Exogenous Salicylic Acid Optimizes Photosynthesis, Antioxidant Metabolism, and Gene Expression in Perennial Ryegrass Subjected to Salt Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Culture and Growth Conditions
2.2. Treatments
2.3. Sample Collection
2.4. Measurements
2.5. Experimental Design and Statistical Analysis
3. Results
3.1. Turf Quality (TQ) and Chl Content
3.2. MDA Content, EL, and H2O2 Level
3.3. Photosynthetic Rate (Pn) and Stomatal Conductance (gs)
3.4. Antioxidant Enzyme Activity and Gene Expression
3.5. Nitrate Reductase Activity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Alkharabsheh, H.M.; Seleiman, M.F.; Hewedy, O.A.; Battaglia, M.L.; Jalal, R.S.; Alhammad, B.A.; Schillaci, C.; Ali, N.; Al-Doss, A. Field crop responses and management strategies to mitigate soil salinity in modern agriculture: A review. Agronomy 2021, 11, 2299. [Google Scholar] [CrossRef]
- Yadu, S.; Dewangan, T.L.; Chandrakar, V.; Keshavkant, S. Imperative roles of salicylic acid and nitric oxide in improving salinity tolerance in Pisum sativum L. Physiol. Mol. Biol. Plants 2017, 23, 43–58. [Google Scholar] [CrossRef] [PubMed]
- Safdar, H.; Amin, A.; Shafiq, Y.; Ali, A.; Yasin, R.; Shoukat, A.; Hussan, M.U.; Sarwar, M.I. A review: Impact of salinity on plant growth. Nat. Sci 2019, 17, 34–40. [Google Scholar]
- Hu, L.; Li, H.; Pang, H.; Fu, J. Responses of antioxidant gene, protein and enzymes to salinity stress in two genotypes of perennial ryegrass (Lolium perenne) differing in salt tolerance. J. Plant Physiol. 2012, 169, 146–156. [Google Scholar] [CrossRef]
- Marcum, K.; Pessarakli, M. Physiological adaptations of turfgrasses to salinity stress. In Handbook of Turfgrass Management and Physiology; CRC Press: Boca Raton, FL, USA, 2008; pp. 407–418. [Google Scholar]
- Li, F.; Zhan, D.; Xu, L.; Han, L.; Zhang, X. Antioxidant and hormone responses to heat stress in two Kentucky bluegrass cultivars contrasting in heat tolerance. J. Am. Soc. Hortic. Sci. 2014, 139, 587–596. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signaling transduction. Annu. Rev. Plant Biol. 2004, 55, 373. [Google Scholar] [CrossRef]
- Sharma, A.; Gupta, P.; Prabhakar, P.K. Endogenous repair system of oxidative damage of DNA. Curr. Chem. Biol. 2019, 13, 110–119. [Google Scholar] [CrossRef]
- Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot. 2003, 91, 179–194. [Google Scholar] [CrossRef]
- Mansoor, S.; Ali Wani, O.; Lone, J.K.; Manhas, S.; Kour, N.; Alam, P.; Ahmad, A.; Ahmad, P. Reactive Oxygen Species in plants: From source to sink. Antioxidants 2022, 11, 225. [Google Scholar] [CrossRef]
- Mittler, R.; Vanderauwera, S.; Gollery, M.; Van Breusegem, F. Reactive oxygen gene network of plants. Trends Plant Sci. 2004, 9, 490–498. [Google Scholar] [CrossRef]
