The Sodium/Calcium Exchanger PcNCX1-Mediated Ca²⁺ Efflux Is Involved in Cinnamaldehyde-Induced Cell-Wall Defects of Phytophthora capsici

Abstract

Phytophthora capsici is one of the devastating pathogens, causing foliar blight, root rot, and fruit rot in peppers. Cinnamaldehyde (CA) is a natural compound coming from Cinnamomum cassia. The medicinal properties of CA have been widely identified. Limited knowledge is known about the application of CA in agriculture. In this study, CA significantly inhibited P. capsici, which further suppressed Phytophthora blights in both pepper seedlings and pepper fruits. Treatment with CA resulted in collapsed and fragmented hyphae, accompanying the increase in MDA (malondialdehyde) content and the decrease in intercellular glycerol content in hyphae. CA also inhibited the growth of wild type yeast. The yeast mutant ΔYvc1 with a deletion of Yvc1 (a Ca²⁺ transporter) showed decreased sensitivity to CA. The transformation of PcNCX1, a sodium/calcium exchanger from P. capsici, into ΔYvc1 restored its sensitivity to CA. The transformant carrying PcNCX1 also showed restored Ca²⁺ efflux upon CA treatment. RNA-seq analysis showed that CA treatments resulted in the down-regulation of a set of genes encoding for calcium-related proteins. Collectively, our study demonstrates that the antifungal activity of CA against P. capsici may be associated with PcNCX1-mediated Ca²⁺ efflux. Our results provide crucial insights into the antimicrobial action of CA.

1. Introduction

Phytophthora blights caused by Phytophthora capsici are an increasingly severe disease on solanaceous and cucurbitaceous hosts, such as pepper, cucumber, tomato, eggplant, and pumpkin [1]. Chemical fungicides are frequently used to control Phytophthora blight diseases. However, the long-term application of chemical fungicides not only leads to the resistance of P. capsici but also poses potential threats on human health and environment [2]. Consequently, environmentally friendly fungicides need to be developed in order to control Phytophthora blight diseases effectively.

Cinnamaldehyde (CA), a major constituent of cinnamon essential oils, has been widely used as food additives and medicine due to its antimicrobial activities and pharmacological effects [3]. CA can modulate physiological changes in host mammalian cells by regulating several intrinsic signals such as Ca²⁺, nitric oxide (NO), and adenosine monophosphate-activated protein kinase (AMPK) [4]. In the Gram-positive bacterium Staphylococcus aureus, CA can inhibit its hemolytic activity on human erythrocytes and reduce its adherence to latex [5]. Moreover, In Streptococcus mutans, CA decreased biofilm biomass and metabolism at sub-MIC (Minimum inhibitory concentrations) concentrations [6]. In Aspergillus brasiliensis, CA exhibits a high in vitro antifungal effect by altering the morphology of the hyphae [7]. It has been reported that CA has significant antifungal activity against Colletotrichum lagenarium, an important plant-pathogenic fungus causing the anthracnose of cucumbers [8]. Our previous study suggested that CA had great potential to control Phytophthora blight disease by promoting pepper root growth and inhibiting the growth of P. capsici [9]. Ca²⁺ efflux has been closely linked to the antifungal activity of CA against P. capsici [9]. However, the molecular mechanism for CA-mediated Ca²⁺ efflux in P. capsici remains unclear.

Ca²⁺ is a secondary messenger involved in numerous signaling pathways in eukaryotic cells [10]. In filamentous fungi, Ca²⁺ regulates a diverse array of biological processes including cell cycle, sporulation, hyphal morphogenesis, infection structure differentiation, and pathogenesis [11,12]. The disruption of Ca²⁺ homeostasis results in defects of fungal cell wall integrity, further inhibiting fungal growth [13,14]. Ca²⁺ homeostasis is maintained by Ca²⁺ channels, pumps, and transporters. The Na⁺/Ca²⁺ exchanger (NCX) is the major pathway for transport of Ca²⁺ out of the cytoplasm, a putative NCX gene, Arabidopsis NCX-like (AtNCL), contributed to Ca²⁺ homeostasis under abiotic stress [15]. The yeast vacuolar conductance 1 (Yvc1, also named TRPY1) is a Ca²⁺ transporter, which mediates Ca²⁺ release from the vacuole in yeast in response to hypertonic shock [16]. It has been documented that CA has great potential to activate Yvc1 in mammalian cells [17]. We previously found that CA was able to disturb Ca²⁺ homeostasis in P. capsici. This drove us to think about the possibility for the regulation of P. capsici Ca²⁺ channels by CA. On the other hand, it is well known that the RNA-seq has been used a routine method for studying the fungal growth, pathogenesis, and the genes involved in resistance [18,19,20].

