Activation of Vitamin D Receptor Pathway Enhances Differentiating Capacity in Acute Myeloid Leukemia with Isocitrate Dehydrogenase Mutations
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Primary AML Cells
2.2. Mice and Patient-Derived Xenografted Model
2.3. AML Cell Lines
2.4. Reagents
2.5. Lentiviral Infection
2.6. RNA Extraction and RT-qPCR
2.7. Western Blot
2.8. Analysis of Myeloid Differentiation
2.8.1. Flow Cytometry
2.8.2. Morphological Characterization
2.9. Data Exploration Mining
2.10. Single Cell RNA Sequencing
2.11. Metabolomic Analyses
2.11.1. Extraction of Metabolites
2.11.2. Metabolite Quantification
2.12. Statistical Analysis
3. Results
3.1. Vitamin D Receptor-Related Gene Signatures Are Enriched in Transcriptomes of IDH Mutant Cells
3.2. IDH Mutations Activate CEBPa-VDR-RXR Axis through 2HG Production
3.3. Combine Treatment with VD and ATRA Produces a Synergistic Induction of Differentiation in a CEBPα-Dependent Manner
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Short, N.J.; Rytting, M.E.; Cortes, J.E. Acute myeloid leukaemia. Lancet 2018, 392, 593–606. [Google Scholar] [CrossRef]
- Figueroa, M.E.; Abdel-Wahab, O.; Lu, C.; Ward, P.S.; Patel, J.; Shih, A.; Li, Y.; Bhagwat, N.; Vasanthakumar, A.; Fernandez, H.F.; et al. Leukemic IDH1 and IDH2 Mutations Result in a Hypermethylation Phenotype, Disrupt TET2 Function, and Impair Hematopoietic Differentiation. Cancer Cell 2010, 18, 553–567. [Google Scholar] [CrossRef] [Green Version]
- Lu, C.; Ward, P.S.; Kapoor, G.S.; Rohle, D.; Turcan, S.; Abdel-Wahab, O.; Edwards, C.R.; Khanin, R.; Figueroa, M.E.; Melnick, A.; et al. IDH mutation impairs histone demethylation and results in a block to cell differentiation. Nature 2012, 483, 474–478. [Google Scholar] [CrossRef] [Green Version]
- Boutzen, H.; Saland, E.; Larrue, C.; De Toni, F.; Gales, L.; Castelli, F.A.; Cathebas, M.; Zaghdoudi, S.; Stuani, L.; Kaoma, T.; et al. Isocitrate dehydrogenase 1 mutations prime the all-trans retinoic acid myeloid differentiation pathway in acute myeloid leukemia. J. Exp. Med. 2016, 213, 483–497. [Google Scholar] [CrossRef]
- Jia, D.; Lu, M.; Jung, K.H.; Park, J.H.; Yu, L.; Onuchic, J.N.; Kaipparettu, B.A.; Levine, H. Elucidating cancer metabolic plasticity by coupling gene regulation with metabolic pathways. Proc. Natl. Acad. Sci. USA 2019, 116, 3909–3918. [Google Scholar] [CrossRef] [Green Version]
- Ok, C.Y.; Loghavi, S.; Sui, D.; Wei, P.; Kanagal-Shamanna, R.; Yin, C.C.; Zuo, Z.; Routbort, M.J.; Tang, G.; Tang, Z.; et al. Persistent IDH1/2 mutations in remission can predict relapse in patients with acute myeloid leukemia. Haematologica 2019, 104, 305–311. [Google Scholar] [CrossRef] [Green Version]
- Short, N.J.; Konopleva, M.; Kadia, T.M.; Borthakur, G.; Ravandi, F.; Dinardo, C.D.; Daver, N. Advances in the Treatment of Acute Myeloid Leukemia: New Drugs and New Challenges. Cancer Discov. 2020, 10, 506–525. [Google Scholar] [CrossRef] [Green Version]
- Intlekofer, A.M.; Shih, A.H.; Wang, B.; Nazir, A.; Rustenburg, A.S.; Albanese, S.; Patel, M.; Famulare, C.; Correa, F.M.; Takemoto, N.; et al. Acquired resistance to IDH inhibition through trans or cis dimer-interface mutations. Nature 2018, 559, 125–129. [Google Scholar] [CrossRef]