- Deinlein, U.; Stephan, A.B.; Horie, T.; Luo, W.; Xu, G.; Schroeder, J.I. Plant salt-tolerance mechanisms. Trends Plant Sci. 2014, 19, 371–379. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, F.; Singh, A.; Kamal, A. Salicylic acid–mediated defense mechanisms to abiotic stress tolerance. In Plant Signaling Molecules; Elsevier: Amsterdam, The Netherlands, 2019; pp. 355–369. [Google Scholar]
- Sheteiwy, M.S.; An, J.; Yin, M.; Jia, X.; Guan, Y.; He, F.; Hu, J. Cold plasma treatment and exogenous salicylic acid priming enhances salinity tolerance of Oryza sativa seedlings. Protoplasma 2019, 256, 79–99. [Google Scholar] [CrossRef] [PubMed]
- Bukhat, S.; Manzoor, H.; Athar, H.-u.-R.; Zafar, Z.U.; Azeem, F.; Rasul, S. Salicylic acid induced photosynthetic adaptability of Raphanus sativus to salt stress is associated with antioxidant capacity. J. Plant Growth Regul. 2020, 39, 809–822. [Google Scholar] [CrossRef]
- Idrees, M.; Naeem, M.; Aftab, T.; Khan, M. Salicylic acid mitigates salinity stress by improving antioxidant defence system and enhances vincristine and vinblastine alkaloids production in periwinkle [Catharanthus roseus (L.) G. Don]. Acta Physiol. Plant. 2011, 33, 987–999. [Google Scholar] [CrossRef]
- Syeed, S.; Anjum, N.A.; Nazar, R.; Iqbal, N.; Masood, A.; Khan, N.A. Salicylic acid-mediated changes in photosynthesis, nutrients content and antioxidant metabolism in two mustard (Brassica juncea L.) cultivars differing in salt tolerance. Acta Physiol. Plant. 2011, 33, 877–886. [Google Scholar] [CrossRef]
- Mutlu, S.; Atici, Ö.; Nalbantoglu, B. Effects of salicylic acid and salinity on apoplastic antioxidant enzymes in two wheat cultivars differing in salt tolerance. Biol. Plant. 2009, 53, 334–338. [Google Scholar] [CrossRef]
- Rahimi, E.; Nazari, F.; Javadi, T.; Samadi, S.; da Silva, J.A.T. Potassium-enriched clinoptilolite zeolite mitigates the adverse impacts of salinity stress in perennial ryegrass (Lolium perenne L.) by increasing silicon absorption and improving the K/Na ratio. J. Environ. Manag. 2021, 285, 112142. [Google Scholar] [CrossRef]
- Javaid, M.M.; Mahmood, A.; Alshaya, D.S.; AlKahtani, M.D.; Waheed, H.; Wasaya, A.; Khan, S.A.; Naqve, M.; Haider, I.; Shahid, M.A. Influence of environmental factors on seed germination and seedling characteristics of perennial ryegrass (Lolium perenne L.). Sci. Rep. 2022, 12, 9522. [Google Scholar] [CrossRef]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. In Circular, 2nd ed.; California Agricultural Experiment Station: Davis, CA, USA, 1950; Volume 347. [Google Scholar]
- Qu, R.; Li, D.; Du, R.; Qu, R. Lead uptake by roots of four turfgrass species in hydroponic cultures. HortScience 2003, 38, 623–626. [Google Scholar] [CrossRef]
- Arfan, M.; Athar, H.R.; Ashraf, M. Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress? J. Plant Physiol. 2007, 164, 685–694. [Google Scholar] [CrossRef]