In this work, we first identified the antifungal effect of CA against P. capsici in vivo and in vitro. Then, we studied the role of PcNCX1 (a sodium/calcium exchanger) in CA-disturbed Ca²⁺ homeostasis in P. capsici based on yeast complementation experiments. In addition, we analyzed the gene expression profile of CA-treated P. capsici using the RNA-seq. The involvement of PcNCX1-Ca²⁺ in the antifungal mechanism for CA against P. capsici was discussed as well.

2. Materials and Methods

2.1. Strains and Growth Conditions

P. capsici strain (Institution of plant protection, Nanjing Agricultural University) was cultured on PDA (potato dextrose agar) medium at 25 °C, For liquid cultures, P. capsici strains were grown in a V8 medium at 25 °C at 100 rpm.

2.2. Complementation of the S. cerevisiae ΔYvc1

The CDS fragment of PcNCX1 (BT032616.1, Table S1) was amplified from P. capsici RNA by PCR using primer pairs Ncx1-F (Hind III): aagcttATGGCTCAGCGCCGACGC and Ncx1-R (Xho I): ctcgagTTAAATGATGTCCAAGCCGC. The fragment was purified and cloned into a pMD19-T vector (Takara, Co., Dalian, China) to generate plasmid pMD-PcNCX1. The PcNCX1 fragment was digested with HindIII-XhoI from pMD-PcNCX1 and subcloned into the pYES2 yeast expression vector digested with HindIII-XhoI to generate pYES2-PcNCX1 expressing PcNCX1 under the Gal1 promoter. After verification by sequencing, the pYES2-PcNCX1 plasmid was introduced into the S. cerevisiae ΔYvc1 mutant strain YOR087W (BY4741; MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; YOR087w::kanMX4), and it was purchased from Euroscarf (accessed on 15 May 2022, http://www.euroscarf.de/search.php?search=YOR087W, Germany). Yeast cells were incubated on a liquid YPD (yeast extract peptone dextrose) medium containing CA at various concentration.

2.3. Inoculation of P. capsici on Pepper Seedlings and Plants

Zoospores of P. capsici were induced from 5-day-old sporangia by washing with sterile distilled water for 24 h at 25 °C and were adjusted to a concentration of 1 × 10⁵ spores/mL for inoculations. Pepper (Capsicum annuum) fruits (Sujiao 5) were surface- sterilized with 1% NaClO for 10 min followed by washing with double-distilled water (ddH₂O) for three times. A total of 50 μL of zoospores suspension (1 × 10⁵ spores/mL) with 1 mM CA [21] were inoculated on the surface of each pepper fruit at three different sites. The inoculated pepper fruits were placed in a plastic box with a water-saturated filter paper and were incubated at 25 °C. The disease symptoms were observed at 4 days post inoculation (dpi). For pepper plants inoculation, a total of 50 μL of zoospores suspension (1 × 10⁵ spores/mL) with 1 mM CA was inoculated at the stem base of 35-day-old pepper plants (Sujiao 5). The inoculated plants were kept in a chamber with photosynthetic active radiation of 200 μmol/m²/s, a photoperiod of 12 h and a temperature at 25 °C for 4 days followed by the observation of disease symptoms.

2.4. Histochemical Staining

Trypan blue staining was used to evaluated cell death in the root pepper plant. The pepper roots at 4 dpi were carefully washed with ddH₂O. Then, the roots were stained with Trypan blue (10 mg/L) for 1 h and detained in lactophenol for 1 h followed by photographing with a digital camera [22,23].

