Next Article in Journal
Predictions and Estimations in Agricultural Production under a Changing Climate
Previous Article in Journal
Functional Analysis of MoMyb13, a Myb Transcription Factor Involved in Regulating Growth, Conidiation, Hydrophobicity, and Pathogenicity of Magnaporthe oryzae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 2
10.3390/agronomy14020252
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Poly-Glutamic Acid Promotes the Growth and the Accumulation of Main Medicinal Components in Salvia miltiorrhiza

by
Changjuan Shan
1,2,*,
Xiaoqing Zhang
1,
Yi Luo
1 and
Dongfeng Yang
3,*
1
School of Life Science, Henan Institute of Science and Technology, Xinxiang 453003, China
2
Xinxiang Pasture Engineering Technology Research Center, Xinxiang 453003, China
3
College of Life Sciences and Medicine, Zhejiang Sci-Tech University, Hangzhou 310018, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(2), 252; https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy14020252
Submission received: 3 November 2023 / Revised: 20 December 2023 / Accepted: 4 January 2024 / Published: 24 January 2024
Browse Figures
Versions Notes

Abstract

:
Salvia miltiorrhiza Bunge is a traditional medicinal plant in China and poly-glutamic acid (PGA) is a valuable biopolymer. However, it is unclear whether PGA promotes growth and the accumulation of main medicinal components in S. miltiorrhiza. To elucidate this scientific question, the influences of PGA on the growth, physiological characteristics, and accumulation of main medicinal components in S. miltiorrhiza were explored through a pot experiment. The results revealed that PGA significantly promoted basal diameter, plant height, shoot and root biomass, as well as root volume, compared with control. PGA also increased SPAD value, net photosynthetic rate, actual and maximum photochemical efficiency of photosynthetic system II, photochemical quenching, and electronic transfer rate. Meanwhile, PGA increased transpiration rate, stomatal conductance, water use efficiency, leaf relative water content, and the contents of soluble protein, soluble sugar, and proline. Furthermore, PGA increased the activities of antioxidant enzymes and the contents of antioxidants. The above findings imply that PGA facilitated S. miltiorrhiza growth by enhancing photosynthetic performance, water metabolism, and antioxidant capacity. Additionally, PGA significantly improved the yield of rosmarinic acid, salvianolic acid B, dihydrotanshinone, cryptotanshinone, tanshinone I, and tanshinone ⅡA in roots by up-regulating the transcript levels of genes responsible for their biosynthesis. Our findings indicated that PGA promoted S. miltiorrhiza growth and the accumulation of main medicinal components in roots.

1. Introduction

Salvia is a genus of plants in the Labiatae family. This genus comprises several medicinal plants, such as Salvia abrotanoides (Karl.), S. yangii, and S. miltiorrhiza [1,2]. The roots of these Salvia species include water-soluble medicinal ingredients and fat-soluble medicinal ingredients. The main water-soluble medicinal ingredients include rosmarinic acid (RosA) and salvianolic acid B (SalB) [2]. Fat-soluble medicinal ingredients mainly include dihydrotanshinone (DHT), tanshinone I (Tan I), cryptotanshinone (CTS), and tanshinone ⅡA (Tan ⅡA) [3,4,5]. The above medicinal components can dissipate blood stasis by activating blood circulation, prevent atherosclerosis, lower blood pressure and fat, and have anti-inflammation and antitumor effects [6,7]. In China, S. miltiorrhiza is one of the major medicinal materials commonly used in clinical practice, with a long history of more than 2000 years. Its dry roots also contained above water-soluble and fat-soluble main medicinal ingredients, including RosA, SalB, DHT, Tan I, CTS and Tan ⅡA [8]. In S. miltiorrhiza, the water-soluble ingredients have anticoagulation, cytoprotection, antiviral, antioxidation and other pharmacological effects [9]. The fat-soluble ingredients have antibacterial, anti-inflammatory, antitumor and other pharmacological effects [10,11]. Thus, the roots have been extensively used to treat inflammation, cardiovascular diseases, chronic renal failure, angina pectoris and dysmenorrhea in many regions in the world, mainly including Asia, Europe and the United States [2]. Due to the above reasons, S. miltiorrhiza is a very useful medicinal plant not only in China but all over the world. Therefore, S. miltiorrhiza has become a kind of bulk medicinal material. Recently, the demand for S. miltiorrhiza has increased significantly in the world. Thus, it is necessary to improve the growth and the accumulation of the main medicinal components in S. miltiorrhiza roots to meet the market demand. More and more research has demonstrated that exogenous substances improved the growth and the yield of main medicinal components in medical plants. For S. miltiorrhiza, Zhang et al. [12] found that nano-selenium improved the growth and the contents of tanshinones (Tans) and salvianolic acids (SAs). Han et al. [13] displayed that cerous nitrate promoted the growth and Tans production. Sun et al. [14,15] found that karrikins improved SalB content. Shi et al. [16] reported that abscisic acid (ABA) increased the contents of phenolic acids and Tans. For other medical plants, Islam et al. [17] showed that putrescine enhanced ginsenosides content in the sprouts of Panax ginseng. Chang et al. [18] reported that melatonin enhanced secondary metabolite contents and the yield of Prunella vulgaris. The above previous studies indicate that we could regulate the growth and the yield of medicinal components in medical plants through the application of exogenous substances. Thus, it is worth exploring the influences of exogenous substances on the growth and the accumulation of main medicinal components in S. miltiorrhiza roots.
It has been documented that the application of biopolymers in plant or plant organ cultures could improve plant growth and the accumulation of medicinal components [19,20,21,22,23,24,25,26,27,28,29]. Chang et al. [24] showed that biopolymer polylactic acid (PLA) stimulated the growth of soybeans. Patil et al. [27] reported that different biopolymers, agar, cellulose, alginate, psyllium gaur gum, and bacterial exopolysaccharide (EPS), all improved the seedling growth of Gossypium herbaceum L. Zagzog et al. [29] also demonstrated that chitosan improved the vegetative growth of mangos. Wierzchowski et al. [23] found that PLA could promote biomass proliferation of Rindera graeca hairy root. Additionally, previous studies have also proved that biopolymers could also improve the accumulation of medicinal components in the culture of plant hairy root [19,20,21,22,23,25,26]. Kawka et al. [21] showed that polyurethane foam (PUF) enhanced rinderol production in R. graeca hairy root. Wierzchowski et al. [23] found that poly(glycerol sebacate) (PGS) could cause deoxyshikonin production in R. graeca hairy root. Jose et al. [20] showed that polypropylene (PP) caused the production of plumbagin in Plumbago rosea L. hairy root. The above studies clearly indicate that biopolymers play vital roles in promoting plant growth and the accumulation of medicinal components in medicinal plants, which shows the wide application of biopolymers in plant science.
Poly-glutamic acid (PGA) is a valuable biopolymer. Being non-toxic, edible, and biodegradable, PGA is widely applied in food, biomedicine, and agriculture [30]. In agriculture, PGA has been extensively used to act as slow-release fertilizer, increase the relative abundance of plant-growth-promoting bacteria in soil, decrease excessive chemical fertilizer usage, enhance crop stress tolerance, and promote plant growth, etc. [31]. It has been reported that PGA improved the growth of Brassica rapa L. [32]. The application of PGA could also strengthen the antioxidant capacity of B. napus L. by reinforcing the activities of superoxide dismutase (SOD) and catalase (CAT) [33]. Meanwhile, the previous reports demonstrated that PGA reinforced the photosynthesis of B. rapa L. and maize (Zea mays L.) [34,35]. It has been displayed that PGA could promote maize growth by improving the photosynthesis, water metabolism, and the antioxidant capacity [36]. The above previous reports indicated that PGA promoted crops’ growth by regulating the photosynthesis, water metabolism, and the antioxidant capacity, whereas it is still unclear whether, and how, PGA affects the photosynthetic performance, water metabolism, the antioxidant capacity, and the growth of S. miltiorrhiza. In addition, the influence of PGA on the yield of main medicinal components in S. miltiorrhiza roots is also unclear. Hence, it is worth investigating the role of PGA in regulating the photosynthetic performance, water metabolism, the antioxidant capacity, the growth, and the yield of main medicinal components in S. miltiorrhiza roots, which is the main novelty of this study.
In this research, we supposed that PGA improved the growth and the accumulation of main medicinal components of S. miltiorrhiza. To prove the correctness of this hypothesis, we explored the influences of PGA on growth parameters such as basal diameter, plant height, shoot and root biomass, root volume, SPAD value, net photosynthetic rate (Pn), chlorophyll fluorescence parameters (actual photochemical efficiency of photosynthetical system II (Y(II)), maximum photochemical efficiency of photosynthetical system Ⅱ in dark (Fv/Fm) and in light (Fv′/Fm′), photochemical quenching (qP), non-photochemical quenching (NPQ), electronic transfer rate (ETR)), transpiration rate (Tr), water use efficiency (WUE), stomatal conductance (Gs), leaf relative water content (LRWC), the activities of antioxidant enzymes (SOD, peroxidase (POD), CAT, ascorbate peroxidase (APX) and glutathione reductase (GR)), the contents of main osmotic adjustment substances (soluble protein (SP), soluble sugar (SS), proline (Pro)), malondialdehyde (MDA), reduced ascorbate (AsA), and reduced glutathione (GSH), as well as the yield of main medicinal components and the expression of gene coding enzymes in charge of the above medicinal components’ biosynthesis at the transcript level. The purpose of our research was to elucidate whether and how PGA affected the growth and the accumulation of main medicinal components of S. miltiorrhiza, which can provide more knowledge for PGA applications in facilitating the yield of main medicinal components.