- Waddington, D.; Turner, T.; Duich, J.; Moberg, E. Effect of fertilization on penncross creeping bentgrass 1. Agron. J. 1978, 70, 713–718. [Google Scholar] [CrossRef]
- Knudson, L.L.; Tibbitts, T.W.; Edwards, G.E. Measurement of ozone injury by determination of leaf chlorophyll concentration. Plant Physiol. 1977, 60, 606–608. [Google Scholar] [CrossRef] [PubMed]
- Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef]
- Shi, Q.; Bao, Z.; Zhu, Z.; Ying, Q.; Qian, Q. Effects of different treatments of salicylic acid on heat tolerance, chlorophyll fluorescence, and antioxidant enzyme activity in seedlings of Cucumis sativa L. Plant Growth Regul. 2006, 48, 127–135. [Google Scholar] [CrossRef]
- Patterson, B.D.; MacRae, E.A.; Ferguson, I.B. Estimation of hydrogen peroxide in plant extracts using titanium (IV). Anal. Biochem. 1984, 139, 487–492. [Google Scholar] [CrossRef]
- Aftab, T.; Khan, M.; da Silva, J.A.T.; Idrees, M.; Naeem, M. Role of salicylic acid in promoting salt stress tolerance and enhanced artemisinin production in Artemisia annua L. J. Plant Growth Regul. 2011, 30, 425–435. [Google Scholar] [CrossRef]
- Stevens, J.; Senaratna, T.; Sivasithamparam, K. Salicylic acid induces salinity tolerance in tomato (Lycopersicon esculentum cv. Roma): Associated changes in gas exchange, water relations and membrane stabilisation. Plant Growth Regul. 2006, 49, 77–83. [Google Scholar]
- Chance, B.; Maehly, A. Assay of catalases and peroxidases. Methods Biochem. Anal. 1955, 1, 357–424. [Google Scholar]
- Hammerschmidt, R.; Nuckles, E.; Kuć, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 1982, 20, 73–82. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Downs, M.R.; Nadelhoffer, K.J.; Melillo, J.M.; Aber, J.D. Foliar and fine root nitrate reductase activity in seedlings of four forest tree species in relation to nitrogen availability. Trees 1993, 7, 233–236. [Google Scholar] [CrossRef]
- Luo, H.; Li, H.; Zhang, X.; Fu, J. Antioxidant responses and gene expression in perennial ryegrass (Lolium perenne L.) under cadmium stress. Ecotoxicology 2011, 20, 770–778. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bian, S.; Jiang, Y. Reactive oxygen species, antioxidant enzyme activities and gene expression patterns in leaves and roots of Kentucky bluegrass in response to drought stress and recovery. Scientia Horticulturae. 2009, 120, 264–270. [Google Scholar] [CrossRef]
- Foito, A.; Byrne, S.L.; Shepherd, T.; Stewart, D.; Barth, S. Transcriptional and metabolic profiles of Lolium perenne L. genotypes in response to a PEG-induced water stress. Plant Biotechnology Journal. 2009, 7, 719–732. [Google Scholar] [CrossRef]
- Lee, J.M.; Roche, J.R.; Donaghy, D.J.; Thrush, A.; Sathish, P. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.). BMC Mol. Biol. 2010, 11, 1–14. [Google Scholar] [CrossRef]