The intracellular Ca²⁺ in yeast cells were labeled in situ with specific fluorescent probe Fluo-3-AM (Beyotime Biotechnology Institute, Haimen, China). Fluo-3-AM was added to yeast suspension at a final concentration of 150 μM. Then, the suspension was incubated at 37 °C for 1 h. Confocal microscopy was performed using a Zeiss Axiovert 200 M microscope equipped with a Zeiss LSM 710 META system using 940/1.2 NA and 963/1.2 NA C-Apochromat water immersion objectives. Images were acquired and processed using LSM 710 AIM version 4.2 SP1 software (Zeiss, Oberkochen, Germany).

2.5. Determination of Glycerol Content

The P. capsici strain grown in liquid V8 media were treated with 0, 0.8, 1.6, and 2 mM of CA [21] for 24 h. Then, the mycelia were harvested for the determination of glycerol content. Glycerol content was determined using cupric glycerinate colorimetric assay under the instructions of a glycerol detection kit (E1012; Beijing Applygen Technologies Inc., Beijing, China).

2.6. Determination of Malondialdehyde (MDA) Content

The content of MDA was determined as an indicator of the lipid peroxidation in CA-treated mycelia of P. capsici. An MDA detection kit (A003; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) was selected to determine the MDA’s level based on the spectrophotometric determination of the reaction between MDA and 1,3-diethyl-2-thiobarbituric acid (TBA) assisted by trichloroacetic acid (TCA).

2.7. Scanning Electron Microscopy (SEM)

The P. capsici mycelia was cultivated with liquid V8 with or without CA (1 mM). The samples were fixed in 2.5% glutaraldehyde for 2 h. Then, the samples were transferred to alcohol with increasing concentrations (30%, 50%, and 70%) for 15 min followed by 20 min in 80%, 90%, 95%, and 100% of alcohol, consecutively. The graded aqueous series of acetone (25%, 50%, 75%, and 100%) was critical point dried with CO₂ using acetone as an intermediate fluid. After that, the fungal samples were visualized and photographed by SEM (EVO-LS10, ZEISS, Jena, Germany).

2.8. qRT-PCR Analysis

Quantitative RT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (ABI Co., Carlsbad, CA, USA) and transcripts were analyzed using the 7500 System SDS software (ABI). To compare the relative abundances of target gene transcripts, the average threshold cycle (Ct) was normalized to that of Actin (Actin-F: ACTGCACGTTCCAGACGATC; Actin-R: CCACCACCTTGATCTTCATG) for each of the treated samples as 2^−ΔCt, where −ΔCt = (C_{t, target gene} − C_{t, actin}). Fold change was calculated as 2^−ΔΔCt, where −ΔΔCt = (C_{t, target gene} − C_{t, actin})_{treated with CA}−(C_{t, control} − C_{t, actin})_control. The primers were 131120-RT-F: ACTCGCTCTGGTATACGTGG and 131120-RT-R: AACAACAGTTTACCACCCGC.

2.9. Total RNA Isolation and Library Preparation for Transcriptome Sequencing

Total RNA was extracted from P. capsici mycelia treated with 1 mM CA for 24 h using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacture’s protocol. P. capsici mycelia without CA were taken as control. The quality and integrity of RNA was evaluated using Bioanalyzer 2100 (Agilent Technologies, CA, USA) and agarose gel electrophoresis. A total amount of 3 μg RNA per sample was used as input material for the RNA sample preparation. Sequencing libraries were generated using NEBNext Ultra^TM RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA) following the manufacturer’s recommendations. The mRNA was purified from total RNA using oligo (dT)-attached magnetic beads. The first strand cDNA was synthesized using random hexamer primer and M-MuLV reverse transcriptase. Second stand cDNA syntheses were subsequently performed using DNA polymerase I and RNase H. After second-strand cDNA synthesis and dual-index adaptor ligation, the paired-end library fragments with 150–200 bp in length were purified with AMPure XP system (Beckman Coulter, Beverly, CA, USA). The library quality was assessed using Agilent Bioanalyzer 2100 system. Then, four libraries (Control-1, -2 and CA-treatment-1, -2) preparations were sequenced on an Illumina Hiseq 2000 platform to generate 100 bp paired-end reads (BGI, Shenzhen, Guangzhou, China).