- Harding, J.J.; Lowery, M.A.; Shih, A.H.; Schvartzman, J.M.; Hou, S.; Famulare, C.; Patel, M.; Roshal, M.; Do, R.K.; Zehir, A.; et al. Isoform Switching as a Mechanism of Acquired Resistance to Mutant Isocitrate Dehydrogenase Inhibition. Cancer Discov. 2018, 8, 1540–1547. [Google Scholar] [CrossRef] [Green Version]
- Choe, S.; Wang, H.; Dinardo, C.D.; Stein, E.M.; De Botton, S.; Fathi, A.T.; Tallman, M.S.; Kantarjian, H.M.; Stone, R.M.; Quek, L.; et al. Molecular Mechanisms Mediating Relapse Following Ivosidenib Monotherapy in Patients with IDH1-Mutant Relapsed or Refractory Acute Myeloid Leukemia. Blood 2019, 134, 545. [Google Scholar] [CrossRef]
- Chan, S.M.; Thomas, D.; Corces, M.; Xavy, S.; Rastogi, S.; Hong, W.-J.; Zhao, F.; Medeiros, B.C.; Tyvoll, D.A.; Majeti, R. Isocitrate dehydrogenase 1 and 2 mutations induce BCL-2 dependence in acute myeloid leukemia. Nat. Med. 2015, 21, 178–184. [Google Scholar] [CrossRef] [Green Version]
- Losman, J.A.; Looper, R.; Koivunen, P.; Lee, S.; Schneider, R.K.; McMahon, C.; Cowley, G.S.; Root, D.E.; Ebert, B.L.; Kaelin, W.G., Jr. (R)-2-Hydroxyglutarate Is Sufficient to Promote Leukemogenesis and Its Effects Are Reversible. Science 2013, 339, 1621–1625. [Google Scholar] [CrossRef]
- Stuani, L.; Sabatier, M.; Saland, E.; Cognet, G.; Poupin, N.; Bosc, C.; Castelli, F.A.; Gales, L.; Turtoi, E.; Montersino, C.; et al. Mitochondrial metabolism supports resistance to IDH mutant inhibitors in acute myeloid leukemia. J. Exp. Med. 2021, 218, e20200924. [Google Scholar] [CrossRef] [PubMed]
- Warwick, T.; Schulz, M.H.; Günther, S.; Gilsbach, R.; Neme, A.; Carlberg, C.; Brandes, R.P.; Seuter, S. A hierarchical regulatory network analysis of the vitamin D induced transcriptome reveals novel regulators and complete VDR dependency in monocytes. Sci. Rep. 2021, 11, 6518. [Google Scholar] [CrossRef] [PubMed]
- Butler, A.; Hoffman, P.; Smibert, P.; Papalexi, E.; Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. 2018, 36, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Hafemeister, C.; Satija, R. Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression. Genome Biol. 2019, 20, 1. [Google Scholar] [CrossRef] [Green Version]
- Verhaak, R.G.W.; Wouters, B.J.; Erpelinck, C.A.; Abbas, S.; Beverloo, H.B.; Lugthart, S.; Lowenberg, B.; Delwel, R.; Valk, P.J. Prediction of molecular subtypes in acute myeloid leukemia based on gene expression profiling. Haematologica 2009, 94, 131–134. [Google Scholar] [CrossRef] [Green Version]
- Gocek, E.; Marcinkowska, E. Differentiation therapy of acute myeloid leukemia. Cancers 2021, 3, 2. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.; Morita, K.; DiNardo, C.D.; Furudate, K.; Tanaka, T.; Yan, Y.; Patel, K.P.; MacBeth, K.J.; Liu, G.; Frattini, M.; et al. Leukemia stemness and co-occurring mutations drive resistance to IDH inhibitors in acute myeloid leukemia. Nat. Commun. 2021, 12, 1. [Google Scholar] [CrossRef]
- Nurminen, V.; Neme, A.; Seuter, S.; Carlberg, C. Modulation of vitamin D signaling by the pioneer factor CEBPA. Biochim. Biophys. Acta-Gene Regul. Mech. 2019, 1862, 96–106. [Google Scholar] [CrossRef]
- Dhawan, P.; Weider, R.; Christakos, S. CCAAT enhancer-binding protein α is a molecular target of 1,25-dihydroxyvitamin D3 in MCF-7 breast cancer cells. J. Biol. Chem. 2009, 284, 3086–3095. [Google Scholar] [CrossRef] [Green Version]