- Alsahli, A.; Mohamed, A.-K.; Alaraidh, I.; Al-Ghamdi, A.; Al-Watban, A.; El-Zaidy, M.; Alzahrani, S.M. Salicylic acid alleviates salinity stress through the modulation of biochemical attributes and some key antioxidants in wheat seedlings. Pak. J. Bot. 2019, 51, 1551–1559. [Google Scholar] [CrossRef]
- Hernández, J.A.; Almansa, M.S. Short-term effects of salt stress on antioxidant systems and leaf water relations of pea leaves. Physiol. Plant. 2002, 115, 251–257. [Google Scholar] [CrossRef]
- Younis, M.E.; Rizwan, M.; Tourky, S. Assessment of early physiological and biochemical responses in chia (Salvia hispanica L.) sprouts under salt stress. Acta Physiol. Plant. 2021, 43, 1–10. [Google Scholar] [CrossRef]
- Rao, M.V.; Paliyath, G.; Ormrod, D.P.; Murr, D.P.; Watkins, C.B. Influence of salicylic acid on H2O2 production, oxidative stress, and H2O2-metabolizing enzymes (salicylic acid-mediated oxidative damage requires H2O2). Plant Physiol. 1997, 115, 137–149. [Google Scholar] [CrossRef]
- Tari, I. Acclimation of tomato plants to salinity stress after a salicylic acid pre-treatment. Acta Biol. Szeged. 2002, 46, 55–56. [Google Scholar]
- Yildirim, E.; Turan, M.; Guvenc, I. Effect of foliar salicylic acid applications on growth, chlorophyll, and mineral content of cucumber grown under salt stress. J. Plant Nutr. 2008, 31, 593–612. [Google Scholar] [CrossRef]
- Gurmani, A.R.; Khan, S.U.; Ali, A.; Rubab, T.; Schwinghamer, T.; Jilani, G.; Farid, A.; Zhang, J. Salicylic acid and kinetin mediated stimulation of salt tolerance in cucumber (Cucumis sativus L.) genotypes varying in salinity tolerance. Hortic. Environ. Biotechnol. 2018, 59, 461–471. [Google Scholar] [CrossRef]
- Mahmoud, L.M.; Vincent, C.I.; Grosser, J.W.; Dutt, M. The response of salt-stressed Valencia sweet orange (Citrus sinensis) to salicylic acid and methyl jasmonate treatments. Plant Physiol. Rep. 2021, 26, 137–151. [Google Scholar] [CrossRef]
- Hamani, A.K.M.; Wang, G.; Soothar, M.K.; Shen, X.; Gao, Y.; Qiu, R.; Mehmood, F. Responses of leaf gas exchange attributes, photosynthetic pigments and antioxidant enzymes in NaCl-stressed cotton (Gossypium hirsutum L.) seedlings to exogenous glycine betaine and salicylic acid. BMC Plant Biol. 2020, 20, 434. [Google Scholar] [CrossRef]
- Gama, P.B.S.; Tanaka, K.; Eneji, A.E.; Eltayeb, A.E.; Siddig, K.E. Salt-induced stress effects on biomass, photosynthetic rate, and reactive oxygen species-scavenging enzyme accumulation in common bean. J. Plant Nutr. 2009, 32, 837–854. [Google Scholar] [CrossRef]
- Khan, M.I.R.; Asgher, M.; Khan, N.A. Alleviation of salt-induced photosynthesis and growth inhibition by salicylic acid involves glycinebetaine and ethylene in mungbean (Vigna radiata L.). Plant Physiol. Biochem. 2014, 80, 67–74. [Google Scholar] [CrossRef]