2.10. Quality Control, Transcriptome Assembly and Differential Expression Analysis of Unigenes

For quality control, raw sequencing data were filtered by Fast QC software, and low-quality reads were filtered out. Both clean reads were de novo assembled with Trinity with the default settings, with the exception that min_kmer_cov was set to 2 by default.

The analysis of DEGs (differential expression genes) between two samples were performed with the DEGseq R package. The p-value was adjusted using the q value. The q value < 0.005 and the absolute value of log₂ > 1 were set as the threshold for significant difference in gene expression. Gene ontology (GO) analyses of DEGs were implemented by BGI WEGO (Web Gene Ontology Annotation Plotting, accessed on 15 August 2015, http://wego.genomics.org.cn/cgi-bin/wego/index.pl) and agriGO (GO Analysis Toolkit and Database for Agricultural Community, accessed on 15 August 2015, http://bioinfo.cau.edu.cn/agriGO/index.php). Pathways were significantly enriched with KEGG (Q-value < 0.05).

2.11. Statistical Analysis

For the data of the measurement of physiological parameters, each result was presented as the mean and standard deviation (SD) of three replicates. The least significant difference (LSD) test was performed on all data following a one-way analysis of variance (ANOVA) to test for significant differences (p < 0.05) among different treatments.

3. Results

3.1. CA Controlled the Pepper Phytophthora Blight

In our previous study, CA exerted efficient inhibitory effects on both mycelial growth (EC₅₀ = 0.75 mM) and zoospore germination (MIC = 0.4 mM) of P. capsici [6]. To investigate the role of CA in the pathogenicity of P. capsici, CA (1 mM) was applied on pepper fruit surface inoculated with P. capsici zoospore suspensions. Pepper fruit inoculated with P. capsicia showed severe disease symptoms while treatment with CA resulted in much fewer fruit rots at 4 dpi (Figure 1A). Similar results were obtained with pepper plants (Figure 1B). Inoculation with P. capsici at the base of stem resulted in the infection of stem and roots, further leading to seedling lodging and leaf withering. Treatment with CA was able to rescue seedling growth from the infection of P. capsici (Figure 1B). As a kind of soil borne disease fungus, P. capsici can infect plant roots to cause root cell death. We analyzed root cell death using trypan blue staining. CA remarkably attenuated root cell death of seedlings inoculated with P. capsici (Figure 1C). These results indicated that CA effectively controlled the infection of P. capsici on pepper.

3.2. CA Impacted Cell Integrity of P. capsici

Results from the SEM revealed clear morphological alterations in the hyphae of P. capsici under CA treatments. Compared to the control group, collapsed and fragmented hyphae were observed in mycelia treated with CA (Figure 2A). The accumulation of MDA is a typical indicator of oxidative injury and plasma membrane damage [24]. Treatment with CA led to significant increase in MDA content in the mycelia of P. capsici in a dose-dependent manner (Figure 2B). The intercellular glycerol plays a critical role in the protection of fungal cells from osmotic stress [25]. We found that treatment with CA resulted in a significant decrease in intercellular glycerol content in the mycelia of P. capsici. The changes of MDA and glycerol content also confirmed the loss of cell integrity in the hyphae of P. capsici under CA treatment.

3.3. Identification of CA-Regulated Ca²⁺ Channels in P. capsici

We previously found that CA induced immediate Ca²⁺ efflux from zoospores of P. capsici [9]. In this study, the yeast mutant ΔYvc1 was used to investigate CA-regulated Ca²⁺ channel in P. capsici. ΔYvc1 was more tolerant to CA compared to the wild type (WT) yeast, indicating that Yvc1 played a role in response to CA (Figure 3A). Then, we complemented the yeast mutant ΔYvc1 with PcNCX1 (the P. capsici sodium/calcium exchanger). The transformants (ΔYvc1/NCX1 #1 and ΔYvc1/NCX1 #2) expressing PcNCX1 showed recovered sensitivity to different concentration of CA (Figure 3A), indicating that PcNCX1 maybe the potential target of CA. Then we tested the intracellular Ca²⁺ level using specific fluorescent probe Fluo-3 AM. In CA-free medium, the intracellular Ca²⁺ was successfully labeled with green fluorescence in WT yeast, the deletion mutant ΔYvc1, and the complemented strain ΔYvc1/PcNCX1 (Figure 3B). Compared to WT and the ΔYvc1/PcNCX1 strains, the deletion mutant ΔYvc1 stilled showed strong fluorescent signal upon CA treatment (Figure 3C). These results showed that the PcNCX1 can partly restore CA-induced Ca²⁺ efflux in the yeast deletion mutant ΔYvc1.