2. Material and Methods

2.1. Plant Material and Treatment

Five-month-old seedlings of purple S. miltiorrhiza were supplied by the planting base in Danyang city, Jiangsu Province, China. Seedlings with similar height and growth status were planted in gallon pots (30.0 cm height, 26.5 cm upper caliber and 25.5 cm lower caliber) with 2 seedlings per pot. Each pot contained 14.0 kg of garden soil and peat (6:1, w/w). Seedlings were cultivated in the open air. All the pots were placed under the rain shelter in rainy weather. Field water capacity (FC) of culture soil was 28% (w/w). During the whole experiment, the water content of the culture soil was controlled to 60% FC by weighing method from March to November 2022. In order to provide enough mineral nutrition, we added 4.44 g compound fertilizer (Stanley Fertilizer Co., Ltd., Linyi, China) to the culture soil per pot. The ratio of N:P:K in the compound fertilizer is 15:15:15.
To investigate the effects of PGA (Nanjing Shineking Biotech Co., Ltd., Nanjing, China), the seedlings were, respectively, treated by 0.022, 0.044, and 0.088 g PGA per pot through root irrigation method and expressed as T1, T2, and T3. Before treatment, different dosages of PGA per pot were prepared by dissolving PGA in 300 mL distilled water, respectively. Meanwhile, the control seedlings were irrigated by 300 mL distilled water alone. Each treatment was repeated nine times. We treated the seedlings on 15 April and 15 May 2022, respectively. Among nine replicates, the first three replicates were applied to investigate the effects of PGA on corresponding parameters in June in Table 1. The second three replicates were applied to investigate the effects of PGA on corresponding parameters in August in Table 1. The third three replicates were used to investigate the influences of PGA on final shoot and root dry weight, as well as the final yield of medicinal components in root shown in Table 1.

2.2. Assays of Growth Parameters

Basal diameter and plant height were measured by using the digital vernier scale (Shanghai Constant Measuring Tools Co., Ltd., Shanghai, China) and meter ruler (Hangzhou Weiwei Trading Co., Ltd., Hangzhou, China), respectively. Whole plants were taken out by the broken barrel method and each plant was then divided into root and shoot. Then, root volume was determined through drainage method using 500 mL volumetric cylinder (Shanghai Leigu Instrument Co., Ltd., Shanghai, China). Then, the root and shoot were dried for 72 h at 80 °C. Finally, the dry weight was calculated using the electronic balance (Shanghai Yajin Electronic Technology Co., Ltd., Shanghai, China). The accuracy of the electronic balance was 0.01 g. Root/shoot ratio was expressed as the quotient of root dry weight and shoot dry weight. In November, whole plants were also taken out by the broken barrel method and each plant was also divided into root and shoot. Then, their dry weight was measured as above. Above indicators of each treatment were all measured three replicates.

2.3. Assays of SPAD, Pn, and Chlorophyll Fluorescence Parameters

The SPAD value of the top fully expanded leaf was measured by using SPAD-502 Plus Chlorophyll Meter (Konica Minolta, Tokyo, Japan). The Pn value was measured by using Licor-6400 photosynthetic instrument (Lincoln, NE, USA). The conditions in leaf chamber were set as light intensity of 1000 μmol(photon) m−2 s−1, CO2 concentration of 400 ppm, and leaf temperature of 25.0 °C. The top fully expanded leaves were first equilibrated and then a steady-state value of Pn was recorded. The leaves used to measure Pn value were also used to measure chlorophyll fluorescence parameters Fv/Fm, Fv′/Fm′, NPQ, qP, Y (Ⅱ), and ETR by a PAM-2500 portable modulated chlorophyll fluorometer (Walz, Effeltrich, Germany). Minimum fluorescence (F0) was measured under a weak modulating radiation (0.5 μmol(photon) m−2 s−1), and maximum fluorescence (Fm) was induced by a saturating pulse of radiation (2400 μmol(photon) m−2 s−1). For dark adaptation, the leaves were covered for 30 min. Then, the above chlorophyll fluorescence parameters were measured by the fluorometer. All above indicators were measured from 9:30 to 11:00. Above indicators of each treatment were all measured three replicates.

2.4. Assays of SP, SS, and Pro Contents in Leaves

SS content was measured according to Wei [37] by using the anthrone-sulfuric acid colorimetry method. SP content was measured according to Bradford [38] by using the Coomassie brilliant blue G-250 method. Pro content was analyzed by using the acid-ninhydrin chromogenic agent method described by Bates et al. [39]. Above indicators of each treatment were all measured three replicates.

2.5. Assays of Tr, Gs, WUE, and LRWC

The leaves used to measure Pn value were also used to measure Tr, Gs, and WUE, along with Pn, by using Licor-6400 photosynthetic instrument (Lincoln, NE, USA) from 9:30 to 11:00. The conditions in leaf chamber were set as light intensity of 1000 μmol(photon) m−2 s−1, CO2 concentration of 400 ppm, and leaf temperature of 25.0 °C. The top fully expanded leaves were first equilibrated and then steady-state values of Tr, Gs, and WUE were recorded. The value of LRWC was calculated using below equation: LRWC = [(FW − DW)/(SW − DW)] × 100%. In this equation, FW, DW, and SW stand for fresh weight, dry weight, and saturated weight of leaves. Briefly, fresh leaves were weighed and recorded as FW. Fresh leaves were immersed in water for 12 h and recorded as SW. Then, the leaves were dried in an oven (Shanghai Yilin Scientific Instrument Co., Ltd., Shanghai, China) at 105 °C for 5 min followed by 65 °C until a constant weight, which was recorded as DW. Above indicators of each treatment were all measured three replicates.

2.6. Assays of Antioxidant Enzymes and MDA Content in Leaves

The activities of SOD (EC 1.15.1.1), POD (EC 1.11.1.7), and CAT (EC 1.11.1.6) were, respectively, measured according to Giannopolitis and Ries [40], Scebba et al. [41], and Kato and Shimizu [42]. One unit of SOD activity was defined as the amount of enzyme required to cause a 50% inhibition in the nitro blue tetrazolium chloride monohydrate reduction. One unit of POD activity was defined as an increase in absorbance of 0.001 per min at 470 nm. One unit of CAT activity was defined as a decrease in absorbance of 0.001 per min at 240 nm. The activities of APX (EC 1.11.1.11) and GR (EC 1.6.4.2) were measured according to Shan and Liang [38]. One unit of APX and GR activities was defined as a decrease in absorbance of 0.01 per min at 290 nm and 340 nm, respectively. The activities of the above enzymes were all expressed as U g−1 FW. MDA content was also measured according to Shan and Liang [43] by using the thiobarbituric acid method. Above indicators of each treatment were all measured three replicates.

2.7. Determination of AsA and GSH Contents in Leaves

Briefly, each leaf sample (0.5 g) was homogenized with 5 mL of 5% (m/v) ice-cold meta-phosphoric acid (Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China). The homogenates were then centrifuged at 12,000× g for 20 min at 4 °C. Then, the supernatants were immediately used to measure the contents of AsA and GSH. The contents of AsA and GSH were, respectively, measured by using the method described by Hodges et al. [44] and Griffith [45]. Above indicators of each treatment were all measured three replicates.

2.8. Real-Time Quantitative PCR (qRT-PCR) of Key Genes Coding Enzymes Responsible for the Biosynthesis of Main Medicinal Components in Root

Total RNA was extracted from frozen root samples by using RNA extraction kit (Bioteke Corporation Co., Ltd., Wuxi, China). The quality of RNA extraction was assessed via BioDrop (Shanghai Representative Office of Biochrom Ltd., Shanghai, China) and agarose gel electrophoresis. According to the protocol of a cDNA synthesis kit (TransGen Biotech Co., Ltd., Beijing, China), cDNA was synthesized and then used as the template of qRT-PCR. Specific primers for key gene coding enzymes responsible for the biosynthesis of main medicinal components and the internal reference gene Actin were designed as in Table 2. The above primers were all synthesized by Sangon Biotech. PCR reactions (10 μL) included 0.5 μL cDNA, 0.2 μL each of upstream and downstream primers, 5 μL 2×PerfectStart Green qPCR SuperMix (TransGen Biotech Co., Ltd., Beijing, China), and 4.1 μL H2O. Reactions were performed by using an ABI Quant Studio 6 Flex real-time PCR system (EPBAIS Applied Biosystems Trading (Shanghai) Co., Ltd., Shanghai, China) under below conditions: 95 °C for 30 s, 1 cycle; 95 °C for 5 s and 58 °C for 30 s, 40 cycles. The expression of each gene relative to average Ct value of the internal reference gene was determined and analyzed by using ABI 6 Flex System Sequence Detection Software version 1.3. The relative change in gene transcription level was quantified according to 2−ΔΔCt method. For control samples, the mean relative expression level of the assayed gene was assigned a value of 1.0, and the relative expression level of all samples calculated relative to it. Each treatment was performed three replicates.