- Sawada, H.; Shim, I.-S.; Usui, K.; Kobayashi, K.; Fujihara, S. Adaptive mechanism of Echinochloa crus-galli Beauv. var. formosensis Ohwi under salt stress: Effect of salicylic acid on salt sensitivity. Plant Sci. 2008, 174, 583–589. [Google Scholar] [CrossRef]
- Shahid, M.A.; Sarkhosh, A.; Khan, N.; Balal, R.M.; Ali, S.; Rossi, L.; Gómez, C.; Mattson, N.; Nasim, W.; Garcia-Sanchez, F. Insights into the physiological and biochemical impacts of salt stress on plant growth and development. Agronomy 2020, 10, 938. [Google Scholar] [CrossRef]
- El-Khallal, S.M.; Hathout, T.A.; Ahsour, A.; Kerrit, A.-A.A. Brassinolide and salicylic acid induced antioxidant enzymes, hormonal balance and protein profile of maize plants grown under salt stress. Res. J. Agric. Biol. Sci. 2009, 5, 391–402. [Google Scholar]
- Liu, Y.; Xi, M.; Li, Y.; Cheng, Z.; Wang, S.; Kong, F. Improvement in salt tolerance of Iris pseudacorus L. in constructed wetland by exogenous application of salicylic acid and calcium chloride. J. Environ. Manag. 2021, 300, 113703. [Google Scholar] [CrossRef]
- Nazar, R.; Iqbal, N.; Syeed, S.; Khan, N.A. Salicylic acid alleviates decreases in photosynthesis under salt stress by enhancing nitrogen and sulfur assimilation and antioxidant metabolism differentially in two mungbean cultivars. J. Plant Physiol. 2011, 168, 807–815. [Google Scholar] [CrossRef]
Gene | Primers Sequences (5′–3′) | Size (bp) | Reference |
---|---|---|---|
Cyt Cu/ZnSOD | F GACACMACAAATGGHTGCAT | 221 | Bian and Jiang (2009) [37] |
R TCATCBGGATCGGCATGGACAAC | |||
Chl Cu/ZnSOD | F ATGGGTGCATATCDAYAG | 271 | Bian and Jiang (2009) [37] |
R GCCAGTCTTCCACCAGCAT | |||
MnSOD | F CAGRGBGCCATCAAGTTCAACG | 338 | Bian and Jiang (2009) [37] |
R TACTGCAGGTAGTACGCATG | |||
FeSOD | F TGCACTTGGTGATATTCCACTC | 297 | Bian and Jiang (2009) [37] |
R CGAATCTCAGCATCAGGTATCA | |||
POD | F TTCACATTCTGCTCTGCCTG | 202 | Bian and Jiang (2009) [37] |
R CCGTGTCTTGTTTCCTCCTG | |||
CAT | F CCTSTCATTGTGMGTTTCTC | 292 | Bian and Jiang (2009) [37] |
R GTTAACTCCRAAVCCATCCATATG | |||
pAPX | F CCTGAAAGGTCTGGGTTTGA | 173 | Foito et al. (2009) [38] |
R TCCTTGGCATAAAGGTCCAC | |||
eEF1A(s) | F CCGTTTTGTCGAGTTTGGT | 113 | Lee et al. (2010) [39] |
R AGCAACTGTAACCGAACATAGC |
NaCl (mM) | SA (mM) | Days of NaCl Treatment | ||||
---|---|---|---|---|---|---|
0 | 6 | 12 | 18 | 24 | ||
Electrolyte leakage (%) | ||||||
0 | 0 | 12 a x | 13 a | 22 ba | 18 a | 15 a |
0.25 | 12 a | 13 a | 17 b | 22 a | 14 a | |
0.5 | 11 a | 12 a | 16 b | 20 a | 12 a | |
1 | 15 a | 13 a | 25 a | 19 a | 17 a | |
250 | 0 | 12 a | 27 a | 47 a | 57 a | 70 a |
0.25 | 12 a | 14 b | 31 b | 39 b | 45 b | |
0.5 | 11 a | 16 b | 35 b | 43 b | 58 ab | |
1 | 14 a | 16 b | 43 b | 60 a | 70 a | |
0 mM NaCl | 13 x | 13 y | 20 y | 20 y | 14 y | |
250 mM NaCl | 12 x | 18 x | 39 x | 49 x | 61 x | |