3.4. Transcriptome Analysis of P. capsici Treated with CA

To explore the mechanisms underlying the inhibition of P. capsici by CA, we performed RNA-sequencing of P. capsici hyphae under CA treatments and found that the hyphae are thin compared to control (Figure 4A). Approximately 46 million (96.81%) and 44 million (98.33%) clean reads were obtained from CA-treatment and control, respectively (

Table 1. Summary of sequences analysis of sample of treated with CA and control.

Sample Name	Raw Reads	Clean Reads	Genome Map Rate	Gene Map Rate	Expressed Transcripts
CA-treatment	47,695,094	46,172,436	91.46%	71.95%	13,230
control	45,423,808	44,664,188	91.32%	68.05%	13,667

). Among all the clean reads, approximately 91.46% and 91.32% of the CA-treatment and control were mapped to the reference genome, respectively (Table 1). We identified 956 up-regulated unigenes and 2575 down-regulated unigenes upon CA treatment (Figure 4B).

Enrichment analysis was performed to illustrate the biological functions of the identified DEGs. In total, 607, 1184, and 1198 DGEs of cellular components, molecular function, and biological process were enriched in 37 (gene ontology) GO terms. Five GO terms including “metabolic process” (805), “Cellular process” (578), and “Single-organism process” (457) in the category of biological process; “Catalytic activity” (1229) and “Transporter activity” (215) in the category of molecular function were significantly enriched in the CA-treatment sample (Figure 5A). In addition, 1591 DEGs were enriched in KEGG pathways. The most enriched pathways were “Metabolic pathways” (388) and “Biosynthesis of secondary metabolites” (169) (Figure 5B).

Ca²⁺ acts as a second messenger to modulate numerous intrinsic metabolic processes by regulating a set of Ca²⁺-binding proteins [26]. CA affected Ca²⁺ homeostasis by regulating PcNCX1. We screened the expression level of genes coding for Ca²⁺-regulated proteins from RNA-sequencing data. As expected, in the CA-treatment samples, 25 and 5 calcium-related proteins were down- and up-regulated, respectively (

Table 2. Summary of DEGs encoding calcium-related genes.

Gene ID	Log2 Ratio (CA_Treatment/Control)	Up/Down-Regulation (CA_Treatment/Control)	p-Value	Gene Annotation
534,503	2.100603941	Up	1.48 × 10−13	Probable calcium-binding protein
534,501	1.757530286	Up	1.04 × 10−15	Putative calmodulin-3
507,044	1.698515183	Up	0	Calmodulin
548,475	1.629408523	Up	4.67 × 10−172	Calnexin homolog
535,137	1.181965909	Up	1.34 × 10−27	Mitochondrial proton/calcium exchanger protein
68,193	−11.45121111	Down	1.46 × 10−6	Calcium-dependent protein kinase 9
111,992 *	−6.434628228	Down	6.64 × 10−26	Plasma membrane calcium-transporting ATPase 4
130,774	−5.933690655	Down	4.95 × 10−17	Caltractin
507,496	−5.36862133	Down	2.23 × 10−11	Probable calcium-binding protein CML13
6853	−4.37625161	Down	3.55 × 10−20	EF-hand calcium-binding domain containing protein 10
123,091	−2.64385619	Down	3.75 × 10−12	Calcium-dependent protein kinase 7
109,877 *	−2.485426827	Down	6.44 × 10−5	Calcium-transporting ATPase 10, plasma membrane-type
117,823	−2.37469857	Down	2.46 × 10−13	Calcineurin subunit B
6396	−2.348262243	Down	7.47 × 10−13	Probable calcium-binding protein CML45
109,832	−2.270282489	Down	9.25 × 10−27	Uncharacterized calcium-binding protein C50C3.5
98,673	−2.159568209	Down	9.27 × 10−35	Calretinin
121,662	−2.137074852	Down	2.85 × 10−9	Calcineurin B-like protein 2
531,031	−1.941557727	Down	1.38 × 10−63	Probable calcium-binding protein CML18
119,329	−1.910916456	Down	2.60 × 10−8	Calmodulin-like protein 12
540283	−1.893563064	Down	1.44 × 10−14	Calcineurin B-like protein 10
41,424	−1.816842742	Down	2.15 × 10−10	Probable calcium-binding protein CML18
574,424	−1.802060622	Down	6.45 × 10−22	Voltage-dependent L-type calcium channel subunit alpha-1C
126,140 *	−1.729910837	Down	1.77 × 10−7	Plasma membrane calcium-transporting ATPase 4
525,961	−1.601016081	Down	2.76 × 10−19	Cobalt/magnesium transport protein CorA
41,359	−1.34356494	Down	1.75 × 10−34	Caltractin
547,508	−1.296891544	Down	2.53 × 10−17	Calcium-dependent protein kinase 34
504,561	−1.295161185	Down	1.48 × 10−9	Calcineurin subunit B
549,419 *	−1.184730681	Down	2.02 × 10−12	Plasma membrane calcium-transporting ATPase 4
542,784	−1.145992514	Down	5.49 × 10−56	Calcium-dependent protein kinase 22
554,361	−1.073761931	Down	3.95 × 10−18	Caltractin ICL1e