2.9. Assays of the Yield of Main Medicinal Components per Plant in Root

The dried roots were pulverized and 50 mg of sample powder was dissolved in 5 mL 70% methanol (Thermo Fisher Scientific (China) Inc., Shanghai, China) and sonicated for 45 min. Then, the solution was centrifuged at 12,000× g for 10 min. The solution was filtered through a 0.22 mm microporous membrane (Zhejiang Tailin Biotechnology Co., Ltd., Hangzhou, China) and then used to measure the contents of DHT, CTS, Tan I, Tan ⅡA, RosA, and SalB in roots by using Waters e2695 binary high-performance liquid chromatography (Waters Technology (Shanghai) Co., Ltd., Shanghai, China) with Waters 2998 ultraviolet detector (Waters Technology (Shanghai) Co., Ltd., Shanghai, China) and Waters Sunfire C18 chromatographic column (Waters Technology (Shanghai) Co., Ltd., Shanghai, China) by comparison with authentic standards based on retention times and peak areas. The standards of DHT, CTS, Tan I, Tan ⅡA, RosA, and SalB were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). The column temperature was 30 °C and sample volume was 20 μL. The volume flow rate was 1 mL/min, and the sample ran for 96 min. The chromatographic detection wavelength for Tans (DHT, CTS, Tan I, and Tan ⅡA) was 270 nm. The chromatographic detection wavelength for phenolic acids (RosA and SalB) was 288 nm. The mobile phase is chromatography-grade acetonitrile (Thermo Fisher Scientific (China) Inc., Shanghai, China) and 0.02% phosphoric acid (Thermo Fisher Scientific (China) Inc., Shanghai, China) aqueous solution. The elution gradient program was set according to Wang et al. [46]. The contents of main medicinal components were calculated by using the standard curves. The final yield of main medicinal components per plant was expressed as the product of the contents of main medicinal components and the dry weight of root per plant. Above indicators of each treatment were all measured three replicates.

2.10. Statistical Analysis

Data in figures and Tables were the mean of three replicates and expressed as mean ± standard deviation. Figures were drawn by using Excel software 2021. Statistical analyses were performed by one-way analysis of variance by using SPSS software 25.0. Significant difference was compared by Duncan’s multiple range test at 5% level. Correlation analysis and regression analysis were also performed by using SPSS software 25.0.

3. Results

3.1. Influences of PGA on Growth Parameters

In comparation with control, different dosages of PGA all increased the growth parameters of basal diameter, plant height, shoot and root biomass, and root volume in June and August (Figure 1). PGA increased the root/shoot ratio in June, but reduced root/shoot ratio in August. Among different dosages of PGA, T2 treatment significantly increased the above growth parameters except the root/shoot ratio, especially in August. In August, T2 treatment increased the basal diameter, plant height, shoot and root biomass, and root volume by 36.8%, 39.9%, 68.3%, 46.4%, and 41.7%, in comparation with the control group. The above findings suggest that PGA application could facilitate the growth of S. miltiorrhiza.

3.2. Effects of PGA on Photosynthetic Performance

Compared with the control, different dosages of PGA all increased the SPAD value, Pn, Y(II), Fv/Fm, Fv′/Fm′, qP, and ETR of S. miltiorrhiza in June and August (Table 3 and Figure 2). Meanwhile, different dosages of PGA decreased NPQ. Among different dosages of PGA, T2 treatment significantly affected the above parameters. In August, T2 treatment decreased NPQ by 26.9% and increased the SPAD value, Pn, Y(II), Fv/Fm, Fv′/Fm′, qP, and ETR by 30.5%, 51.1%, 27.5%, 27.4%, 34.9%, 24.6%, and 34.4%, in comparation with the control group. The above findings suggest that PGA application could improve the photosynthetic performance, which further facilitates the growth of S. miltiorrhiza.

3.3. Effects of PGA on Water Physiological Characteristics

Compared with the control, different dosages of PGA increased Tr, WUE, Gs, and LRWC in June and August (Figure 3). Meanwhile, different dosages of PGA also increased the contents of osmolytes SP, SS, and Pro (Table 4). Among different levels of PGA, T2 treatment significantly increased the above parameters. In August, T2 treatment increased Tr, WUE, Gs, LRWC, SP, SS, and Pro by 34.9%, 12.3%, 40.2%, 11.6%, 29.5%, 37.8%, and 32.0%, in comparation with the control group. The above findings suggest that PGA application could promote the accumulation of osmolytes, which further improves water retention capacity and maintains the water balance of S. miltiorrhiza. In this way, PGA improves the water metabolism and water use efficiency, which further facilitates the growth of S. miltiorrhiza.

3.4. Influences of PGA on the Antioxidant Capacity

In comparation with the control group, different dosages of PGA enhanced the antioxidant capacity by promoting the activities of antioxidant enzymes and the contents of antioxidants, which further lowered the MDA content in June and August (Table 5 and Table 6, Figure 4). Among different dosages of PGA, T2 treatment significantly strengthened the antioxidant capacity. In August, T2 treatment increased the activities of SOD, POD, CAT, APX, and GR by 33.3%, 29.9%, 40.1%, 36.6%, and 42.0%, respectively, in comparation with the control group. In addition, T2 treatment increased the contents of AsA and GSH by 39.9% and 30.1%, respectively. Meanwhile, T2 treatment decreased the MDA content by 41.1%. The above findings indicate that PGA application enhances the antioxidant capacity, which further maintains the redox homeostasis of S. miltiorrhiza. In this way, PGA facilitates the growth of S. miltiorrhiza.

3.5. Effects of PGA on the Yield of RosA and SalB per Plant and the Expression of Genes Coding Enzymes Responsible for Their Biosynthesis in S. miltiorrhiza Root

In comparation with control, different dosages of PGA had better influences on the yield of RosA and SalB per plant and the expression of gene coding enzymes responsible for their biosynthesis in roots in June and August (Figure 5 and Figure 6). Among different dosages of PGA, T2 treatment significantly enhanced the expression of gene coding enzymes responsible for RosA and SalB biosynthesis, including RAS10, CYD98A75, and CYD98A14, which further increased the yield of RosA and SalB in roots. In August, T2 treatment up-regulated the expression of RAS10, CYD98A75, and CYD98A14 by 111.0%, 200.0%, and 163.6%, in comparation with control. At the same time, T2 treatment facilitated the yield of RosA and SalB per plant by 74.8% and 130.4%. These results suggest that PGA application promotes RosA and SalB biosynthesis in roots by enhancing the expression of gene coding enzymes in charge of their biosynthesis at the transcript level. In this way, PGA facilitates the accumulation of water-soluble medicinal ingredients in roots.

3.6. Effects of PGA on the Yield of Main Tanshinones per Plant and the Expression of Genes Coding Enzymes Responsible for Their Biosynthesis in S. miltiorrhiza Root

In comparation with control, different dosages of PGA also had better influences on the yield of main tanshinones per plant and the expression of gene coding enzymes responsible for their biosynthesis in roots in June and August (Figure 7 and Figure 8), especially in August. Among different dosages of PGA, T1 significantly enhanced the expression of FPPS, HGMR, and GGPPS. T2 significantly enhanced the expression of DXS2, CPS, HGMR, and GGPPS, which further increased the yield of main tanshinones in S. miltiorrhiza roots, including DHT, CTS, Tan I, and Tan ⅡA. In August, T1 treatment up-regulated the expression of HGMR, DXS2, FPPS, GGPPS, and CPS by 125.0%, 150.0%, 233.0%, 399.0%, and 266.0%, T2 treatment up-regulated the expression of HGMR, DXS2, FPPS, GGPPS, and CPS by 136.0%, 222.0%, 157.0%, 411.0%, and 310.0%, T3 treatment up-regulated the expression of HGMR, DXS2, FPPS, GGPPS, and CPS by 80.0%, 191.0%, 160.0%, 271.0%, and 211.0%, compared with the control. Meanwhile, T1 treatment increased the yield of DHT, CTS, Tan I, and Tan ⅡA by 74.0%, 113.2%, 86.4%, and 46.6%, T2 treatment increased the yield of DHT, CTS, Tan I, and Tan ⅡA by 99.7%, 44.8%, 90.5%, and 27.1%. T3 treatment increased the yield of DHT, CTS, Tan I, and Tan ⅡA by 85.2%, 49.4%, 71.3%, and 13.3%, compared with the control. The above findings suggest that PGA application could facilitate the biosynthesis of DHT, CTS, Tan I, and Tan ⅡA in roots by enhancing the expression of gene coding enzymes in charge of their biosynthesis at the transcript level. In this way, PGA facilitates the accumulation of fat-soluble medicinal ingredients in roots.

