said-Sadier, N.; Johnson, L.; Atanasova, K.R.; Sellami, H.; Yilmaz, Ö.; Ojcius, D.M. P2X4 assembles with P2X7 and pannexin-1 in gingival epithelial cells and modulates ATP-induced reactive oxygen species production and inflammasome activation. PLoS ONE 2013, 8, e70210. [Google Scholar] [CrossRef] [Green Version]
- Xing, F.; Okuda, H.; Watabe, M.; Kobayashi, A.; Pai, S.K.; Liu, W.; Pandey, P.R.; Fukuda, K.; Hirota, S.; Sugai, T. Hypoxia-induced Jagged2 promotes breast cancer metastasis and self-renewal of cancer stem-like cells. Oncogene 2011, 30, 4075. [Google Scholar] [CrossRef] [Green Version]
- Sahlgren, C.; Gustafsson, M.V.; Jin, S.; Poellinger, L.; Lendahl, U. Notch signaling mediates hypoxia-induced tumor cell migration and invasion. Proc. Natl. Acad. Sci. USA 2008, 105, 6392–6397. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Yuan, M.; Yao, Y.; Wu, D.; Dong, S.; Tong, X. In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway. Biomed. Pharmacother. Biomed. Pharmacother. 2019, 117, 109090. [Google Scholar] [CrossRef]
- Kotini, M.; Barriga, E.H.; Leslie, J.; Gentzel, M.; Rauschenberger, V.; Schambony, A.; Mayor, R. Gap junction protein Connexin-43 is a direct transcriptional regulator of N-cadherin in vivo. Nat. Commun. 2018, 9, 3846. [Google Scholar] [CrossRef]
- Radisky, E.S.; Radisky, D.C. Matrix metalloproteinases as breast cancer drivers and therapeutic targets. Front. Biosci. (Landmark Ed. ) 2015, 20, 1144. [Google Scholar] [CrossRef] [PubMed]
- Freeman, T.J.; Sayedyahossein, S.; Johnston, D.; Sanchez-Pupo, R.E.; O’Donnell, B.; Huang, K.; Lakhani, Z.; Nouri-Nejad, D.; Barr, K.J.; Harland, L.; et al. Inhibition of pannexin 1 reduces the tumorigenic properties of human melanoma cells. Cancers 2019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dai, X.; Cheng, H.; Bai, Z.; Li, J. Breast cancer cell line classification and its relevance with breast tumor subtyping. J. Cancer 2017, 8, 3131–3141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chavez, K.J.; Garimella, S.V.; Lipkowitz, S. Triple negative breast cancer cell lines: One tool in the search for better treatment of triple negative breast cancer. Breast Dis. 2010, 32, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mateos-Gomez, P.A.; Gong, F.; Nair, N.; Miller, K.M.; Lazzerini-Denchi, E.; Sfeir, A. Mammalian polymerase θ promotes alternative NHEJ and suppresses recombination. Nature 2015, 518, 254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grossman, R.L.; Heath, A.P.; Ferretti, V.; Varmus, H.E.; Lowy, D.R.; Kibbe, W.A.; Staudt, L.M. Toward a Shared Vision for Cancer Genomic Data. N. Engl. J. Med. 2016, 375, 1109–1112. [Google Scholar] [CrossRef]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data; AACR: Philadelphia, PA, USA, 2012. [Google Scholar]
- Gao, J.; Aksoy, B.A.; Dogrusoz, U.; Dresdner, G.; Gross, B.; Sumer, S.O.; Sun, Y.; Jacobsen, A.; Sinha, R.; Larsson, E. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal. 2013, 6, pl1. [Google Scholar] [CrossRef] [Green Version]
- Curtis, C.; Shah, S.P.; Chin, S.F.; Turashvili, G.; Rueda, O.M.; Dunning, M.J.; Speed, D.; Lynch, A.G.; Samarajiwa, S.; Yuan, Y.; et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 2012, 486, 346–352. [Google Scholar] [CrossRef]
- Mootha, V.K.; Lindgren, C.M.; Eriksson, K.F.; Subramanian, A.; Sihag, S.; Lehar, J.; Puigserver, P.; Carlsson, E.; Ridderstrale, M.; Laurila, E.; et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat. Genet. 2003, 34, 267–273. [Google Scholar] [CrossRef]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Green Version]