Note: Asterisk indicates four Ca²⁺ pump proteins.

). This may due to decreased intracellular Ca²⁺ levels in CA-treated P. capsici. In addition, we found that the expressions of four Ca²⁺ pump genes (111,992, 109,877, 126,140, and 549,419) were also down-regulated by CA, indicating that the down-regulation of these genes may also contributed CA-suppressed intracellular Ca²⁺ levels in P. capsici.

ABC (ATP-binding cassette) transporters mainly use the hydrolysis of ATP to fuel the transmembrane’s transport and participates in the physiological process of drug resistance by facilitating drug efflux [27]. In this study, we found that 45 DEGs (including 34 down-regulated and 11 up-regulated) encoded for ABC transporters and drug-resistance proteins in the CA-treated samples (Table S2). These results suggested that ABC transporters in P. capsici may be differentially regulated by CA.

4. Discussion

P. capsici is a highly destructive plant pathogen worldwide. CA is a widely used flavoring agent that has been used to improve food quality. In this study, we showed that CA was able to destroy the cell integrity of P. capsici hyphae and to control pepper phytophthora effectively. Yvc1 in S. cerevisiae is a vacuolar membrane localized calcium channel. Yvc1 mediates Ca²⁺ release from the vacuole in response to hypertonic shock [28,29,30]. We found that PcNCX1 can partly restore the immediate Ca²⁺ efflux of the yeast deletion mutant ΔYvc1 under CA treatment. Thus, CA could target PcNCX1 to cause cell defects of P. capsici.

CA could be a safe antibacterial and antifungal alternative due to its food additive properties. Several studies have shown that CA can inhibit the growth, morphology, and mycelial formation of C. albicans. Our previous study indicated that CA can control the pepper blight by inhibiting the zoospore germination and vegetable growth of P. capsici [9]. In this study, we found that CA significantly controls the pepper Phytophthora blight by destroying the cell wall integrity of P. capsici (Figure 1 and Figure 2). Cell-wall integrity plays a vital role in fungal growth and development as well as the ability to survive under stress conditions [31]. We found collapsed and fragmented hyphae in P. capsici mycelia treated with CA (Figure 2A). In addition, MDA concentration and intercellular glycerol measured tests showed that the hyphae of P. capsici treated with CA was more sensitive to oxidative stress and osmotic stress (Figure 2B). The pathogenicity of M. oryzae is dependent on several key genes (e.g., MoSWI6, MoRGS1, and MoPDEH) modulating cell wall integrity [32,33,34]. It is reported that CA can affect the synthesis of 1,3-β-D-glucans of Aspergillus fumigatus and can inhibit chitin synthase 1 in Saccharomyces cerevisiae [35]. RNA-seq analysis showed that the expressions of twelve glucan 1,3-β-glucosidase of P. capsici treated with CA were significantly different from control (Table S3), which suggested that CA affected cell-wall integrity by regulating the expression of glucan 1,3-β-glucosidase.

Ca²⁺ is a second messenger involved in the response to different stress signals (e.g., hypotonic, hypertonic shock, and nutrients) in yeast [36]. Ca²⁺-binding proteins interact with specific transcription factors to modulate the cell-wall’s integrity and pathogenicity of fungi [37,38]. Ca²⁺ concentration is regulated precisely by the endoplasmic reticulum (ER), Golgi, and vacuole [39]. Yvc1 is involved in the regulation of cytoplasmic Ca²⁺ homeostasis [40]. In this study, we transformed PcNCX1 (a sodium/calcium exchanger) to the yeast mutant ΔYvc1. The transformants expressing PcNCX1 showed restored sensitivity to CA (Figure 3A), coinciding with the decrease in intracellular Ca²⁺ level in complemented strain ΔYvc1/PcNCX1 upon CA treatment (Figure 3B,C). In Candida albicans, CA introduced apoptosis through accumulating the intracellular reactive oxygen species and calcium in the cytoplasm [41]. In Brassica rapa, CA can be able to prime plant defense by regulating endogenous Ca²⁺ in order to facilitate cadmium tolerance [42]. In our pervious study, we have found that CA inhibited the growth of P. capsici by stimulating Ca²⁺ efflux [9]. Combining with the data in this study, it can be suggested that CA may regulate PcNCX1 to induce the decrease in intracellular Ca²⁺ levels, further leading to the growth inhibition of P. capsici.

The Yeast complementation experiment suggested that PcNCX1 is a potential target of CA. Thus, we suspect that CA may directly interact with PcNCX1 to modulate its activity. CA has been identified as an agonist of hTRPA1 (human transient receptor potential ankyrin 1). CA directly binds to a set of cysteine residues in the N-terminus of hTRPA1, leading to covalent protein modification. These modifications may activate the channel’s activity by altering subunit–subunit interactions or by modulating the association of hTRPA1 with other cellular proteins [43]. Whether CA can modulate the channel activity of PcNCX1 through similar mechanisms needs further studies. In addition, CA can modulate mammalian TRPs at a transcriptional level [44]. In this study, we found that CA down-regulated the expression of two Ca²⁺ pump genes in P. capsici as well. Therefore, CA may modulate Ca²⁺ flux by regulating Ca²⁺ channels at transcriptional level.

The RNA-seq of P. capsici treated with CA was analyzed, and we found that 956 up-regulated and 2575 down-regulated genes in the CA-treated sample and the functions of these DEGs varied (Figure 4B). However, we could not detect PcNCX1 in the RNA-seq data. Moreover, we investigated the expression of PcNCX1 in the sample treated with CA with qRT-PCR and found that the expression level was significantly down-regulated (Figure S1). In addition, most of the calcium-related genes (25/30) were down-regulated in CA-treated sample (Table 2), suggesting that CA could introduced decreased intracellular Ca²⁺ level in P. capsici. The chemical insensitivity may include non-specific efflux pumps and detoxification, which can be performed by proteins such as the ABC transporter and the cytochrome P450 protein, respectively [45]. CA treatments resulted in the downregulation of most ABC transporter genes (34/45) in P. capsici, suggesting that CA shows strong antifungal activities by possibly suppressing the detoxification system of P. capsici. In our next research, we will study the function of these Ca²⁺ transporter associated genes using the CRISPER-CAS9 method, which further enrich the action mechanism of CA to P. capsici.

5. Conclusions

CA effectively control the pepper Phytophthora blight caused by P. capsici. The loss of cell-wall integrity is closely related to the antifungal effect of CA against P. capsici. Yeast complementation experiments showed that the sodium/calcium exchanger PcNCX1 restored the immediate Ca²⁺ efflux of ΔYvc1. Our study demonstrates that PcNCX1-mediated Ca²⁺ efflux may be one of the important reasons to explain the antifungal effect of CA against P. capsici, which provides crucial insights into the antimicrobial action of CA.