3.7. Effects of PGA on Final Biomass and the Final Yield of Main Medicinal Components per Plant

In comparation with the control group, different dosages of PGA had significant effects on the final biomass of the shoots and roots and the yield of RosA, SalB, DHT, CTS, Tan I, and Tan ⅡA per plant (Table 7 and Figure 9), especially with T2 and T3 treatment. Compared with control, T2 treatment improved the final biomass of the shoots and roots by 65.4% and 63.0%, T3 treatment improved the final biomass of the shoots and roots by 48.2% and 35.9%. Meanwhile, T2 treatment apparently improved the yield of RosA, SalB, DHT, CTS, Tan I, and Tan ⅡA per plant by 123.0%, 208.8%, 65.5%, 14.7%, 42.5%, and 22.2%, compared with the control. T3 treatment apparently improved the yield of RosA, SalB, DHT, CTS, Tan I, and Tan ⅡA per plant by 49.1%, 100.7%, 68.9%, 43.3%, 109.9%, and 86.5%. These results once again suggest that the application of PGA could improve S. miltiorrhiza growth and enhance the accumulation of main medicinal components in root.
Through Pearson correlation analysis (Table 8), we found that shoot and root dry weight and the yield of RosA, SalB, DHT, CTS, Tan I, and Tan ⅡA were all positively correlated with PGA dosage, which indicated that PGA had positive effects on plant growth and the yield of above main medicinal components in roots. Through regression analysis (Table 9), we found that shoot and root dry weight and the yield of RosA, SalB, and DHT increased when PGA dosage was during the range from 0 to 0.044 g per pot, but tended to be decreased under higher PGA dosage. While the yield of CTS, Tan I, and Tan ⅡA increased when PGA dosage was during the range from 0 to 0.088 g per pot. Therefore, our above results clearly suggested that there was a suitable dosage of PGA in promoting the growth and the yield of main medicinal components in roots.

4. Discussion

In recent years, researchers have shown that PGA improves the growth of Chinese cabbage [32], maize [20], rape [47], spinach (Spinacia oleracea L.) [48], cotton (Gossypium hirsutum L.) [49], lettuce (Lactuca sativa var. ramosa Hort.) [50], wheat (Triticum aestivum L.) [51], cucumber (Cucumis sativus L.) [52], and Solanum nigrum [53]. In our study, the findings demonstrated that PGA significantly improved S. miltiorrhiza growth, as indicated by basal diameter, plant height, shoot and root biomass, and root volume, which agreed with previous results in other plants [36,50]. Previous research has also documented that plant growth had close relationships with photosynthesis, water metabolism, and the antioxidant capacity [34,36]. Therefore, it will be interesting to explore the influences of PGA on the photosynthesis, water metabolism, and the antioxidant capacity of S. miltiorrhiza, which can elucidate the physiological mechanism of PGA in promoting the growth of S. miltiorrhiza. For photosynthesis, previous studies have shown that PGA improved Pn and the contents of photosynthetic pigments in maize, rape and Chinese cabbage [33,34,35]. It has been reported that PGA could decrease the chlorophyll fluorescence parameter NPQ value and increase the values of Fv/Fm, ETR, qP, and Y (Ⅱ) [34]. In S. miltiorrhiza, we found that PGA decreased NPQ and improved the Pn, SPAD value, Fv/Fm, ETR, qP, and Y (Ⅱ), which was consistent with previous studies in other plants [34,35]. For water metabolism, Cao et al. [36] reported that PGA could promote stomatal opening, WUE, and the content of osmotic regulator proline in maize. Quan et al. [34] reported that PGA increased Tr, Gs, and proline content in cabbage. Xu et al. [33] found that PGA improved RWC and proline content in rape. Liang et al. [49] showed that PGA enhanced WUE of cotton crop. Lei et al. [54] demonstrated that PGA could increase proline content in rape. In S. miltiorrhiza, we found that PGA also promoted Tr, Gs, WUE, and proline content, which agreed with previous results in above other plants [34,36]. Additionally, we also found that PGA could increase LRWC and the contents of osmotic regulators SP and SS, which indicated that PGA could enhance water metabolism by maintaining water balance through osmoregulation in S. miltiorrhiza. For the antioxidant capacity, Xu et al. [33] showed that PGA enhanced the activities of SOD and CAT in rape. Quan et al. [34] found that PGA enhanced the activities of SOD, POD, CAT, and APX in Chinese cabbage. Cao et al. [36] demonstrated that PGA could improve the activities of SOD, POD, and APX in maize. Guo et al. [52] showed that PGA enhanced the activities of SOD, POD, and CAT in wheat. For S. miltiorrhiza, our study also displayed that PGA strengthened the antioxidant capacity by enhancing the activities of SOD, POD, CAT, and APX, which agreed with previous results in above other plants [34,36]. In addition, our findings demonstrated that PGA increased GR activity and the contents of antioxidants AsA and GSH in leaves, which further enhanced the antioxidant capacity of S. miltiorrhiza, which is one novelty for this study. As APX and GR are in charge of the operation of the ascorbate–glutathione (AsA-GSH) cycle, our current findings indicated that PGA could enhance the antioxidant capacity by improving the AsA-GSH cycle in S. miltiorrhiza. Shan and Liang [38] have displayed that the contents of AsA and GSH could be regulated through the enzymes responsible for their regeneration and biosynthesis. In the AsA-GSH cycle, APX, GR, DHAR, and MDHAR are in charge of AsA and GSH regeneration [55]. L-galactono-1,4-lactone dehydrogenase (GalLDH) and gamma-glutamylcysteine synthetase (γ-ECS) are in charge of AsA and GSH biosynthesis, respectively [43]. In the study, the findings showed that PGA increased the contents of AsA and GSH in S. miltiorrhiza, whereas our study only explored the influences of PGA on the activities of APX and GR. We did not explore the influences of PGA on the activities of DHAR, MDHAR, GalLDH, and γ-ECS. Therefore, it is worth exploring the influences of PGA on the activities of DHAR, MDHAR, GalLDH, and γ-ECS, which can provide more information on the roles of PGA in enhancing the antioxidant capacity of S. miltiorrhiza. Furthermore, Xu et al. [47] displayed that brassinolide (BR), jasmonic acid (JA), Ca2+, and H2O2 were involved in PGA regulating the antioxidant capacity of rape through cross-talk. However, it is still unclear whether BR, JA, Ca2+, and H2O2 were involved in PGA regulating the antioxidant capacity of S. miltiorrhiza alone or through cross-talk. Therefore, it is worth investigating the roles of BR, JA, Ca2+, and H2O2 in PGA regulating the antioxidant capacity of S. miltiorrhiza, which can clarify more mechanisms of the roles of PGA in enhancing the antioxidant capacity of S. miltiorrhiza. The above results of the current study are the first to report the function of PGA in facilitating S. miltiorrhiza growth by enhancing photosynthesis, water metabolism, and antioxidant capacity (Figure 10), which provides more theoretical basis for PGA applications in promoting the growth of S. miltiorrhiza.
Tans and SAs are the main medicinal components in Salvia species, including S. miltiorrhiza. In the root of S. miltiorrhiza, Tans mainly include DHT, CTS, Tan I, and Tan ⅡA, and SAs mainly include RosA and SalB [8]. For the current research, our findings demonstrate that different dosages of PGA had significant influences on the final yield of DHT, CTS, Tan I and Tan ⅡA, RosA, and SalB in S. miltiorrhiza roots, especially for the treatments with 0.044 and 0.088 g PGA per pot. The biosynthetic pathways of phenolic acids include the phenylpropanoid pathway and tyrosine-derived pathway [2,3]. The key enzymes in the phenylpropanoid pathway mainly include phenylalanine ammonia lyase (PAL) and 4-coumarate:CoA ligase (4CL). In the tyrosine-derived pathway, the key enzymes mainly include tyrosine aminotransferase (TAT) and 4-hydroxyphenylpyruvate reductase (HPPR). Rosmarinic acid synthase (RAS) can couple products from the above two pathways to synthesize 4-coumaroyl-3′,4′-dihydroxyphenyllactic acid, which is then hydroxylated by CYP98A to produce RosA. SalB is then derived from RosA [2,3]. Thus, the contents of the phenolic acids RosA and SalB have close relationships with the expression of PAL, 4CL, TAT, RAS, and CYP98A [2,3]. In this study, we found that PGA could up-regulate the expression of RAS10, CYD98A75, and CYD98A14, which further increased the accumulation of the water-soluble ingredients RosA and SalB in roots. These results clearly indicated that PGA could improve the production of RosA and SalB by enhancing their anabolism through the up-regulation of RAS and CYD98A at the transcript level. The biosynthetic pathways of Tans include the mevalonate (MVA) pathway in cytoplasm and the methylerythritol phosphate (MEP) pathway in plastids [56]. In the MVA pathway, 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) is a key upstream enzyme. In the MEP pathway, 1-deoxy-D-xylulose-5-phosphate synthase (DXS) is a key upstream enzyme [56,57]. The products of the above two pathways are then catalyzed by the key midstream and downstream enzymes. The key midstream enzymes include geranylgeranyl diphosphate synthase (GGPPS), farnesyl pyrophosphate synthase (FPPS), and copalyl diphosphate synthase (CPS). The key downstream enzymes include kaurene synthase-like (KSL) and a cytochrome P450 enzyme (CYP76AH1) [58]. Thus the contents of Tans have also close relationships with the expression of their biosynthetic genes, including DXS, HMGR, FPPS, GGPPS, CPS, and KSL. The current findings also demonstrated that PGA could up-regulate the expression of HGMR, DXS2, FPPS, GGPPS, and CPS, which further increases the accumulation of the fat-soluble ingredients DHT, CTS, Tan I, and Tan ⅡA in roots. The present study clearly indicates that PGA could increase the yield of the main medicinal components in roots by enhancing the expression of key upstream and midstream gene coding enzymes in charge of their biosynthesis at the transcript level (Figure 10), which provides knowledge for the roles of PGA in regulating the accumulation of medicinal components and PGA applications in S. miltiorrhiza production. This is the other novelty of this study. In the current study, we also found that the treatment with 0.044 g PGA per pot had better effects on the yield of the water-soluble medicinal ingredients RosA and SalB in S. miltiorrhiza roots, while the treatment with 0.088 g PGA per pot had better effects on the yield of the fat-soluble medicinal ingredients CTS, Tan I, and Tan ⅡA in roots. Thus, the above results suggest that we should select the suitable dosage of PGA according to market demand for medicinal ingredients in S. miltiorrhiza production. It has been documented that methyl jasmonate (MJ) promotes Tans biosynthesis in S. miltiorrhiza [59]. Increasing research has also shown that JA could be involved in smoke-isolated butenolide-regulated Tans biosynthesis in S. miltiorrhiza [60]. Additionally, MJ and JA could regulate phenolic acid accumulation in S. miltiorrhiza [3,14]. The previous research above indicated that jasmonates (JAs) could regulate Tans and phenolic acids biosynthesis. Meanwhile, previous studies showed that JA could regulate SalB content in S. miltiorrhiza through cross-talk with brassinolide, Ca2+, and H2O2 [10,11]. A previous study displayed that JA participated in PGA regulating the antioxidant capacity of S. miltiorrhiza [47]. However, it is still unclear whether JA participated in PGA-regulated Tans and phenolic acid biosynthesis in S. miltiorrhiza alone or through cross-talk with other signal molecules. In addition, ABA has been proven to be a vital signal molecule in regulating the accumulation of Tans and phenolic acids in S. miltiorrhiza [61,62]. While it is still unknown whether ABA participated in PGA-regulated Tans and phenolic acid biosynthesis in S. miltiorrhiz. If so, it will also be worth investigating the cross-talk between ABA and the other signal molecules above in PGA-regulated Tans and phenolic acid biosynthesis, which will provide more knowledge on the mechanisms of PGA in improving the accumulation of main medicinal components in S. miltiorrhiza.