MDA content (nmol g−1) | ||||||
0 | 0 | 37.0 a | 43.3 a | 47.2 a | 46.7 a | 53.3 a |
0.25 | 38.5 a | 43.2 a | 44.0 a | 39.1 a | 43.9 a | |
0.5 | 35.2 a | 45.0 a | 44.6 a | 45.5 a | 50.7 a | |
1 | 38.3 a | 46.8 a | 44.7 a | 43.6 a | 47.3 a | |
250 | 0 | 36.8 a | 49.8 a | 63.6 a | 72.8 a | 105.4 a |
0.25 | 38.1 a | 44.3 a | 46.7 b | 57.0 b | 62.4 b | |
0.5 | 35.5 a | 46.0 a | 46.0 b | 55.9 b | 70.1 ab | |
1 | 37.9 a | 55.7 a | 55.0 ab | 67.5 ab | 100.1 a | |
0 mM NaCl | 37.3 x | 44.6 x | 45.1 y | 43.7 y | 48.8 y | |
250 mM NaCl | 37.0 x | 49.0 x | 52.8 x | 63.3 x | 84.8 x | |
H2O2 level (μmol g−1) | ||||||
0 | 0 | 1.0 ab | 0.9 a | 1.3 a | 1.0 a | 1.3 a |
0.25 | 0.8 b | 0.8 a | 1.1 ab | 0.7 a | 0.7 a | |
0.5 | 0.8 b | 0.8 a | 1.1 b | 0.8 a | 1.1 a | |
1 | 1.2 a | 1.0 a | 0.8 c | 1.0 a | 1.4 a | |
250 | 0 | 1.1 a | 1.5 ab | 2.1 a | 3.2 a | 3.9 ab |
0.25 | 0.7 a | 0.9 b | 1.6 a | 2.3 a | 2.0 b | |
0.5 | 0.9 a | 1.1 ab | 1.9 a | 2.6 a | 2.3 ab | |
1 | 1.1 a | 1.7 a | 2.1 a | 3.7 a | 4.1 a | |
0 mM NaCl | 1.0 x | 0.9 y | 1.1 y | 0.9 y | 1.1 y | |
250 mM NaCl | 0.9 x | 1.3 x | 1.9 x | 2.9 x | 3.1 x |
NaCl (mM) | SA (mM) | Days of NaCl Treatment | ||||
---|---|---|---|---|---|---|
0 | 6 | 12 | 18 | 24 | ||
Pn (μmol CO2 m−2 s−1) | ||||||
0 | 0 | 11.8 a x | 14 a | 12.3 a | 8.5 b | 11.9 a |
0.25 | 11.6 a | 13.8 a | 13.2 a | 11.1 a | 13.7 a | |
0.5 | 11.2 a | 13.1 a | 10.7 a | 11.9 a | 11.2 a | |
1 | 10.0 b | 8.5 b | 6.8 b | 8.1 b | 7.1 b | |
250 | 0 | 11.2 a | 4.4 ab | 6.5 a | 2.7 b | 2.7 b |
0.25 | 11.6 a | 4.8 ab | 7.9 a | 6.1 a | 5.5 a | |
0.5 | 10.7 a | 5.7 a | 6.1 a | 6.0 a | 5.7 a | |
1 | 8.3 b | 3.2 b | 5.3 a | 2.6 b | 3.4 b | |
0 mM NaCl | 11.1 x | 12.3 x | 10.8 x | 9.9 x | 11.0 x | |
250 mM NaCl | 10.4 x | 4.5 y | 6.4 y | 4.4 y | 5.5 y | |
gs (mol H2O m−2 s−1) | ||||||
0 | 0 | 0.26 b | 0.27 b | 0.27 a | 0.27 b | 0.28 b |
0.25 | 0.31 a | 0.32 a | 0.28 a | 0.32 a | 0.33 a | |
0.5 | 0.27 b | 0.30 ab | 0.26 a | 0.28 ab | 0.31 ab | |
1 | 0.22 c | 0.22 c | 0.18 b | 0.20 c | 0.18 c | |
250 | 0 | 0.25 b | 0.16 bc | 0.14 b | 0.09 b | 0.06 c |
0.25 | 0.30 a | 0.21 a | 0.16 a | 0.12 a | 0.10 a | |
0.5 | 0.27 ab | 0.18 ab | 0.15 a | 0.11 a | 0.09 b | |
1 | 0.24 b | 0.14 c | 0.13 b | 0.08 b | 0.06 c | |
0 mM NaCl | 0.26 x | 0.28 x | 0.25 x | 0.27 x | 0.28 x | |
250 mM NaCl | 0.27 x | 0.17 y | 0.14 y | 0.10 y | 0.08 y |
NaCl (mM) | SA (mM) | Days of NaCl Treatment | ||||
---|---|---|---|---|---|---|
0 | 6 | 12 | 18 | 24 | ||
SOD (units g−1) | ||||||
0 | 0 | 876 a x | 888 b | 978 a | 1023 a | 870 b |
0.25 | 951 a | 1026 a | 995 a | 1068 a | 1091 a | |
0.5 | 869 a | 1037 a | 1119 a | 1032 a | 995 ab | |
1 | 877 a | 1025 a | 1010 a | 987 a | 1093 a | |
250 | 0 | 880 a | 1066 a | 889 a | 925 a | 582 b |
0.25 | 916 a | 1244 a | 1068 a | 1151 a | 1115 a | |
0.5 | 885 a | 1197 a | 999 a | 1136 a | 1134 a | |