- Mertins, P.; Mani, D.R.; Ruggles, K.V.; Gillette, M.A.; Clauser, K.R.; Wang, P.; Wang, X.; Qiao, J.W.; Cao, S.; Petralia, F.; et al. Proteogenomics connects somatic mutations to signalling in breast cancer. Nature 2016, 534, 55–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yehia, L.; Boulos, F.; Jabbour, M.; Mahfoud, Z.; Fakhruddin, N.; El-Sabban, M. Expression of HIF-1α and markers of angiogenesis are not significantly different in triple negative breast cancer compared to other breast cancer molecular subtypes: Implications for future therapy. PLoS ONE 2015, 10, e0129356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaito, A.; Saliba, J.; Husari, A.; El-Harakeh, M.; Chhouri, H.; Hashem, Y.; Shihadeh, A.; El-Sabban, M. Electronic Cigarette Smoke Impairs Normal Mesenchymal Stem Cell Differentiation. Sci. Rep. 2017, 7, 14281. [Google Scholar] [CrossRef] [PubMed]
- El-Hajjar, L.; Jalaleddine, N.; Shaito, A.; Zibara, K.; Kazan, J.M.; El-Saghir, J.; El-Sabban, M. Bevacizumab induces inflammation in MDA-MB-231 breast cancer cell line and in a mouse model. Cell Signal. 2019, 53, 400–412. [Google Scholar] [CrossRef] [PubMed]
- El-Hajjar, L.; Shaito, A.; Jalaleddine, N.; Zibara, K.; Kazan, J.M.; El-Saghir, J.; El-Sabban, M. Data on migration of the non-invasive breast cancer cell line, MCF-7 treated with Bevacizumab using Real Time Cell Analyzer (RTCA). Data Brief. 2019, 22, 635–638. [Google Scholar] [CrossRef] [PubMed]
- Kazan, J.M.; El-Saghir, J.; Saliba, J.; Shaito, A.; Jalaleddine, N.; El-Hajjar, L.; Al-Ghadban, S.; Yehia, L.; Zibara, K.; El-Sabban, M. Cx43 expression correlates with breast cancer metastasis in MDA-MB-231 cells in vitro, in a mouse xenograft model and in human breast cancer tissues. Cancers 2019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhaskaracharya, A.; Dao-Ung, P.; Jalilian, I.; Spildrejorde, M.; Skarratt, K.K.; Fuller, S.J.; Sluyter, R.; Stokes, L. Probenecid blocks human P2X7 receptor-induced dye uptake via a pannexin-1 independent mechanism. PLoS ONE 2014, 9, e93058. [Google Scholar] [CrossRef] [Green Version]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate—A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
Genes | Primer Sequence | Annealing Temperature (°C) |
---|---|---|
PANX1 | F: AGACGAGTTTGTGTGCAGCATC R: CAAAAGTGGGGAGGATTCGTAC | 56 |
E-cadherin | F: CAGAAAGTTTTCCACCAAAG R: AAATGTGSGCAATTCTGCTT | 58 |
N-cadherin | F: GGTGGAGGAGAAGAAGACCAG R: GGCATCAGGCTCCACAGT | 58 |
HIF-1α | F: AGCCAGATCTCGGCGAAGT R: CAGAGGCCTTATCAAGATGCG | 58 |
TGF-1β | F: CTAATGGTGGAAACCCACAACG R: TATCGCCAGGAATTGTTGCTG | 57 |
Slug | F: GAGCATTTGCAGACAGGTCA R: ACAGCAGCCAGATTCCTCAT | 57 |
Snail | F: CTTCCAGCAGCCCTACGAC R: CGGTGGGGTTGAGGATCT | 58 |
Vimentin | F: AGGTGGACCAGCTAACCAAC R: TCTCCTCCTGCAATTTCTCC | 56 |
β-catenin | F: AGGGATTTTCTCAGTCCTTC R: CATGCCCTCATCTAATGTCT | 54 |
GAPDH | F: TGGTGCTCAGTGTAGCCCAG R: GGACCTGACCTGCCGTCTAG | 58 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jalaleddine, N.; El-Hajjar, L.; Dakik, H.; Shaito, A.; Saliba, J.; Safi, R.; Zibara, K.; El-Sabban, M. Pannexin1 Is Associated with Enhanced Epithelial-To-Mesenchymal Transition in Human Patient Breast Cancer Tissues and in Breast Cancer Cell Lines. Cancers 2019, 11, 1967. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers11121967
Jalaleddine N, El-Hajjar L, Dakik H, Shaito A, Saliba J, Safi R, Zibara K, El-Sabban M. Pannexin1 Is Associated with Enhanced Epithelial-To-Mesenchymal Transition in Human Patient Breast Cancer Tissues and in Breast Cancer Cell Lines. Cancers. 2019; 11(12):1967. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers11121967
Chicago/Turabian StyleJalaleddine, Nour, Layal El-Hajjar, Hassan Dakik, Abdullah Shaito, Jessica Saliba, Rémi Safi, Kazem Zibara, and Marwan El-Sabban. 2019. "Pannexin1 Is Associated with Enhanced Epithelial-To-Mesenchymal Transition in Human Patient Breast Cancer Tissues and in Breast Cancer Cell Lines" Cancers 11, no. 12: 1967. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers11121967