5. Conclusions

To conclude, our findings indicated that PGA significantly promoted the growth and the accumulation of main medicinal components in S. miltiorrhiza. The application of PGA improved the growth of S. miltiorrhiza by promoting photosynthesis, water metabolism, and the antioxidant capacity. Meanwhile, PGA also improved the accumulation of main medicinal components by enhancing the expression of gene coding enzymes in charge of Tans and phenolic acid biosynthesis in S. miltiorrhiza at the transcript level. The above results suggest that PGA could be used to improve the biomass and the yield of main medicinal components in the production of S. miltiorrhiza.

Author Contributions

Software, X.Z. and Y.L.; Formal analysis, X.Z. and Y.L.; Investigation, X.Z. and Y.L.; Resources, X.Z. and Y.L.; Writing—original draft, C.S.; Writing—review & editing, C.S. and D.Y.; Supervision, D.Y.; Project administration, C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Agricultural Science and Technology Project of Pan’an County (202201), Major Science and Technology Projects of Breeding New Varieties of Agriculture in Zhejiang Province (2021C02074), Key project of the Central Government: Capacity Building of Sustainable Utilization of Traditional Chinese Medicine Resources (2060302), and Key Scientific and Technological Research Projects in Henan Province (212102110131).

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ghanadian, M.; Afshar, R.J.; Fakhim, H.; Yousefi, H.; Matkowski, A.; Khodadadi, M.; Gharibi, S. Bioassay-guided isolation in Salvia abrotanoides Karel. stem based on its anti-fungal and anti-trichomonas activity. Res. Pharm. Sci. 2023, 18, 317–325. [Google Scholar] [PubMed]
  2. Wang, B.; Sun, W.; Li, Q.; Li, Y.; Luo, H.; Song, J.; Sun, C.; Qian, J.; Zhu, Y.; Hayward, A.; et al. Genome-wide identification of phenolic acid biosynthetic genes in Salvia miltiorrhiza. Planta 2015, 241, 711–725. [Google Scholar] [PubMed]
  3. Xie, Y.; Ding, M.; Yin, X.; Wang, G.; Zhang, B.; Chen, L.; Ma, P.; Dong, J. MAPKK2/4/5/7-MAPK3-JAZs modulate phenolic acid biosynthesis in Salvia miltiorrhiza. Phytochemistry 2022, 199, 113177. [Google Scholar] [PubMed]
  4. Khodadadi, F.; Ahmadi, F.S.; Talebi, M.; Matkowski, A.; Szumny, A.; Afshari, M.; Rahimmalek, M. Metabolic and transcriptomic approaches of chitosan and water stress on polyphenolic and terpenoid components and gene expression in Salvia abrotanoides (Karl.) and S. yangii. Int. J. Mol. Sci. 2023, 24, 15426. [Google Scholar] [PubMed]
  5. Afshari, M.; Rahimmalek, M.; Sabzalian, M.R.; Bielecka, M.; Matkowski, A.; Talebi, M. Changes in physiological, phytochemical traits and gene expression of two Perovskia species in response to water deficit. Sci. Hortic. 2022, 293, 110747. [Google Scholar]
  6. Zou, L.; Liu, D.; Yang, H.; Zhou, C.; Deng, S.; Xu, N.; He, X.; Liu, Y.; Shao, M.; Yu, L.; et al. Salvianolic acids from Salvia miltiorrhiza Bunge and their anti-inflammatory effects through the activation of α7nAchR signaling. J. Ethnopharmacol. 2023, 317, 116743. [Google Scholar]
  7. Wei, B.; Sun, C.; Wan, H.; Shou, Q.; Han, B.; Sheng, M.; Li, L.; Kai, G. Bioactive components and molecular mechanisms of Salvia miltiorrhiza Bunge in promoting blood circulation to remove blood stasis. J. Ethnopharmacol. 2023, 317, 116697. [Google Scholar]
  8. Hao, X.L.; Pu, Z.Q.; Cao, G.; You, D.W.; Zhou, Y.; Deng, C.P.; Shi, M.; Nile, S.H.; Wang, Y.; Zhou, W.; et al. Tanshinone and salvianolic acid biosynthesis are regulated by SmMYB98 in Salvia miltiorrhiza hairy roots. J. Adv. Res. 2020, 23, 1–12. [Google Scholar]
  9. Wu, Y.B.; Ni, Z.Y.; Shi, Q.W.; Dong, M.; Kiyota, H.; Gu, Y.C.; Cong, B. Constituents from Salvia species and their biological activities. Chem. Rev. 2012, 112, 5967–6026. [Google Scholar]
  10. Liang, Y.; Kang, L.Y.; Qi, Z.H.; Gao, X.; Quan, H.L.; Lin, H.F. Salvia miltiorrhiza solution and its active compounds ameliorate human granulosa cell damage induced by H2O2. Exp. Ther. Med. 2021, 21, 64. [Google Scholar]
  11. Wang, B.Q. Salvia miltiorrhiza: Chemical and pharmacological review of a medicinal plant. J. Med. Plant Res. 2010, 4, 2813–2820. [Google Scholar]
  12. Zhang, Y.; Zhang, T.; Pan, Y.; Ma, L.; Fang, Y.; Pan, C.; Qiang, Y.; Cao, X.; Xu, H. Nano-selenium promotes the product quality and plant defense of Salvia miltiorrhiza by inducing tanshinones and salvianolic acids accumulation. Ind. Crops Prod. 2023, 195, 116436. [Google Scholar]
  13. Han, M.; Guo, W.; Liang, Z.; Yang, D.; Yan, X.; Zhu, Y.; Liu, Y. Effects of cerous nitrate on growth and tanshinone production in Salvia miltiorrhiza hairy roots. J. Rare Earth. 2015, 33, 1228–1235. [Google Scholar]
  14. Sun, H.; Xu, Z.; Zhou, J.; Guo, L. Karrikins-induced accumulation of salvianolic acid B is regulated by jasmonic acid and hydrogen peroxide in Salvia miltiorrhiza. S. Afr. J. Bot. 2020, 130, 371–374. [Google Scholar]
  15. Sun, H.; Xu, Z.; Zhou, J.; Guo, L. Karrikins-induced accumulation of salvianolic acid B is mediated by calcium–calmodulin, brassinolide and jasmonic acid in Salvia miltiorrhiza. S. Afr. J. Bot. 2020, 132, 45–49. [Google Scholar]
  16. Shi, M.; Hua, Q.; Kai, G. Comprehensive transcriptomic analysis in response to abscisic acid in Salvia miltiorrhiza. Plant Cell Tiss. Organ Cult. 2021, 147, 389–404. [Google Scholar]
  17. Islam, J.; Ryu, B.R.; Azad, O.K.; Rahman, H.; Rana, S.; Lim, J.D.; Lim, Y.S. Exogenous putrescine enhances salt tolerance and ginsenosides content in Korean Ginseng (Panax ginseng Meyer) sprouts. Plants 2021, 10, 1313. [Google Scholar]
  18. Chang, Q.; Zhang, L.; Chen, S.; Gong, M.; Liu, L.; Hou, X.; Mi, Y.; Wang, X.; Wang, J.; Zhang, Y.; et al. Exogenous melatonin enhanced the yield and secondary metabolite contents of Prunella vulgaris by modulating antioxidant system, root architecture and photosynthetic capacity. Plants 2023, 12, 1129. [Google Scholar]
  19. Thakore, D.; Srivastava, A.K.; Sinha, A.K. Mass production of Ajmalicine by bioreactor cultivation of hairy roots of Catharanthus roseus. Biochem. Eng. J. 2017, 119, 84–91. [Google Scholar]
  20. Jose, B.; Silja, P.K.; Pillai, D.B.; Satheeshkumar, K. In vitro cultivation of hairy roots of Plumbago rosea L. in a customized Reaction kettle for the production of plumbagin—An anticancer compound. Ind. Crops Prod. 2016, 87, 89–95. [Google Scholar]
  21. Kawka, M.; Bubko, I.; Koronkiewicz, M.; Gruber-Bzura, B.; Graikou, K.; Chinou, I.; Jeziorek, M.; Pietrosiuk, A.; Sykłowska-Baranek, K. Polyurethane foam rafts supported in vitro cultures of Rindera graeca roots for enhanced production of Rinderol, potent proapoptotic naphthoquinone compound. Int. J. Mol. Sci. 2022, 23, 56. [Google Scholar]