1 | 905 a | 1112 a | 1082 a | 1096 a | 640 b | |
0 mM NaCl | 893 x | 994 y | 1025 x | 1028 x | 1012 x | |
250 mM NaCl | 897 x | 1155 x | 1010 x | 1076 x | 958 x | |
CAT (units min−1 g−1) | ||||||
0 | 0 | 68.5 b | 74.0 ab | 47.7 b | 61.8 c | 65.6 c |
0.25 | 82.5 ab | 75.0 ab | 66.8 a | 81.2 a | 84.1 a | |
0.5 | 87.0 a | 78.6 a | 67.4 a | 74.2 ab | 79.5 ab | |
1 | 81.3 ab | 72.6 b | 59.1 ab | 64.3 bc | 76.1 b | |
250 | 0 | 82.2 a | 70.4 a | 58.1 ab | 50.3 ab | 62.6 a |
0.25 | 79.8 a | 78.0 a | 62.9 a | 63.5 a | 40.3 b | |
0.5 | 81.4 a | 72.3 a | 56.9 ab | 62.0 ab | 40.8 b | |
1 | 80.3 a | 67.0 a | 49.8 b | 43.3 b | 38.7 b | |
0 mM NaCl | 79.8 x | 75.1 x | 60.2 x | 70.4 x | 76.3 x | |
250 mM NaCl | 80.9 x | 71.9 x | 57.0 x | 54.8 y | 51.6 y |
NaCl (mM) | SA (mM) | Days of NaCl treatment | ||||
---|---|---|---|---|---|---|
0 | 6 | 12 | 18 | 24 | ||
APX (units min−1 g−1) | ||||||
0 | 0 | 4.4 b x | 4.3 a | 5.3 a | 4.9 bc | 4.9 a |
0.25 | 5.0 ab | 5.2 a | 5.7 a | 6.0 ab | 6.3 a | |
0.5 | 5.5 a | 5.2 a | 5.5 a | 6.6 a | 5.3 a | |
1 | 4.9 ab | 4.5 a | 5.1 a | 4.3 c | 5.5 a | |
250 | 0 | 5.4 a | 5.3 a | 5.5 ab | 4.4 bc | 3.8 bc |
0.25 | 5.4 a | 5.5 a | 6.9 a | 6.8 a | 7.0 a | |
0.5 | 5.2 ab | 5.3 a | 6.2 a | 5.7 ab | 6.4 ab | |
1 | 4.3 b | 5.1 a | 4.7 b | 3.0 c | 2.6 c | |
0 mM NaCl | 5.0 x | 4.8 y | 5.4 x | 5.4 x | 5.5 x | |
250 mM NaCl | 5.1 x | 5.3 x | 5.8 x | 5.0 x | 5.5 x | |
POD (units min−1 g−1) | ||||||
0 | 0 | 1.3 a | 1.5 a | 1.4 a | 1.5 a | 1.5 a |
0.25 | 1.4 a | 1.6 a | 1.5 a | 1.6 a | 1.6 a | |
0.5 | 1.4 a | 1.5 a | 1.4 a | 1.7 a | 1.6 a | |
1 | 1.4 a | 1.4 a | 1.3 a | 1.5 a | 1.4 a | |
250 | 0 | 1.4 a | 1.4 a | 1.3 b | 1.2 c | 1.2 a |
0.25 | 1.5 a | 1.4 a | 1.6 a | 1.6 a | 1.4 a | |
0.5 | 1.4 a | 1.5 a | 1.5 ab | 1.5 ab | 1.3 a | |
1 | 1.3 a | 1.5 a | 1.3 b | 1.2 bc | 1.1 a | |
0 mM NaCl | 1.4 x | 1.5 x | 1.4 x | 1.6 x | 1.5 x | |
250 mM NaCl | 1.4 x | 1.5 x | 1.4 x | 1.4 y | 1.2 y |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Dong, S.; Teng, K.; Chang, Z.; Zhang, X. Exogenous Salicylic Acid Optimizes Photosynthesis, Antioxidant Metabolism, and Gene Expression in Perennial Ryegrass Subjected to Salt Stress. Agronomy 2022, 12, 1920. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy12081920
Wang Z, Dong S, Teng K, Chang Z, Zhang X. Exogenous Salicylic Acid Optimizes Photosynthesis, Antioxidant Metabolism, and Gene Expression in Perennial Ryegrass Subjected to Salt Stress. Agronomy. 2022; 12(8):1920. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy12081920
Chicago/Turabian StyleWang, Ziyue, Shuang Dong, Ke Teng, Zhihui Chang, and Xunzhong Zhang. 2022. "Exogenous Salicylic Acid Optimizes Photosynthesis, Antioxidant Metabolism, and Gene Expression in Perennial Ryegrass Subjected to Salt Stress" Agronomy 12, no. 8: 1920. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy12081920