Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype
Abstract
:1. Introduction
2. Materials and Methods
2.1. Wheat Materials
2.2. Genotyping the GPC-B1 Locus and NAM-B1 Allele
2.3. Development and Evaluation of a KASP Marker for Identifying the NAM-B1 Allele
3. Results and Discussion
3.1. Selecting GPC-B1-Carrying Cultivars and Analysis of NAM-B1 Alleles
3.2. Development of a NAM-B1-Specific KASP Marker for the Efficient Breeding of Wheat with High-Protein-Content
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sharma, A.; Garg, S.; Sheikh, I.; Vyas, P.; Dhaliwal, H.S. Effect of wheat grain protein composition on end-use quality. J. Food Sci. Technol. 2020, 57, 2771–2785. [Google Scholar] [CrossRef]
- Uauy, C.; Distelfeld, A.; Fahima, T.; Blechl, A.; Dubcovsky, J. A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 2006, 314, 1298–1301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joppa, L.R.; Du, C.; Hart, G.E.; Hareland, G.A. Mapping gene(s) for grain protein in tetraploid wheat (Triticum turgidum L.) using a population of recombinant inbred chromosome lines. Crop Sci. 1997, 37, 1586–1589. [Google Scholar] [CrossRef]
- Olmos, S.; Distelfeld, A.; Chicaiza, O.; Schlatter, A.R.; Fahima, T.; Echenique, V.; Dubcovsky, J. Precise mapping of a locus affecting grain protein content in durum wheat. Theor. Appl. Genet. 2003, 107, 1243–1251. [Google Scholar] [CrossRef] [Green Version]
- Distelfeld, A.; Uauy, C.; Fahima, T.; Dubcovsky, J. Physical map of the wheat high-grain protein content gene Gpc-B1 and development of a high-throughput molecular marker. New Phytol. 2006, 169, 753–763. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.Y.; Song, G.Q.; Zhang, S.J.; Li, Y.L.; Gao, J.; Shahidul, I.; Ma, W.; Li, G.Y.; Ji, W.Q. The allelic distribution and variation analysis of the NAM-B1 gene in Chinese wheat cultivars. J. Integr. Agric. 2017, 16, 1294–1303. [Google Scholar] [CrossRef] [Green Version]
- Brevis, J.C.; Dubcovsky, J. Effects of the chromosome region including the Gpc-B1 locus on wheat grain and protein yield. Crop Sci. 2010, 50, 93–104. [Google Scholar] [CrossRef] [Green Version]
- Waters, B.M.; Uauy, C.; Dubcovsky, J.; Grusak, M.A. Wheat (Triticum aestivum) NAM proteins regulate the translocation of iron, zinc, and nitrogen compounds from vegetative tissues to grains. J. Exp. Bot. 2009, 60, 4263–4274. [Google Scholar] [CrossRef] [Green Version]
- Hagenblad, J.; Asplund, L.; Balfourier, F.; Ravel, C.; Leino, M.W. Strong presence of the high grain protein content allele of NAM-B1 in Fennoscandan wheat. Theor. Appl. Genet. 2012, 125, 1677–1686. [Google Scholar] [CrossRef]
- Aydin, N.; Sermet, C.; Mut, Z.; Bayramoglu, H.O.; Özcan, H. Path analyses of yield and some agronomic and quality traits of bread wheat (Triticum aestivum L.) in different environments. Afr. J. Biotechnol. 2010, 9, 5131–5134. [Google Scholar]
- Bogard, M.; Jourdan, M.; Allard, V.; Martre, P.; Perretant, M.R.; Ravel, C.; Heumez, E.; Orford, S.; Snape, J.; Griffiths, S.; et al. Anthesis date mainly explained correlations between post-anthesis leaf senescence, grain yield, and grain protein concentration in a winter wheat population segregating for flowering time QTLs. J. Exp. Bot. 2011, 62, 3621–3636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bordes, J.; Branlard, G.; Oury, F.X.; Charmet, G.; Balfourier, F. Agronomic characteristics, grain quality and flour rheology of 372 bread wheats in a worldwide core collection. J. Cereal Sci. 2008, 48, 569–579. [Google Scholar] [CrossRef]
- Carter, A.H.; Santra, D.K.; Kidwell, K.K. Assessment of the effects of the Gpc-B1 allele on senescence rate, grain protein concentration and mineral content in hard red spring wheat (Triticum aestivum L.) from the Pacific Northwest Region of the USA. Plant Breed. 2012, 131, 62–68. [Google Scholar] [CrossRef]
- Kuhn, J.C.; Stubbs, T.L.; Carter, A.H. Effect of the Gpc-B1 allele in hard red winter wheat in the US Pacific Northwest. Crop Sci. 2016, 56, 1009–1017. [Google Scholar] [CrossRef]
- Kumar, J.; Jaiswal, V.; Kumar, A.; Kumar, N.; Mir, R.R.; Kumar, S.; Dhariwal, R.; Tyagi, S.; Khandelwal, M.; Prabhu, K.V.; et al. Introgression of a major gene for high grain protein content in some Indian bread wheat cultivars. Field Crops Res. 2011, 123, 226–233. [Google Scholar] [CrossRef]
- Maphosa, L.; Collins, N.C.; Taylor, J.; Mather, D.E. Post-anthesis heat and a Gpc-B1 introgression have similar but non-additive effects in bread wheat. Funct. Plant Biol. 2014, 41, 1002–1008. [Google Scholar] [CrossRef]
- Tabbita, F.; Pearce, S.; Barneix, A.J. Breeding for increased grain protein and micronutrient content in wheat: Ten years of the GPC-B1 gene. J. Cereal Sci. 2017, 73, 183–191. [Google Scholar] [CrossRef]
- Vishwakarma, M.K.; Mishra, V.K.; Gupta, P.K.; Yadav, P.S.; Kumar, H.; Joshi, A.K. Introgression of the high grain protein gene Gpc-B1 in an elite wheat variety of Indo-Gangetic Plains through marker assisted backcross breeding. Curr. Plant Biol. 2014, 1, 60–67. [Google Scholar] [CrossRef] [Green Version]
- Gupta, P.K.; Balyan, H.S.; Chhuneja, P.; Jaiswal, J.P.; Tamhankar, S.; Mishra, V.K.; Bains, N.S.; Chand, R.; Joshi, A.K.; Kaur, S.; et al. Pyramiding of genes for grain protein content, grain quality, and rust resistance in eleven Indian bread wheat cultivars: A multi-institutional effort. Mol. Breed. 2022, 42, 21. [Google Scholar] [CrossRef]
- Yang, R.; Juhasz, A.; Zhang, Y.; Chen, X.; Zhang, Y.; She, M.; Zhang, J.; Maddern, R.; Edwards, I.; Diepeveen, D.; et al. Molecular characterisation of the NAM-1 genes in bread wheat in Australia. Crop Pasture Sci. 2018, 69, 1173–1181. [Google Scholar] [CrossRef]
- Singh, C.; Srivastava, P.; Sharma, A.; Chhuneja, P.; Sohu, V.S.; Bains, N.S. Effect of Gpc-B1 gene on grain protein content and productivity traits in a set of high yielding wheat lines. Indian J. Genet. Plant Breed. 2018, 78, 211–216. [Google Scholar] [CrossRef]
- Velu, G.; Singh, R.P.; Cardenas, M.E.; Wu, B.; Guzman, C.; Ortiz-Monasterio, I. Characterization of grain protein content gene (GPC-B1) introgression lines and its potential use in breeding for enhanced grain zinc and iron concentration in spring wheat. Acta Physiol. Plant. 2017, 39, 212. [Google Scholar] [CrossRef]
- Vishwakarma, M.K.; Arun, B.; Mishra, V.K.; Yadav, P.S.; Kumar, H.; Joshi, A.K. Marker-assisted improvement of grain protein content and grain weight in Indian bread wheat. Euphytica 2016, 208, 313–321. [Google Scholar] [CrossRef]
- Asplund, L.; Hagenblad, J.; Leino, M.W. Re-evaluating the history of the wheat domestication gene NAM-B1 using historical plant material. J. Archaeol. Sci. 2010, 37, 2303–2307. [Google Scholar] [CrossRef]
- Lundström, M.; Leino, M.W.; Hagenblad, J. Evolutionary history of the NAM-B1 gene in wild and domesticated tetraploid wheat. BMC Genet. 2017, 18, 118. [Google Scholar] [CrossRef] [PubMed]
- Vagndorf, N.; Kristensen, P.S.; Andersen, J.R.; Jahoor, A.; Orabi, J. Marker-assisted breeding in wheat. Next Gener. Plant Breed. 2018, 1, 3–22. [Google Scholar]
- Cha, J.K.; O’Connor, K.; Alahmad, S.; Lee, J.H.; Dinglasan, E.; Park, H.; Lee, S.M.; Hirsz, D.; Kwon, S.W.; Kwon, Y.; et al. Speed vernalization to accelerate generation advance in winter cereal crops. Mol. Plant 2022, 15, 1300–1309. [Google Scholar] [CrossRef]
Locus | Marker Type | Primer Name | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature | Reference |
---|---|---|---|---|---|---|
GPC-B1 | SSR | Xucw108 | AGCCAGGGATAGAGGAGGAA | 217 | 58 °C | Uauy et al. [2] |
AGCTGTGAGCTGGTGTCCTT | ||||||
Xucw109 | ATCTGCAATTCCAGGCACAC | 212 | 58 °C | |||
CCAGCAGATCAAGGAGAATTG | ||||||
NAM-B1 | Sequencing | NAM-B1-specific pair 2 | GGAAGAATATAAAAATACTACTTGTGC | 555 | 56 °C | |
CTCCGTTCCTTCCTTCACAC | ||||||
NAM-B1 | KASP | FAM | GAGCCGGAAGATGAGTCGGAG | - | 65→55 °C (−1 °C/cycle), 57 °C | This study |
HEX | GAGCCGGAAGATGAGTCGGAA | |||||
Common | GGGAAGAAGATCTGATGAGGTCCAT |
GPC-B1 | Korean | Others | Total | |||
---|---|---|---|---|---|---|
Number of Cultivars | Frequency (%) | Number of Cultivars | Frequency (%) | Number of Cultivars | Frequency (%) | |
Presence | 9 | 14.3 | 32 | 31.1 | 41 | 24.7 |
Absence | 54 | 85.7 | 71 | 68.9 | 125 | 75.3 |
NAM-B1 | SNP 1 | Number | Cultivars |
---|---|---|---|
Wild-type | - | 3 | Benhur, BETHLEHEM, PI 350731 |
1-bp insertion | T | 38 | Chinese Spring, Ariheukchal, etc. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cha, J.-K.; Park, H.; Kwon, Y.; Lee, S.-M.; Oh, K.-W.; Lee, J.-H. Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype. Agronomy 2023, 13, 1977. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy13081977
Cha J-K, Park H, Kwon Y, Lee S-M, Oh K-W, Lee J-H. Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype. Agronomy. 2023; 13(8):1977. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy13081977
Chicago/Turabian StyleCha, Jin-Kyung, Hyeonjin Park, Youngho Kwon, So-Myeong Lee, Ki-Won Oh, and Jong-Hee Lee. 2023. "Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype" Agronomy 13, no. 8: 1977. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy13081977