  22. Nowak, B.; Kawka, M.; Wierzchowski, K.; Sykłowska-Baranek, K.; Pilarek, M. MTMS-based aerogel constructs for immobilization of plant hairy roots: Effects on proliferation of Rindera graeca biomass and extracellular secretion of naphthoquinones. J. Funct. Biomater. 2021, 12, 19. [Google Scholar]
  23. Wierzchowski, K.; Kawka, M.; Wrzecionek, M.; Urbanek, J.; Pietrosiuk, A.; Sykłowska-Baranek, K.; Gadomska-Gajadhur, A.; Pilarek, M. Stress-induced intensification of deoxyshikonin production in Rindera graeca hairy root cultures with ester-based scaffolds. Plants 2022, 11, 3462. [Google Scholar] [PubMed]
  24. Chang, Y.N.; Mueller, R.E.; Iannotti, E.L. Use of low MW polylactic acid and lactide to stimulate growth and yield of soybeans. Plant Growth Regul. 1996, 19, 223–232. [Google Scholar]
  25. Srivastava, S.; Srivastava, A.K. Azadirachtin production by hairy root cultivation of Azadirachta indica in a modified stirred tank reactor. Bioprocess Biosyst. Eng. 2012, 35, 1549–1553. [Google Scholar] [PubMed]
  26. Chen, C.; Wu, L.; Harbottle, M. Influence of biopolymer gel-coated fibres on sand reinforcement as a model of plant root behaviour. Plant Soil 2019, 438, 361–375. [Google Scholar]
  27. Patil, S.V.; Salunke, B.K.; Patil, C.D.; Salunkhe, R.B. Studies on amendment of different biopolymers in sandy loam and their effect on germination, seedling growth of Gossypium herbaceum L. Appl. Biochem. Biotechnol. 2011, 163, 780–791. [Google Scholar] [PubMed]
  28. Chakraborty, M.; Hasanuzzaman, M.; Rahman, M.; Khan, M.A.R.; Bhowmik, P.; Mahmud, N.U.; Tanveer, M.; Islam, T. Mechanism of plant growth promotion and disease suppression by chitosan biopolymer. Agriculture 2020, 10, 624. [Google Scholar]
  29. Zagzog, O.A.; Gad, M.M.; Hafez, N.K. Effect of nano-chitosan on vegetative growth, fruiting and resistance of malformation of mango. Trends Hortic. Res. 2017, 6, 673–681. [Google Scholar]
  30. Balogun-Agbaje, O.A.; Odeniyi, O.A.; Odeniyi, M.A. Drug delivery applications of poly-γ-glutamic acid. Futur. J. Pharm. Sci. 2021, 7, 125. [Google Scholar]
  31. Wang, L.; Chen, S.; Yu, B. Poly-γ-glutamic acid: Recent achievements, diverse applications and future perspectives. Trends Food Sci. Technol. 2022, 119, 1–12. [Google Scholar]
  32. Bai, N.; Zhang, H.; Li, S.; Zheng, X.; Zhang, J.; Sun, L.; Lv, W. Effects of application rates of poly-γ-glutamic acid on vegetable growth and soil bacterial community structure. Appl. Soil Ecol. 2020, 147, 103405. [Google Scholar]
  33. Xu, Z.; Ma, J.; Lei, P.; Wang, Q.; Feng, X.; Xu, H. Poly-γ-glutamic acid induces system tolerance to drought stress by promoting abscisic acid accumulation in Brassica napus L. Sci. Rep. 2020, 10, 252. [Google Scholar]
  34. Quan, J.; Zheng, W.W.; Tan, J.R.; Li, Z.W.; Wu, M.F.; Hong, S.B.; Zhao, Y.T.; Zhou, Z.J.; Zang, X.Y. Glutamic acid and poly-γ-glutamic acid enhanced the heat resistance of Chinese cabbage (Brassica rapa L. ssp. pekinensis) by improving carotenoid biosynthesis, photosynthesis, and ROS signaling. Int. J. Mol. Sci. 2022, 23, 11671. [Google Scholar] [PubMed]
  35. Ma, H.; Li, P.; Liu, X.; Li, C.; Zhang, S.; Wang, X.; Tao, X. Poly-γ-glutamic acid enhanced the drought resistance of maize by improving photosynthesis and affecting the rhizosphere microbial community. BMC Plant Biol. 2022, 22, 11. [Google Scholar]
  36. Cao, L.; Lu, X.; Wang, G.; Dang, Z.; Qiu, T.; Qiu, J.; Tian, Y.; Wang, Z.; Dang, Y. Effects of foliar spraying with carbon-adsorbed polyglutamic acid on growth and development of maize. Crops 2022, 38, 158–166. [Google Scholar]
  37. Wei, Q. The Experiment of Basic Biochemistry; Higher Education Press: Beijing, China, 2009; pp. 84–86. [Google Scholar]
  38. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar]
  39. Bates, L.E.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar]
  40. Giannopolitis, C.N.; Ries, S.K. Superoxide dismutases occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar]
  41. Scebba, F.; Sebastiani, L.; Vitagliano, C. Activities of antioxidant enzymes during senescence of Prunus armeniaca leaves. Biol. Plantarum 2001, 44, 41–46. [Google Scholar]
  42. Kato, M.; Shimizu, S. Chlorophyll metabolism in higher plants VII. Chlorophyll degradation in senescing tobacco leaves: Phenolic-dependent peroxidative degradation. Can. J. Bot. 1987, 65, 729–735. [Google Scholar]
  43. Shan, C.; Liang, Z. Jasmonic acid regulates ascorbate and glutathione metabolism in Agropyron cristatum leaves under water stress. Plant Sci. 2010, 178, 130–139. [Google Scholar]
  44. Hodges, D.M.; Andrews, C.J.; Johnson, D.A.; Hamilton, R.I. Antioxidant compound responses to chilling stress in differentially sensitive inbred maize lines. Physiol. Plant 1996, 98, 685–692. [Google Scholar]
  45. Griffith, O.W. Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal. Biochem. 1980, 106, 207–212. [Google Scholar] [PubMed]
  46. Wang, F.; You, H.; Du, X.; Yang, Z.; Zhang, X.; Liang, Z.; Yang, D. Effects of different nitrogen sources on accumulation of active components in hairy roots of Salvia miltiorrhiza and Salvia castanea f. tomentosa. Chin. Tradit. Herb. Drugs 2020, 51, 2538–2547. [Google Scholar]
  47. Xu, Z.; Lei, P.; Pang, X.; Li, H.; Feng, X.; Xu, H. Exogenous application of poly-γ-glutamic acid enhances stress defense in Brassica napus L. seedlings by inducing cross-talks between Ca2+, H2O2, brassinolide, and jasmonic acid in leaves. Plant Physiol. Biochem. 2017, 118, 460–470. [Google Scholar]
  48. Chen, L.; Fei, L.J.; Wang, Z.L.; Salahou, M.K.; Liu, L.; Zhong, Y.; Dai, Z.G. The effects of ploy (γ-glutamic acid) on spinach productivity and nitrogen use efficiency in North-West China. Plant Soil Environ. 2018, 64, 517–522. [Google Scholar]
  49. Liang, J.; Shi, W. Poly-γ-glutamic acid improves water-stable aggregates, nitrogen and phosphorus uptake efficiency, water-fertilizer productivity, and economic benefit in barren desertified soils of Northwest China. Agric. Water Manag. 2021, 245, 106551. [Google Scholar]
  50. Wang, X.; Dong, G.; Liu, X.; Zhang, S.; Li, C.; Lu, X.; Xia, T. Poly-γ-glutamic acid-producing bacteria reduced Cd uptake and effected the rhizosphere microbial communities of lettuce. J. Hazard. Mater. 2020, 398, 123146. [Google Scholar]
  51. Guo, Z.; Yang, N.; Zhu, C.; Gan, L. Exogenously applied poly-γ-glutamic acid alleviates salt stress in wheat seedlings by modulating ion balance and the antioxidant system. Environ. Sci. Pollut. Res. 2017, 24, 6592–6598. [Google Scholar]
  52. Pang, X.; Lei, P.; Feng, X.; Xu, Z.; Xu, H.; Liu, K. Poly-γ-glutamic acid, a bio-chelator, alleviates the toxicity of Cd and Pb in the soil and promotes the establishment of healthy Cucumis sativus L. seedling. Environ. Sci. Pollut. Res. 2018, 25, 19975–19988. [Google Scholar]