- Nowak, U.; Janik, S.; Marchwicka, A.; Łaszkiewicz, A.; Jakuszak, A.; Cebrat, M.; Marcinkowska, E. Investigating the Role of Methylation in Silencing of VDR Gene Expression in Normal Cells during Hematopoiesis and in Their Leukemic Counterparts. Cells 2020, 9, 1991. [Google Scholar] [CrossRef] [PubMed]
- Paubelle, E.; Zylbersztejn, F.; Maciel, T.T.; Carvalho, C.; Mupo, A.; Cheok, M.; Lieben, L.; Sujobert, P.; Decroocq, J.; Yokoyama, A.; et al. Vitamin D Receptor Controls Cell Stemness in Acute Myeloid Leukemia and in Normal Bone Marrow. Cell Rep. 2020, 30, 739–754. [Google Scholar] [CrossRef] [Green Version]
- Marik, R.; Fackler, M.; Gabrielson, E.; Zeiger, M.A.; Sukumar, S.; Stearns, V.; Umbricht, C.B. DNA methylation-related vitamin D receptor insensitivity in breast cancer. Cancer Biol. Ther. 2010, 10, 44–53. [Google Scholar] [CrossRef] [Green Version]
- Döhner, H.; Estey, E.; Grimwade, D.; Amadori, S.; Appelbaum, F.R.; Büchner, T.; Dombret, H.; Ebert, B.L.; Fenaux, P.; Larson, R.A.; et al. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood 2017, 129, 424–447. [Google Scholar] [CrossRef] [Green Version]
- DiNardo, C.D.; Perl, A.E. Advances in patient care through increasingly individualized therapy. Nat. Rev. Clin. Oncol. 2019, 16, 73–74. [Google Scholar] [CrossRef] [PubMed]
- Stein, E.M.; Dinardo, C.D.; Pollyea, D.A.; Fathi, A.T.; Roboz, G.J.; Altman, J.K.; Stone, R.M.; DeAngelo, D.; Levine, R.L.; Flinn, I.; et al. Enasidenib in mutant IDH2 relapsed or refractory acute myeloid leukemia. Blood 2017, 130, 722–731. [Google Scholar] [CrossRef] [PubMed]
- Stein, E.M.; Dinardo, C.D.; Fathi, A.T.; Pollyea, D.A.; Stone, R.M.; Altman, J.K.; Roboz, G.J.; Patel, M.R.; Collins, R.; Flinn, I.W.; et al. Molecular remission and response patterns in patients with mutant-IDH2 acute myeloid leukemia treated with enasidenib. Blood 2019, 133, 676–687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roboz, G.J.; Dinardo, C.D.; Stein, E.M.; De Botton, S.; Mims, A.S.; Prince, G.T.; Altman, J.K.; Arellano, M.L.; Donnellan, W.; Erba, H.P.; et al. Ivosidenib induces deep durable remissions in patients with newly diagnosed IDH1-mutant acute myeloid leukemia. Blood 2020, 135, 463–471. [Google Scholar] [CrossRef] [Green Version]
- Amatangelo, M.D.; Quek, L.; Shih, A.; Stein, E.M.; Roshal, M.; David, M.; Marteyn, B.; Farnoud, N.R.; De Botton, S.; Bernard, O.; et al. Enasidenib induces acute myeloid leukemia cell differentiation to promote clinical response. Blood 2017, 130, 732–741. [Google Scholar] [CrossRef]
- Luong, Q.T.; Koeffler, H.P. Vitamin D compounds in leukemia. J. Steroid Biochem. Mol. Biol. 2005, 97, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Gocek, E.; Marchwicka, A.; Baurska, H.; Chrobak, A.; Marcinkowska, E. Opposite regulation of vitamin D receptor by ATRA in AML cells susceptible and resistant to vitamin D-induced differentiation. J. Steroid Biochem. Mol. Biol. 2012, 132, 220–226. [Google Scholar] [CrossRef] [PubMed]
- Dhawan, P.; Peng, X.; Sutton, A.; MacDonald, P.N.; Croniger, C.M.; Trautwein, C.; Centrella, M.; McCarthy, T.L.; Christakos, S. Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D 3 24-Hydroxylase. Mol. Cell. Biol. 2005, 25, 472–487. [Google Scholar] [CrossRef] [Green Version]
- Marcinkowska, E.; Garay, E.; Gocek, E.; Chrobak, A.; Wang, X.; Studzinski, G.P. Regulation of C/EBPβ isoforms by MAPK pathways in HL60 cells induced to differentiate by 1,25-dihydroxyvitamin D3. Exp. Cell Res. 2006, 312, 2054–2065. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, Y.; Studzinski, G.P. Retinoblastoma Protein and CCAAT/Enhancer-Binding Protein β Are Required for 1,25-Dihydroxyvitamin D3-Induced Monocytic Differentiation of HL60 Cells. Cancer Res. 2004, 64, 370–377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, R.; Dong, L.; Li, C.; Nachtergaele, S.; Wunderlich, M.; Qing, Y.; Deng, X.; Wang, Y.; Weng, X.; Hu, C.; et al. R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m6A/MYC/CEBPA Signaling. Cell 2017, 172, 90–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qing, Y.; Dong, L.; Gao, L.; Li, C.; Li, Y.; Han, L.; Prince, E.; Tan, B.; Deng, X.; Wetzel, C.; et al. R-2-hydroxyglutarate attenuates aerobic glycolysis in leukemia by targeting the FTO/m6A/PFKP/LDHB axis. Mol. Cell 2021, 81, 922–939. [Google Scholar] [CrossRef] [PubMed]
- Neme, A.; Seuter, S.; Carlberg, C. Selective regulation of biological processes by vitamin D based on the spatio-temporal cistrome of its receptor. Biochim. Biophys. Acta-Gene Regul. Mech. 2017, 1860, 952–961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glass, J.L.; Hassane, D.; Wouters, B.J.; Kunimoto, H.; Avellino, R.; Garrett-Bakelman, F.E.; Guryanova, O.A.; Bowman, R.; Redlich, S.; Intlekofer, A.; et al. Epigenetic Identity in AML Depends on Disruption of Nonpromoter Regulatory Elements and Is Affected by Antagonistic Effects of Mutations in Epigenetic Modifiers. Cancer Discov. 2017, 7, 868–883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DiNardo, C.D.; Propert, K.J.; Loren, A.W.; Paietta, E.; Sun, Z.; Levine, R.L.; Straley, K.S.; Yen, K.; Patel, J.P.; Agresta, S.; et al. Serum 2-hydroxyglutarate levels predict isocitrate dehydrogenase mutations and clinical outcome in acute myeloid leukemia. Blood 2013, 121, 4917–4924. [Google Scholar] [CrossRef]
- Wang, W.; Li, G.; He, X.; Gao, J.; Wang, R.; Wang, Y.; Zhao, W. Serum 25-hydroxyvitamin D levels and prognosis in hematological malignancies: A systematic review and meta-analysis. Cell. Physiol. Biochem. 2015, 35, 1999–2005. [Google Scholar] [CrossRef]
- Thomas, X.; Chelghoum, Y.; Fanari, N.; Cannas, G. Serum 25-hydroxyvitamin D levels are associated with prognosis in hematological malignancies. Hematology 2011, 16, 278–283. [Google Scholar] [CrossRef] [PubMed]
- Emadi, A.; Faramand, R.; Carter-Cooper, B.; Tolu, S.; Ford, L.A.; Lapidus, R.G.; Wetzler, M.; Wang, E.S.; Etemadi, A.; Griffiths, E.A. Presence of isocitrate dehydrogenase mutations may predict clinical response to hypomethylating agents in patients with acute myeloid leukemia. Am. J. Hematol. 2015, 90, E77–E79. [Google Scholar] [CrossRef]
- Sekeres, M.A.; Othus, M.; List, A.; Odenike, O.; Stone, R.M.; Gore, S.D.; Litzow, M.R.; Buckstein, R.; Fang, M.; Roulston, D.; et al. Randomized Phase II Study of Azacitidine Alone or in Combination with Lenalidomide or with Vorinostat in Higher-Risk Myelodysplastic Syndromes and Chronic Myelomonocytic Leukemia: North American Intergroup Study SWOG S1117. J. Clin. Oncol. 2017, 35, 2745–2753. [Google Scholar] [CrossRef]
- Döhner, H.; Dolnik, A.; Tang, L.; Seymour, J.F.; Minden, M.D.; Stone, R.M.; Del Castillo, T.B.; Al-Ali, H.K.; Santini, V.; Vyas, P.; et al. Cytogenetics and gene mutations influence survival in older patients with acute myeloid leukemia treated with azacitidine or conventional care. Leukemia 2018, 32, 2546–2557. [Google Scholar] [CrossRef]
- Willekens, C.; Rahme, R.; Duchmann, M.; Vidal, V.; Saada, V.; Broutin, S.; Delahousse, J.; Renneville, A.; Marceau, A.; Clappier, E.; et al. Effects of azacitidine in 93 patients with IDH1/2 mutated acute myeloid leukemia/myelodysplastic syndromes: A French retrospective multicenter study. Leuk. Lymphoma 2021, 62, 438–445. [Google Scholar] [CrossRef]
- Fathi, A.T.; Sadrzadeh, H.; Borger, D.R.; Ballen, K.K.; Amrein, P.C.; Attar, E.C.; Foster, J.; Burke, M.; Lopez, H.U.; Matulis, C.R.; et al. Prospective serial evaluation of 2-hydroxyglutarate, during treatment of newly diagnosed acute myeloid leukemia, to assess disease activity and therapeutic response. Blood 2012, 120, 4649–4652. [Google Scholar] [CrossRef] [Green Version]
- Feldman, D.; Krishnan, A.V.; Swami, S.; Giovannucci, E.; Feldman, B.J. The role of vitamin D in reducing cancer risk and progression. Nat. Rev. Cancer 2014, 14, 342–357. [Google Scholar] [CrossRef]
- Montesinos, P.; Bergua, J.M.; Vellenga, E.; Rayón, C.; Parody, R.; De la Serna, J.; León, A.; Esteve, J.; Milone, G.; Debén, G.; et al. Differentiation syndrome in patients with acute promyelocytic leukemia treated with all-trans retinoic acid and anthracycline chemotherapy: Characteristics, outcome, and prognostic factors. Blood 2009, 113, 775–783. [Google Scholar] [CrossRef] [PubMed]
- Fathi, A.T.; DiNardo, C.D.; Kline, I.; Kenvin, L.; Gupta, I.; Attar, E.C.; Stein, E.M.; De Botton, S. Differentiation syndrome associated with enasidenib, a selective inhibitor of mutant isocitrate dehydrogenase 2 analysis of a phase 1/2 study. JAMA Oncol. 2018, 4, 1106–1110. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Tang, Z.; Slominski, A.T.; Li, W.; Zmijewski, M.A.; Liu, Y.; Chen, J. Vitamin D and its analogs as anticancer and anti-inflammatory agents. Eur. J. Med. Chem. 2020, 207, 112738. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward | Reverse |
---|---|---|
PPIA | 5′ CTCGAATAAGTTTGACTTGTGTTT 3′ | 5′ CTAGGCATGGGAGGGAACA 3′ |
RARA | 5′ GTCTTTGCCTTCGCCAACCA 3′ | 5′ GCCCTCTGAGTTCTCCAACA 3′ |
VDR | 5′ CCTTCACCATGGACGACATG 3′ | 5′ CTTTGGTCACGTCACT 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sabatier, M.; Boet, E.; Zaghdoudi, S.; Guiraud, N.; Hucteau, A.; Polley, N.; Cognet, G.; Saland, E.; Lauture, L.; Farge, T.; et al. Activation of Vitamin D Receptor Pathway Enhances Differentiating Capacity in Acute Myeloid Leukemia with Isocitrate Dehydrogenase Mutations. Cancers 2021, 13, 5243. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers13205243
Sabatier M, Boet E, Zaghdoudi S, Guiraud N, Hucteau A, Polley N, Cognet G, Saland E, Lauture L, Farge T, et al. Activation of Vitamin D Receptor Pathway Enhances Differentiating Capacity in Acute Myeloid Leukemia with Isocitrate Dehydrogenase Mutations. Cancers. 2021; 13(20):5243. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers13205243
Chicago/Turabian StyleSabatier, Marie, Emeline Boet, Sonia Zaghdoudi, Nathan Guiraud, Alexis Hucteau, Nathaniel Polley, Guillaume Cognet, Estelle Saland, Laura Lauture, Thomas Farge, and et al. 2021. "Activation of Vitamin D Receptor Pathway Enhances Differentiating Capacity in Acute Myeloid Leukemia with Isocitrate Dehydrogenase Mutations" Cancers 13, no. 20: 5243. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers13205243