  53. Wang, Y.; Duan, W.; Lv, C.; Wei, Z.; Zhu, Y.; Yang, Q.; Liu, Y.; Shen, Z.; Xia, Y.; Duan, K.; et al. Citric acid and poly-glutamic acid promote the phytoextraction of cadmium and lead in Solanum nigrum L. grown in compound Cd–Pb contaminated soils. Bull. Environ. Contam. Toxicol. 2023, 110, 37. [Google Scholar] [PubMed]
  54. Lei, P.; Xu, Z.; Liang, J.; Luo, X.; Zhang, Y.; Feng, X.; Xu, H. Poly(γ-glutamic acid) enhanced tolerance to salt stress by promoting proline accumulation in Brassica napus L. Plant Growth Regul. 2016, 78, 233–241. [Google Scholar]
  55. Maslennikova, D.R.; Lastochkina, O.V.; Shakirova, F.M. Exogenous sodium nitroprusside improves salt stress tolerance of wheat (Triticum aestivum L.) via regulating the components of ascorbate-glutathione cycle, chlorophyll content and stabilization of cell membranes state. Russ. J. Plant Physiol. 2022, 69, 130. [Google Scholar]
  56. Gao, W.; Sun, H.-X.; Xiao, H.; Cui, G.; Hillwig, M.; Jackson, A.; Wang, X.; Shen, Y.; Zhao, N.; Zhang, L.; et al. Combining metabolomics and transcriptomics to characterize tanshinone biosynthesis in Salvia miltiorrhiza. BMC Genom. 2014, 15, 73. [Google Scholar]
  57. Jiang, Z.; Gao, W.; Huang, L. Tanshinones, critical pharmacological components in Salvia miltiorrhiza. Front. Pharmacol. 2019, 10, 202. [Google Scholar]
  58. Xu, Z.; Peters, R.J.; Weirather, J.; Luo, H.; Liao, B.; Zhang, X.; Zhu, Y.; Ji, A.; Zhang, B.; Hu, S.; et al. Full-length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of Salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 2015, 82, 951–961. [Google Scholar]
  59. Hou, Z.; Li, Y.; Su, F.; Wang, Y.; Zhang, X.; Xu, L.; Yang, D.; Liang, Z. The exploration of methyl jasmonate on the tanshinones biosynthesis in hair roots of Salvia miltiorrhiza Bunge and Salvia castanea f. tomentosa Stib. Ind. Crops Prod. 2021, 167, 113563. [Google Scholar]
  60. Zhou, J.; Ran, Z.F.; Liu, Q.; Xu, Z.X.; Xiong, Y.H.; Fang, L.; Guo, L.P. Jasmonic acid serves as a signal role in smoke-isolated butenolide-induced tanshinones biosynthesis in Salvia miltiorrhiza hairy root. S. Afr. J. Bot. 2019, 121, 355–359. [Google Scholar]
  61. Shi, M.; Zhu, R.; Zhang, Y.; Zhang, S.; Liu, T.; Li, K.; Liu, S.; Wang, L.; Wang, Y.; Zhou, W.; et al. A novel WRKY34-bZIP3 module regulates phenolic acid and tanshinone biosynthesis in Salvia miltiorrhiza. Metab. Eng. 2022, 73, 182–191. [Google Scholar]
  62. Kuang, X.; Sun, S.; Li, Y.; Zhang, H.; Guo, B.; Li, Y.; Sun, C. Transcriptome sequencing with nanopore technology for acquiring a deeper understanding of abscisic acid regulation of secondary mechanisms in Salvia miltiorrhiza. Ind. Crops Prod. 2022, 177, 114535. [Google Scholar]
Agronomy 14 00252 g001
Figure 1. Influences of PGA on the growth parameters of basal diameter (A), plant height (B), biomass of shoot (C) and root (D), root volume (E), and root/shoot ratio (F) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Figure 1. Influences of PGA on the growth parameters of basal diameter (A), plant height (B), biomass of shoot (C) and root (D), root volume (E), and root/shoot ratio (F) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g001
Agronomy 14 00252 g002
Figure 2. Influences of PGA on Y (Ⅱ) (A), Fv/Fm (B), Fv′/Fm′ (C), qP (D), NPQ (E), and ETR (F) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Figure 2. Influences of PGA on Y (Ⅱ) (A), Fv/Fm (B), Fv′/Fm′ (C), qP (D), NPQ (E), and ETR (F) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g002
Agronomy 14 00252 g003
Figure 3. Influences of PGA on water physiological parameters of Tr (A), Gs (B), WUE (C), and LRWC (D) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Figure 3. Influences of PGA on water physiological parameters of Tr (A), Gs (B), WUE (C), and LRWC (D) of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g003
Agronomy 14 00252 g004
Figure 4. Influences of PGA on the activities of SOD (A), POD (B) and CAT (C), and MDA content (D) in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
Figure 4. Influences of PGA on the activities of SOD (A), POD (B) and CAT (C), and MDA content (D) in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g004
Agronomy 14 00252 g005
Figure 5. Influence of PGA on the expression of RAS10 (A), CYD98A75 (B), and CYD98A14 (C) in root. Different letters stand for significant difference at p < 0.05.
Figure 5. Influence of PGA on the expression of RAS10 (A), CYD98A75 (B), and CYD98A14 (C) in root. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g005
Agronomy 14 00252 g006
Figure 6. Influence of PGA on the yield of rosmarinic acid (A) and salvianolic acid B (B) per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Figure 6. Influence of PGA on the yield of rosmarinic acid (A) and salvianolic acid B (B) per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g006
Agronomy 14 00252 g007
Figure 7. Influence of PGA on the expression of HGMR (A), DXS2 (B), FPPS (C), GGPPS (D), and CPS (E) in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Figure 7. Influence of PGA on the expression of HGMR (A), DXS2 (B), FPPS (C), GGPPS (D), and CPS (E) in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g007
Agronomy 14 00252 g008
Figure 8. Influence of PGA on the yield of dihydrotanshinone (A), cryptotanshinone (B), tanshinone I (C), and tanshinone ⅡA (D) per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Figure 8. Influence of PGA on the yield of dihydrotanshinone (A), cryptotanshinone (B), tanshinone I (C), and tanshinone ⅡA (D) per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g008
Agronomy 14 00252 g009
Figure 9. Influence of PGA on final yield of main medicinal components per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Figure 9. Influence of PGA on final yield of main medicinal components per plant in S. miltiorrhiza root. Different letters stand for significant difference at p < 0.05.
Agronomy 14 00252 g009
Agronomy 14 00252 g010
Figure 10. Synthetic summary of the influences of PGA on the growth, physiological characteristics, and accumulation of main medicinal components in S. miltiorrhiza.
Figure 10. Synthetic summary of the influences of PGA on the growth, physiological characteristics, and accumulation of main medicinal components in S. miltiorrhiza.
Agronomy 14 00252 g010
Table 1. The indicators measured in June, August, and November.
Table 1. The indicators measured in June, August, and November.
TimeJuneAugustNovember
Growth parametersBasal diameter, plant height, shoot dry weight, root dry weight, root volume, root/shoot ratioBasal diameter, plant height, shoot dry weight, root dry weight, root volume, root/shoot ratioShoot dry weight, root dry weight
Photosynthetic performanceSPAD, Pn, Y(II), Fv/Fm, Fv′/Fm′, qP, NPQ, ETRSPAD, Pn, Y(II), Fv/Fm, Fv′/Fm′, qP, NPQ, ETR—
Water metabolismTr, WUE, Gs, LRWC, SP, SS, ProTr, WUE, Gs, LRWC, SP, SS, Pro—
Antioxidant capacitySOD, POD, CAT, APX, GR, MDA, AsA, GSHSOD, POD, CAT, APX, GR, MDA, AsA, GSH—
Yield of medicinal components——RosA, SalB, Tan I, Tan IIA, DHT, CTS
Expression of genesHMGR, DXS2, FPPS, GGPPS, CPS, RAS10, CYP98A75, CYP98A14HMGR, DXS2, FPPS, GGPPS, CPS, RAS10, CYP98A75, CYP98A14—
Table 2. Primers for real-time quantitative PCR.
Table 2. Primers for real-time quantitative PCR.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)Genbank ID
ActinCTACGAGCTTCCCGATGGACAGCCACCACTGAGGACAATGDQ243702
HGMRAGATCTATGGATATCCGCCGGAGGCGGTGACCTCAGGAGCCAATCTTCGTGEU680958
DXS2AGATCTATGGCGTCGTCTTGTGGAGTTATGGTCACCTTACAAGTTGTTGATGAGATGAAFJ643618
FPPSATGGCGAATCTGAACGGAGATTATTTCTGCCTCTTGTATADQ991431
GGPPSAAGGATCCATGAGATCTATGAATCTGGTCCGAGCTCTTAGTTCTGCCT ATGTGCAAFJ643617
CPSATGGCCTCCTTATCCTCTACTCACGCGACTGGCTCGAAAAGEU003997
RAS10ATGAAGATCGATATCACAGACTCGTCAAATATCATAAAACAACTTCKM575933
CYP98A75ATGGCGCCTCTCGCTCTCCTCCTGTCGACGGCGACACGCTCGTACKP337735
CYP98A14ATGGCAGCTCTCCTCCTCGCCCCCGTCGGTGTCGACAGCAACGCGCTTGTAHQ316179
Table 3. Influences of PGA on SPAD value and net photosynthetic rate of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Table 3. Influences of PGA on SPAD value and net photosynthetic rate of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
TreatmentsSPAD ValueNet Photosynthetic Rate (µmol m−2 s−1)
JuneAugustJuneAugust
Control38.0 ± 1.90 c34.7 ± 1.39 d16.4 ± 0.66 d13.9 ± 0.76 d
T143.6 ± 1.91 b37.9 ± 1.59 c19.0 ± 0.95 c15.7 ± 0.72 c
T251.6 ± 2.32 a45.3 ± 2.04 a24.4 ± 1.10 a21.0 ± 1.11 a
T346.5 ± 2.32 b41.2 ± 1.90 b20.6 ± 0.91 b18.8 ± 0.83 b
Table 4. Influences of PGA on the contents of osmolytes SP, SS, and Pro in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
Table 4. Influences of PGA on the contents of osmolytes SP, SS, and Pro in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
TreatmentsSoluble Protein Content (mg g−1 FW) Soluble Sugar Content (mg g−1 FW) Proline Content (µg g−1 FW)
JuneAugustJuneAugustJuneAugust
Control94.5 ± 4.35 c57.7 ± 2.42 c15.8 ± 0.74 c17.2 ± 0.85 c45.0 ± 1.80 c50.3 ± 2.31 c
T1102.5 ± 5.13 bc62.9 ± 3.21 bc17.8 ± 0.89 b19.0 ± 1.01 c54.5 ± 2.51 b56.0 ± 2.52 b
T2119.9 ± 4.80 a74.7 ± 2.99 a20.9 ± 0.84 a23.7 ± 1.07 a65.2 ± 2.80 a66.8 ± 3.20 a
T3107.3 ± 5.58 b65.9 ± 2.96 b19.0 ± 0.99 ab21.3 ± 0.94 b58.7 ± 2.76 b58.9 ± 2.89 b
Table 5. Influences of PGA on the contents of AsA and GSH in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
Table 5. Influences of PGA on the contents of AsA and GSH in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
TreatmentsAsA Content (µg g−1 FW)GSH Content (µg g−1 FW)
JuneAugustJuneAugust
Control160.0 ± 7.04 d188.4 ± 9.42 d412.4 ± 17.73 c454.9 ± 18.19 d
T1179.5 ± 7.18 c208.4 ± 10.21 c455.9 ± 23.10 b505.5 ± 19.20 c
T2230.0 ± 11.50 a263.6 ± 10.80 a515.7 ± 25.78 a591.7 ± 22.85 a
T3198.9 ± 8.35 b231.5 ± 11.57 b484.3 ± 21.30 ab547.1 ± 21.61 b
Table 6. Influences of PGA on the activities of APX and GR in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
Table 6. Influences of PGA on the activities of APX and GR in S. miltiorrhiza leaves. Different letters stand for significant difference at p < 0.05.
TreatmentsAPX Activity (U g−1 FW)GR Activity (U g−1 FW)
JuneAugustJuneAugust
Control1.80 ± 0.11 d2.24 ± 0.10 d1.35 ± 0.09 d1.57 ± 0.08 d
T11.91 ± 0.10 cd2.46 ± 0.10 c1.55 ± 0.10 c1.76 ± 0.10 c
T22.64 ± 0.12 a3.06 ± 0.15 a2.01 ± 0.10 a2.23 ± 0.13 a
T32.32 ± 0.11 b2.76 ± 0.14 b1.78 ± 0.12 b1.98 ± 0.11 b
Table 7. Influences of PGA on final dry weight of shoot and root of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
Table 7. Influences of PGA on final dry weight of shoot and root of S. miltiorrhiza. Different letters stand for significant difference at p < 0.05.
TreatmentsShoot Dry Weight per Plant (g)Root Dry Weight per Plant (g)
Control12.10 ± 0.70 d18.70 ± 1.12 d
T114.75 ± 0.89 c21.01 ± 1.18 c
T220.01 ± 1.10 a30.49 ± 1.52 a
T317.93 ± 1.04 b25.41 ± 1.21 b
Table 8. Correlation analysis between PGA dosage and final dry weight of shoot and root, and final yield of main medicinal components of S. miltiorrhiza. One asterisk (*) stands for the significant correlation at the level of 0.05 (double-tailed), two asterisk (**) stands for the significant correlation at the level of 0.01 (double-tailed).
Table 8. Correlation analysis between PGA dosage and final dry weight of shoot and root, and final yield of main medicinal components of S. miltiorrhiza. One asterisk (*) stands for the significant correlation at the level of 0.05 (double-tailed), two asterisk (**) stands for the significant correlation at the level of 0.01 (double-tailed).
PGA DosageShoot Dry WeightRoot Dry WeightRosASalBDHTCTSTan ITan II A
PGA dosage1.0000.7340.6120.4630.5100.8920.9450.990 **0.958 *
shoot dry weight0.7341.0000.979 *0.9290.958 *0.956 *0.6100.6500.555
root dry weight0.6120.979 *1.0000.984 *0.979 *0.8820.5200.5280.439
RosA0.4630.9290.984 *1.0000.9770.7830.3840.3740.287
SalB0.5100.958 *0.979 *0.977 *1.0000.8390.3660.4050.295
DHT0.8920.956 *0.8820.7830.8391.0000.7620.8260.742
CTS0.9450.6100.5200.3840.3660.7621.0000.975 *0.989 *
Tan I0.990 *0.6500.5280.3740.4050.8260.975 *1.0000.989 *
Tan II A0.958 *0.5550.4390.2870.2950.7420.989 *0.989 *1.000
Table 9. Regression analysis between PGA dosage and final dry weight of shoot and root, and final yield of main medicinal components of S. miltiorrhiza.
Table 9. Regression analysis between PGA dosage and final dry weight of shoot and root, and final yield of main medicinal components of S. miltiorrhiza.
Variable YVariable XRegression EquationDegree of Fit
shoot dry weightPGA dosageY = −2100.4X2 + 259.53X + 11.543R2 = 0.8958
root dry weightY = −3287.5X2 + 384.37X + 17.458R2 = 0.7674
RosAY = −24011X2 + 2620.1X + 54.057R2 = 0.6748
SalBY = −39378X2 + 4276.3X + 48.622R2 = 0.8542
DHTY = −3171X2 + 461.81X + 21.89R2 = 0.9816
CTSY = 967.04X + 164.63R2 = 0.8934
Tan IY = 235.43X + 17.166R2 = 0.9806
Tan ⅡAY = 1161.9X + 102.22R2 = 0.9181
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shan, C.; Zhang, X.; Luo, Y.; Yang, D. Poly-Glutamic Acid Promotes the Growth and the Accumulation of Main Medicinal Components in Salvia miltiorrhiza. Agronomy 2024, 14, 252. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy14020252

AMA Style

Shan C, Zhang X, Luo Y, Yang D. Poly-Glutamic Acid Promotes the Growth and the Accumulation of Main Medicinal Components in Salvia miltiorrhiza. Agronomy. 2024; 14(2):252. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy14020252

Chicago/Turabian Style

Shan, Changjuan, Xiaoqing Zhang, Yi Luo, and Dongfeng Yang. 2024. "Poly-Glutamic Acid Promotes the Growth and the Accumulation of Main Medicinal Components in Salvia miltiorrhiza" Agronomy 14, no. 2: 252. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy14020252

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop