Next Article in Journal
Vulpinic Acid Controls Stem Cell Fate toward Osteogenesis and Adipogenesis
Previous Article in Journal
Genome-Wide Analyses and Prediction of Resistance to MLN in Large Tropical Maize Germplasm
Previous Article in Special Issue
MicroRNAs in Vitis vinifera cv. Chardonnay Are Differentially Expressed in Response to Diaporthe Species
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Appropriate Reference Genes for Normalizing miRNA Expression in Citrus Infected by Xanthomonas citri subsp. citri

1
College of Horticulture, Fujian Agriculture and Forestry University, Fuijan 350002, China
2
Department of Environmental Horticulture and Mid-Florida Research and Education Center, Institute of Food and Agricultural Sciences, University of Florida, Apopka, FL 32703, USA
3
College of Horticulture, Nanjing Agriculture University, Nanjing 210095, China
4
College of Crop Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Authors to whom correspondence should be addressed.
Submission received: 14 November 2019 / Revised: 13 December 2019 / Accepted: 16 December 2019 / Published: 23 December 2019
(This article belongs to the Special Issue Plant miRNA Mediated Defense Response)

Abstract

:
MicroRNAs (miRNAs) are short noncoding RNA molecules that regulate gene expression at the posttranscriptional level. Reverse transcription-quantitative PCR (RT-qPCR) is one of the most common methods used for quantification of miRNA expression, and the levels of expression are normalized by comparing with reference genes. Thus, the selection of reference genes is critically important for accurate quantification. The present study was intended to identify appropriate miRNA reference genes for normalizing the level of miRNA expression in Citrus sinensis L. Osbeck and Citrus reticulata Blanco infected by Xanthomonas citri subsp. citri, which caused citrus canker disease. Five algorithms (Delta Ct, geNorm, NormFinder, BestKeeper and RefFinder) were used for screening reference genes, and two quantification approaches, poly(A) extension RT-qPCR and stem-loop RT-qPCR, were used to determine the most appropriate method for detecting expression patterns of miRNA. An overall comprehensive ranking output derived from the multi-algorithms showed that poly(A)-tailed miR162-3p/miR472 were the best reference gene combination for miRNA RT-qPCR normalization in citrus canker research. Candidate reference gene expression profiles determined by poly(A) RT-qPCR were more consistent in the two citrus species. To the best of our knowledge, this is the first systematic comparison of two miRNA quantification methods for evaluating reference genes. These results highlight the importance of rigorously assessing candidate reference genes and clarify some contradictory results in miRNA research on citrus.

1. Introduction

Citrus is one of the most important fruit crops due to its high nutritional and economic value. Citrus crops are cultivated in a wide range of regions with a total fruit production over 130 million tons in 2015, ranking first in quantity in world fruit production (FAO, 2017). Citrus production, however, has encountered several serious diseases, including citrus canker and Huanglongbing [1]. Citrus canker is caused by X. citri subsp. citri (Xcc) with symptoms of water-soaked eruptions, circular lesions, and pustule-like lesions on all plant tissues, resulting in heavy economic losses [2,3].
Research into citrus canker has been focused on the screening of genetic resources for disease resistance [4,5], transcriptomic analysis of plant responses to pathogen infection [6,7,8], induced resistance for disease control [3], and genome editing of specific genes [9]. Plant defense response is comprised of complex molecular networks regulating gene expression at both transcriptional and posttranscriptional levels [10]. MicroRNAs (miRNAs) are a class of non-coding small RNA (sRNA) of unequal lengths ranging from 20 to 25 nt, that have emerged as ubiquitous posttranscriptional regulatory molecules and participate in extremely important biological functions in both plants and animals [11,12].
In plants, miRNAs are known to regulate plant–pathogen interaction by sRNA-mediated gene silencing pathways [13]. Thus far, no mechanistic analysis has been conducted on posttranscriptional regulation of citrus under Xcc challenge. miRNA microarray and sRNA sequencing have been used to investigate miRNA-profiling [14]. High-throughput sRNA sequencing and microarray data from a large number of disease samples provide important information on miRNA expression [15,16,17]. To determine the expression level of mature miRNAs of interest, the reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is commonly employed for the quantification due to its high sensitivity, good reproducibility and superior operability [18]. The level of the expression is normalized by comparing with reference genes [15,18]. Therefore, the selection of reference genes is critically important for the accuracy. Candidate reference genes could be selected from the output of high-throughput sRNA sequencing. These candidate genes were further evaluated by RT-qPCR for their stability, and those with least variability are chosen for miRNA analysis [19,20,21].
The earliest experiment on quantifying target gene expression using RT-qPCR in citrus was performed in 2010. Analysis through geNorm and NormFinder indicated that EF1a and ADP were the most stable reference genes in “Swingle” citrumelo under drought stress [22]. Two other genes FBOX and GAPDH were considered to be appropriate reference genes in citrus genotypes infected by five pathogens (Alternaria alternata, Phytophthora parasitica, Xylella fastidiosa, and Candidatus Liberibacter asiaticus) [23]. For determining gene expression in different organs and tissues, CitUBQ14, CitUBL5, and CitGAPDH appeared to be stably expressed in citrus [24,25]. These reference genes are valuable for RT-qPCR analysis in citrus research. However, they are protein-coding housekeeping genes and may not be appropriate for the analysis of miRNA expression [21]. Firstly, the population of miRNA is much smaller than that of mRNA, with the numbers of expressed molecules in the hundreds rather than tens of thousands, and thus more susceptible to distortion from trends [21]. Secondly, miRNAs are largely posttranscriptionally regulated, and therefore their mature expression may not behave with a high degree of independence from many of their fellow miRNAs [26,27]. Moreover, increasing evidence suggests that global shifts in miRNA expression can be caused by physiological and pathological reasons or by induction [21]. These characteristics make the normalization of miRNA expression significantly different from that of mRNA expression. Therefore, research into the identification of appropriate reference genes for quantifying miRNA expression becomes increasingly important.
Conventional PCR analysis is not suitable for short RNA targets averaging 22 nt in length, because mismatch from closely related miRNAs, precursors and genomic sequences exert an effect on the accuracy due to the low specificity and sensitivity. Currently, two complementary DNA (cDNA) synthesis methods for miRNA quantitative analysis (stem–loop reverse transcription and poly-A tail extension) have been used for compensating these deficiencies [28,29]. Stem–loop RT requires that the primer contains a self-complimentary sequence and a designed overhang. This overhang binds to the 3’ portion of the mature miRNA sequence and can be reverse transcribed with MMLV reverse transcriptase. The mature miRNA sequence will degrade by denaturation, resulting in a complimentary copy of the miRNA forms the template [26]. Poly A tail extension was very close to conventional Oligo(dt) primed reverse transcription reaction, where total RNAs, including mature miRNAs, undergo polyadenylation by using Escherichia coli poly(A) polymerase. Poly(A)-tailed miRNA can be converted into cDNA along with mRNAs in a reverse transcription reaction primed by a standard poly(T) anchor adaptor and MMLV reverse transcriptase [29].
Several studies have recently been performed for identifying appropriate reference genes for miRNA qPCR, of which the stem–loop method has been used more frequently. A set of miRNAs was selected for evaluation in plants, such as castor bean, cotton, watermelon, wheat and sugarcane [30,31,32,33]. Luo et al., 2014, found miR5059 and miR5072 were the best reference genes in different peach tissues under different abiotic stress treatments using poly(A)-tailed RT-qPCR approach [34]. In Arabidopsis, stress-induced miRNAs were cloned by sequencing and the computational method [35,36]. Due to their extremely high expression, U6 snRNA and 5S rRNA/tRNA were used as reference genes to detect the expression of Arabidopsis miRNAs in blot assays [37]. tRNA and 5S rRNA were also applied to monocotyledon plants [38]. More novel stress-responsive miRNAs were reported in Populus trichocarpa [39], which are absent in Arabidopsis. The 5.8S rRNA was selected as a reference gene to quantify miRNAs by using stem–loop real time PCR [39]. Additionally, actin as a protein-coding gene, is widely used in RT-qPCR due to its stable and high expression in different cells. A wheat actin gene was selected to normalize the quantity of templates added in the PCR reactions for analyzing the expression of novel miRNAs using semi-quantitative RT-PCR [40]. Actin was also used as an endogenous control gene to normalize the expression of miRNAs in C. sinensis [41,42,43,44] and in tomato after inoculation with Phytophthora infestans [45]. Other stably expressed protein-coding genes, such as GAPDH or EF-1a, are also used as internal standards in miRNA quantitative studies [46,47]. Due to the specific characteristics of miRNA mentioned above, the use of protein-coding genes as references for normalizing miRNA expression could be questionable.
To our knowledge, there has been no study on the identification of appropriate reference genes for quantifying miRNA expression using poly(A) extension RT-qPCR and stem-loop RT-qPCR in plants. This study was intended to address this issue using C. sinensis (L.) Osbeck and Citrus reticulata Blanco infected with the citrus canker pathogen. To normalize citrus miRNA expression, we first evaluated the expression stability of 20 candidate reference genes including common protein-coding genes. We then used the stem–loop method and poly(A)-tail extension to evaluate the expression variation of candidate miRNA in two citrus species under Xcc treatments. Our results showed that candidate reference gene expression profiles determined by poly(A) RT-qPCR were more consistent in the two citrus species.

2. Materials and Methods

2.1. Plant Materials, Growth Conditions, and Bacterial Inoculation

Two citrus species differing in the susceptibility to Xcc were used in this study. Sweet orange, C. sinensis, is moderately susceptible, whereas Ponkan mandarin, C. reticulata, is moderately resistant [48]. Seeds of sweet oranges ‘Xuegan’ and Ponkan mandarin were collected from Fuzhou, Fujian, China. After sprouting, they were planted in black plastic pots (12 × 12 cm) filled with a substrate comprised of 50% peat, 20% pine bark, 20% perlite and 10% coarse sand. Seedlings were placed in a greenhouse at 30/25 °C (day/night) and 70% of relative humidity under natural light.
Xcc was cultured in the NB (nutrient broth) medium with 1.5% agar at 28 °C. Bacterial cells were suspended in sterile water. The suspension at 1 × 105 cfu mL−1 was syringe-infiltrated into the young leaves of four plants per species. Injection of sterile water to four plants of respective species was a control treatment. Leaf discs were taken from each plant on days 0, 1, 2 and 4 post-infiltration, frozen in liquid N2, and stored at −80 °C until RNA extraction. Thus, there were four biological samples (replicates) per species on a given day.

2.2. RNA Isolation and Complementary DNA Synthesis

Total RNA was extracted from collected discs taken on days 0, 1, 2 and 4, respectively, using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the instruction from the manufacturer. RNA concentrations and ratios of absorbance at 260 nm to that at 280 nm (260/280) or 230 nm (260/230) were determined using a Nanodrop 1000 spectrophotometer (Thermo, Wilmington, DE, USA).
For the use of the poly-A tail method, each polyadenylation and reverse transcription reaction was performed with 1 μg of total RNA in a final volume of 10 μL using a Mir-X™ miRNA First Strand Synthesis kit (Takara/clontech, Mountain View, CA, USA) where there were 5 μL mRQ Buffer (2×) and 1.25 μL mRQ Enzyme. The reaction tubes were incubated in a thermocycler for 1 h at 37 °C and terminated at 85 °C for 5 min to inactivate the enzymes.
For the stem–loop reverse transcription method, the experimental RNA (up to 1 μg), 1 μL (1 μM) stem–loop specific primer (Table S1), and 1 μL (50 μM) Oligo(dT) 15 primer (Promega, Madison, WI, USA) were mixed in nuclease-free water for a final volume of 5 μL per RT reaction and incubated at 70 °C for 5 min followed by ice-cooling. cDNA synthesis was carried out using Improm-II reverse transcription system according to the manufacturer’s instruction (Promega). Briefly, the reaction thermal profile was set with an initial temperature of 16 °C for 30 min followed by 60 cycles of 30 °C for 30 s, 42 °C for 30 s and 50 °C for 1 s. After 60 cycles, the reaction was terminated by incubating the samples at 85 °C for 5 min [28].

2.3. Selection of Candidate Reference Genes and Primer Design

Our previous study identified the transcription levels of conserved miRNAs from sweet orange and Ponkan mandarin infected with Xcc using the high-throughput sequencing. NEB Next Ultra small RNA Sample Library Prep Kit for Illumina (New England, NEB, USA) was employed for generating all 12 sequencing libraries. The Illumina HiSeq2500 platform was used to sequence the library, thereby generating a total of 260,117,346 raw reads. The transcription levels of 20 conserved miRNAs (including published reliable references miR171 [32], miR166b [31], miR159a [49], miR396a [50] and miR166b [51] were obtained and analyzed. Eight putative reference RNA targets (miR472, miR428b, miR396a, miR166b, miR3954, miR160, miR162-3p and miR403) with a median expression and the smallest standard deviations were selected from high-throughput sequencing data for identifying the most suitable normalizer for miRNA qPCR in citrus infected by Xcc.
For the stem–loop method, the primers (Table S1) for miRNAs cDNA synthesis and forward miRNA primers for qPCR were designed according to the report of Chen et al. (2005) [28] or by using the online tool (http://150.216.56.64/miRNAprimerDesigner.php). Universal reverse primer (Table 1) was also based on the report of Chen et al. (2005) [28]. For Poly-A tail primer design, miRNA specific 5’ primer was used as the entire sequence of mature miRNA (21–23 nt). The 3’ primer for qPCR was the mRQ 3’ Primer supplied with the Mir-X™ miRNA First-Strand Synthesis kit.
Non-coding RNA (U4, U5, U6 and snoR14) primers (Table 1) were obtained from previous research [52]. Eight protein-coding traditional reference genes (ACTIN1, ACTIN2, UBC28, TUA5, EF1α, TUB4, GAPDH and PP2A) reported to be good potential candidates in previously published studies [53,54,55,56] also included in this study. The sequences of citrus protein-coding traditional candidate reference genes and genes coding for the CsLOB1 transcription factor were extracted from citrus genome data (http://citrus.hzau.edu.cn/orange/index.php). Primer design was made according to a standard set of design criteria (e.g., primer Tm, length and GC content), which generated a unique, short PCR product of the expected length and sequence [57].

2.4. Reverse Transcription-Quantitative PCR Analysis

The reaction mixture with a total volume of 20 μL contained 2 μL diluted cDNA, 0.4 μL of each 10 μM primer, 7.2 μL ddH2O and 10 μL SYBR Advantage Premix (Takara). Four biological replicates for each sample together with two technical replicates for each well were performed. The RT-qPCR conditions were as follows: denaturation at 95 °C for 10 s, followed by 40 cycles of denaturation at 95 °C for 5 s, and annealing at 60 °C for 30 s in CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). After amplification, a melting curve analysis (60–95 °C with at increments of 0.5 °C) was generated for each reaction to verify the specific amplification.

2.5. Data Analysis

A serial of 5-fold dilutions of cDNA (5×, 25×, 125×, 625× and 3125×) from sweet orange pooled samples were used to create standard curves. The amplification efficiencies (E%) and the correlation coefficient (r) for all primer pairs were determined by RT-qPCR standard curve assays. The PCR efficiency was calculated with following the formula E = 10−1/slope −1. All reference gene’s stability was evaluated using free algorithms: the Delta-Ct method [58], geNorm [59], NormFinder [60] and BestKeeper [61]. The comprehensive stability analysis was performed by a web-based tool RefFinder (http://150.216.56.64/index.php) [62].
The four common statistical approaches (Delta-Ct method, geNorm, NormFinder and BestKeeper) might yield contradictory results from the same data. However, RefFinder could make comprehensive stability ranking of candidate genes according to the results from these softwares. Eight miRNA genes were analyzed in a comparative way to determine the most reliable normalizer, data from stem-loop RT and poly(A) extension were imported to RefFinder individually. To evaluate the potentiality of these candidate genes as miRNA reference gene, we also analyzed their expressional stability by combining data from protein coding RNA.

2.6. Reference Gene Validation

A citrus canker-induced gene Lateral Organ Boundaries (CsLOB1) was analyzed in C. sinensis by RT-qPCR [63], CsLOB1 primers was designed according to the previously mentioned methods, and the same conditions and criteria as for the reference genes were used in CsLOB1. To calculate the relative fold changes in the gene expression of sweet orange leaves after Xcc inoculation, the relative expression of the target was calculated using the comparative 2−ΔΔCt method and normalized to the selected reference genes.

3. Results

3.1. Verification of Primer Efficiency for the Candidate Reference Genes

The correlation coefficient (r) represents whether the plotted data points fit the regression line generated by the standard curve. As a good linear performance, r should be more than 0.99. In this study, r of the standard curve ranged from 0.9730 to 0.9998 (Table 1). The amplification efficiency (E) refers to amplification rate of a template during the reaction. The theoretically ideal E value is 100% indicating that the target cDNA template duplicates exponentially in every PCR cycle [64]. The amplification efficiency of the stem–loop primers varied from 86.8% to 104.7%, and the poly(A)-based reaction E value ranged from 91.5% to 103.6% (Table 1). In practical terms, primer efficiency between 90% and 110% was thought to be acceptable for qPCR experiments [65]; thus, all the primer pairs were deemed sufficiently designed. All of the non-coding RNAs showed low amplification efficiency, which was not fit for qPCR experiment.

3.2. Ct Value Distribution of Candidate Reference Genes

The cycle threshold (Ct) values of most genes ranged from 15 to 30, the non-coding RNA (U4, U5 and U6) showed relatively high expression levels in both sweet orange and Ponkan, with the Ct values lower than 15 (Figure 1). St-miR160 had a highest Ct value of 36.87, which was not recommended (15 ≤ Ct ≤ 30) for a RT-qPCR [66]. St-miR472 showed the narrowest Ct ranges (21.61 to 23.75) in sweet orange (Figure 1A), whereas the non-coding RNA gene U5 was the most variable one. Moreover, the Ct value of the stem–loop primer was more variable than poly(A) extension microRNA in all the tested samples. The variability represents a difference between max Ct and min Ct. St-miR162-3p and St-miR403 showed high variability in sweet orange, with their Ct values ranging from 25.83 to 31.31 and 21.61 to 26.97, respectively (Figure 1A). Similarly, St-miR160 showed the highest Ct value in Ponkan (Figure 1B), while Ct variance of miR162-3p and miR472 was minimal. In Ponkan plants where the Ct value ranged from 15 to 20, the expression was relatively stable.

3.3. Reference Gene Stability Analyzed by geNorm, NormFinder, BestKeeper, Delta-Ct Method, and Refinder

To analyze the expression stability of candidate reference genes during different infection stages of citrus leaves, four statistical algorithms (Delta-Ct method, BestKeeper, NormFinder, and geNorm) and a web-based tool (RefFinder) were used to rank the stability of 28 reference genes including 8 miRNA genes reverse transcribed by stem-loop method (Table 2).
All the Ct raw data were directly input to the program BestKeeper. The Ct value of genes with standard deviation (SD) < 1 was considered to be stable enough or SD (± x-fold) < 2 was also a statistical parameter to determine the reference genes. A matrix of pairwise comparisons and r calculation was performed using BestKeeper. Genes with higher expression stability should have a r closer to 1. Based on the BestKeeper analysis, U5, TUA5, GAPDH and st-miR162-3p could not pass the filter with SD values of 1.44, 1.17, 1.74 and 1.12, respectively, which were much higher than 1 in sweet orange (Table 3). On the other hand, st-miR472 and miR160 (SD: 0.42 and 0.48) were confirmed to be the most stably expressed. Meanwhile, the BestKeeper calculation also provided two best reference genes miR162-3p and miR472 with low SD values (0.25 and 0.26). GAPDH was the least stably-expressed gene for the two citrus species with r values over 25 (Table 3 and Table 4).
The geNorm is a popular algorithm to determine the most stable reference genes from a set of tested candidate reference genes in a given sample panel. We identified miR166b, UBC28, miR472 and miR162-3p as the most stable genes in sweet orange according to the average expression stability value M using geNorm software (Figure 2A). In geNorm, the lower M value represents the higher stability. It is noteworthy to note that all the reference genes in sweet orange were deemed unstable under citrus canker infection according to the commonly proposed cutoff value of M ≤ 0.5. Using a M threshold value of ≤ 0.5, miR472, miR162-3p, miR427b, miR403 and miR160 had the lower M value (0.2790, 0.2790, 0.3930, 0.4450 and 0.4720, respectively) indicating these genes were the most stably expressed genes in Ponkan under canker infection (Figure 2B). The protein coding gene GAPDH was the least stably expressed gene in two citrus species.
Additionally, geNorm is also based on a pairwise comparison model to determine the optimal number of reference genes for accurate data normalization. Average pairwise variation Vn/n + 1 with a cut-off score of 0.15 determined the minimum number of genes necessary for data normalization, below which the inclusion of an additional reference gene had no significant contribution to the normalization. For reference genes expression in sweet orange, the analysis revealed that the V3/4 value was 0.168, the normalization factor should preferably contain at least the four best reference genes. While the V4/5 value was 0.126 (Figure 3A), the fifth additional gene was not necessarily needed to normalize the expression, which confirmed the geNorm results. In all of the Ponkan sample sets, the V2/3 value was considerably smaller than the default threshold value of 0.15, suggesting that the two most stable reference genes were miR162-3p and miR472, which should be appropriate for normalization (Figure 3B).
We further used NormFinder for identifying appropriate reference genes. NormFinder is a Visual Basic Application for Excel. Like geNorm, the software calculates the expression stability value (M) for all candidate genes. Using an analysis of variance (ANOVA)-based comparison model, NormFinder can estimate the variation of the intra- and inter-group. Based on these two statistical methods, the lowest M always suggests the most reliable pair of reference genes. In the sweet orange sample set, the NormFinder analysis revealed that the most stably expressed genes were miR162-3p and miR472, followed by miR160 (Figure 4A). Furthermore, the analysis indicated GAPDH as the least stably expressed gene. The algorithm also selected an optimal pair of reference genes in Ponkan, and the most stable ones were miR403 and miR428b with an M value of 0.28 and 0.45 (Figure 4B).
To obtain the most suitable reference genes, we evaluated the candidates by the Delta Ct method. This approach was employed by comparing the mean difference of ‘gene pairs’ and the variation in Ct values within each sample. The ranking of the reference genes from this method was similar to that obtained by the NormFinder algorithm. Delta Ct method analysis found that miR162-3p and miR472 had lowest StdDev, followed by miR160 which suggested that miR162-3p and miR472 were two top-ranked, stable reference genes among all of the studied genes in sweet orange (Figure 5A), which also confirmed the results from NormFinder analysis. For Ponkan (Figure 5B), miR403 followed by miR482b and miR162-3p, were found to be the most stably expressed genes with low StdDev (0.09, 1.04 and 1.04 respectively).
RefFinder is a web-based tool integrating the above four computational statistical approaches to produce a comprehensive evaluation based on the geometric mean for each candidate gene. In the end, all untransformed raw data values were imported to RefFinder, then the software output ranks reference genes according to the expression of reliability. When the stabilities from all the samples were combined, the output results agreed with the results of NormFinder software and Delta Ct methods. An overall comprehensive ranking output revealed that miR162-3p (Figure 6A), followed by miR472, miR160 and miR166b (Geomean: 2.3, 2.78, 3.08, and 3.74, respectively) were the most stably expressed genes in canker-infected sweet orange, while U5 and GAPDH were the least stably expressed. The RefFinder algorithm showed that miR162-3p and miR403 constitute the best combination of two genes with comprehensive ranking values of 1.86 and 2.21 in all of the Ponkan samples (Figure 6B). Again, U5 and GAPDH were ranked as among the least stably expressed genes, which had the highest Geomean.
The top three most stable genes were miR162-3p, miR160 and miR472 for the poly(A) extension method in sweet orange samples (Table 5). For the stem–loop method, st-miR396a, st-miR162-3p and st-miR166b were ranked as among the most stable genes, while st-miR3954 was the least stable genes under stress conditions. According to RefFinder, the comprehensive ranking poly(A) tail miRNA from the most stable to the least stable gene for Ponkan samples was as follows: miR160 > miR162-3p > miR472 > miR403 > miR428b > miR166b > miR396a > miR3954. While the comprehensive ranking of stem-loop miRNA for Ponkan samples was as follows: st-miR403 > st-miR162-3p > st-miR166b > st-miR160 > st-miR428b > st-miR396a > st-miR3954.
Taken together, UBC28, PP2A and EF1a were identified to be the most stable protein coding reference genes in all sweet orange samples. The protein coding reference genes for accurate transcript normalization in Ponkan were similar to those of sweet orange.

3.4. Validation of Candidate Reference Genes

To confirm the stability of the best ranked candidate reference genes, the expression pattern of CsLOB1 was examined in response to Xcc. The results clearly indicated that CsLOB1 was significantly upregulated after Xcc infection using the combination of miR162-3p/miR472 for normalization (Figure 7A). Correspondingly, there was little difference in mock at each sampling day. However, when the poor reference gene GAPDH was used as an internal control, the expression of CsLOB1 showed a slight fluctuation in mock, but the expression differences between treatment and mock were significantly reduced (Figure 7B).

4. Discussion

A large body of evidence has shown that miRNA-mediated posttranscriptional regulation plays a fundamental role in plant responses to stressful factors, including pathogen infection, salt, drought, heat, cold, nutrient deficiency and metal toxicity [81,82,83,84,85,86]. A great deal of effort has been focused on the identification and functional analysis of plant miRNAs in response to the infection of pathogens, such as viruses [87,88,89], bacteria [16,90,91,92] and fungi [13,93,94], which have provided valuable information as to the role miRNAs play in plant–pathogen interactions [95,96].
Northern blot, microarray and high-throughput sequencing have been used to analyze miRNA expression. However, RT-qPCR is still the most commonly used method. In RT-qPCR analysis, reference genes play a vital role in quantifying the expression level of target genes. Even a slight change in miRNA expression may affect targeting mRNAs for cleavage or repressing translation [96]. Improper reference genes may lead to inaccuracy or false results and incorrect conclusions [97,98]. Recently, there is an increased reporting on the evaluation of plant reference genes under different conditions [30,50,99,100]. However, limited information is available on miRNA reference genes in phytopathogenic research. Several studies showed miRNA in citrus plants [44,45,85], but there is no report on appropriate reference genes for normalizing miRNA expression in citrus canker-infected plants.
The present study identified appropriate reference genes for quantifying miRNA expression in two citrus species infected by Xcc. To achieve reliable results without bias, we selected 28 likely reference genes, including protein-coding RNA and non-coding RNA, and evaluated their expression levels using two different methods in the two citrus species, differing in resistance to Xcc. We then analyzed the performance of the reference genes by five methods and identified appropriate reference genes for each species. miR162-3p, miR160 and miR472 performed best as reference genes for sweet orange plants infected by Xcc, and miR160, miR162-3p and miR472 were the most stable genes for Ponkan attached by the same pathogen. To further confirm the reference genes, we used LOB as the target gene from sweet orange to verify their accuracy. Among the three reference genes, miR160 is known to mediate the interaction between auxin and cytokinin by suppressing the levels of ARF transcription factors, which plays a critical role in various aspects of plant development [101,102,103]. DICER-LIKE 1 (DCL1) is the main enzyme processing miRNA precursors into mature miRNAs and incorporated into the AGO1-RISC, which is considered indispensable for plant development [104]. Meanwhile, miR162 maintains a proper level of DCL1 transcripts by targeting DCL1 mRNA for a negative feedback regulation [104,105,106].
A single reference gene has been commonly used to normalize RT-qPCR results [107]. However, accumulating evidence has suggested that a single reference gene tends to show higher expression variability due to different biological factors [108]. Conversely, the use of multiple reference genes improved RT-qPCR statistical veracity [60,108]. In this study, geNorm software suggested that three reference genes are needed for a more accurate normalization for sweet orange infected by Xcc. As for Ponkan, two reference genes are found to be sufficient for accurately quantifying target gene expression levels (Figure 3). Ponkan is a canker-resistant genotype and showed minor physiological changes and metabolic disorders than the susceptible sweet orange plant used in this study. All Ponkan samples remained relatively stable during Xcc infection processes at different infection stages. Consequently, Ponkan required fewer reference genes for normalizing qPCR results. Nevertheless, our results documented that the use of miR162-3p, miR160 and miR472 should accurately normalize the expression levels of the target gene in both sweet orange and Ponkan during Xcc infection.
GAPDH was considered to be a stable reference gene for qPCR normalization in different plants. GAPDH encodes key enzymes catalyzing the conversion of glyceraldehyde-3-phosphate to 1,3-biphosphoglycerate in the presence of NAD+ and inorganic phosphate in the glycolytic pathway [109,110,111]. Wu et al. (2014) suggested that GAPDH was the most reliable reference gene in navel orange (C. sinensis L. Osbeck) fruit during five different ripening stages [25]. In contrast, our results indicated that GAPDH was unstable, and was not an ideal reference gene for gene expression analyses, which was consistent with the reports of the others [112,113,114,115,116], that GAPDH was an unstably expressed gene in different varieties of oranges under different conditions. In another study, a total of 22 GAPDH genes were identified in wheat. Members of this family were found to notably respond to abiotic stresses [117]. In other words, some of these GAPDHs may participate in multiple functions except for metabolism roles in plants, such as involving abiotic stress resistance. Thus, caution is needed to use the GAPDH gene as a reference gene in RT-qPCR analysis.
CsLOB1 is transcription factor in the family of the Lateral Organ Boundaries Domain gene. All strains of Xcc can encode transcription activator-like (TAL) effectors which bind to effector binding elements in the promoter of CsLOB1 and induce the expression of disease susceptibility genes [63]. In this study, the identified reference genes (miR162-3p and miR472) showed highly reliable for normalizing CsLOB1. The expression profile of CsLOB1 was consistent with two suitable reference gene normalizations, which was also in agreement with the study of Hu [63]. When GAPDH was used as an internal control, CsLOB1 had no significant change in 24h, and mock showed fluctuating patterns of expression (Figure 7). These inaccurate results indicated that GAPDH would be unreliable for RT-qPCR analysis in the citrus bacterial canker response.
Analyzing miRNA expression profiles has inherent difficulties including (1) short nucleotide (18–24 nt); (2) heterogeneous GC content; (3) no sequence feature [e.g., poly(A)]; (4) target sequence interference; and (5) highly homologous within family [18]. Thus, poly(A) extension RT-qPCR and stem–loop RT-qPCR have been used for analyzing miRNA expression. In the stem–loop RT-qPCR, the reverse transcription of individual mature miRNAs uses a specific stem–loop primer. Due to the use of miRNA-specific primers, this approach is highly specific, thus effectively reducing background noise. This method, however, is time consuming and labor intensive. In the poly(A) extension RT-qPCR, miRNAs are first tailed by E. coli Poly(A) Polymerase and then reverse transcribed by oligo(dT) with a universal primer-binding sequence. This method is a universal reverse transcription, the product of the reaction contains cDNA from non-coding RNA (miRNA) and mRNA with a universal anchor primer. Compared to stem–loop RT, the Poly(A) extension method can analyze the transcript level of miRNA, miRNA target genes and other related genes with the same background. In the present study, we evaluated the two methods by comparing reference genes’ stability in different citrus samples through two miRNA quantification methods. Our results showed that the average Ct value of poly-A tail qPCR was lower than the stem–loop RT method.
Moreover, the efficiency of PCR amplification for the stem–loop primer was lower than the poly-A tail, and some of them were even below 90%. Accordingly, the poly-A tail qPCR has higher amplification efficiency and better sensitivity than the stem–loop RT-qPCR. In forensic casework, poly-A tail extension also exhibited apparently more amplification than stem–loop RT for a body fluid identification of miR-451 and miR-205 [118]. In addition, different statistical algorithms revealed that the rank of the stability of the reference genes was in the following order: Poly(A) extension microRNA > stem-loop microRNA > protein coding RNA > non-coding RNA. In the present study, the poly(A) extension method achieved consistent results in two citrus species. Conversely, the top three stable stem–loop microRNAs were different in sweet orange and Ponkan, except st-miR162-3p. A study of Triticum dicoccoides showed that the results of stem–loop RT-qPCR were only partially consistent with data obtained from sequencing or microarray [119]. Similar results have been reported in Triticum aestivum L., where five miRNA genes in different wheat tissues were analyzed by two miRNA qPCR approaches, as well as deep sequencing. The deep sequencing results had higher correlation coefficients with results obtained from poly(A) RT-qPCR, but not with the results derived from stem–loop RT-qPCR [50].

5. Conclusions

The selection of reference genes is critically important for the accurate quantification of target gene expression in RT-qPCR analysis. To identify appropriate miRNA reference genes for normalizing the level of miRNA expression in C. sinensis and C. reticulata infected with a citrus canker pathogen, five algorithms: Delta Ct, geNorm, NormFinder, BestKeeper and RefFinder were used for screening reference genes. Poly(A) extension RT-qPCR and stem–loop RT-qPCR were performed to determine the most appropriate method for detecting expression patterns of miRNA. Our results showed that poly(A) RT-qPCR is a more reliable method than stem–loop RT-qPCR, and miR162-3p and miR472 genes in poly(A) RT-qPCR are the most stable internal control genes for miRNA profiling analysis of citrus infected by Xcc.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2073-4425/11/1/17/s1, Table S1: Primer sequences used in stem-loop reverse transcription.

Author Contributions

Conceptualization, D.P. and J.C.; methodology, D.P. and J.C.; formal analysis, W.C.; investigation, S.L. and Y.Y.; resources, S.X. and G.C.; writing—original draft preparation, S.L. and J.C.; writing—review and editing, S.L. and J.C.; project administration, W.S. All authors have read and agreed to the published version of the manuscript.

Funding

The authors would like to thank Agricultural “Five New” Project, demonstration and promotion of key technologies for promoting ecological quality and high efficiency production (Fujian Development and Reform Commission, 2018) for supporting this study.

Acknowledgments

The authors express their great appreciation to Terri A. Mellich at the University of Florida for critical review of this manuscript.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Jia, H.; Zhang, Y.; Orbovic, V.; Xu, J.; White, F.F.; Jones, J.B.; Wang, N. Genome editing of the disease susceptibility gene cslob1 in citrus confers resistance to citrus canker. Plant Biotechnol. J. 2017, 15, 817–823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Gottwald, T.R.; Graham, J.H.; Schubert, T.S. Citrus canker: The pathogen and its impact. Plant Health Prog. 2002. [Google Scholar] [CrossRef] [Green Version]
  3. Riera, N.; Wang, H.; Li, Y.; Li, J.; Pelz-Stelinski, K.; Wang, N. Induced systemic resistance against citrus canker disease by rhizobacteria. Phytopathology 2018, 108, 1038–1045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Deng, Z.N.; Xu, L.; Li, D.Z.; Long, G.Y.; Liu, L.P.; Fang, F.; Shu, G.P. Screening citrus genotypes for resistance to canker disease (Xanthomonas axonopodis pv. citri). Plant Breed. 2009, 129, 341–345. [Google Scholar] [CrossRef]
  5. Pavan, A.; Calixto, M.C.; Cardoso, S.C.; Mendes, B.M.J.; Filho, A.B.; Lopes, J.R.S.; Carvalho, C.R.D.; Filho, F.D.A.A.M. Evaluation of ‘hamlin’ sweet orange + ‘montenegrina’ mandarin somatic hybrid for tolerance to Xanthomonas axonopodis pv. citri and Xylella fastidiosa. Sci. Hortic. 2007, 113, 278–285. [Google Scholar] [CrossRef]
  6. Cernadas, R.A.; Camillo, L.R.; Benedetti, C.E. Transcriptional analysis of the sweet orange interaction with the citrus canker pathogens Xanthomonas axonopodis pv. citri and Xanthomonas axonopodis pv. Aurantifolii. Mol. Plant Pathol. 2008, 9, 609–631. [Google Scholar] [CrossRef]
  7. Hu, Y.; Duan, S.; Zhang, Y.; Shantharaj, D.; Jones, J.B.; Wang, N. Temporal transcription profiling of sweet orange in response to ptha4-mediated Xanthomonas citri subsp. citri infection. Phytopathology 2016, 106, 442–451. [Google Scholar] [CrossRef] [Green Version]
  8. Fu, X.Z.; Gong, X.Q.; Zhang, Y.X.; Wang, Y.; Liu, J.H. Different transcriptional response to Xanthomonas citri subsp. citri between kumquat and sweet orange with contrasting canker tolerance. PLoS ONE 2012, 7, e41790. [Google Scholar] [CrossRef] [Green Version]
  9. Jia, H.; Orbovic, V.; Wang, N. CRISPR-LbCas12a-mediated modification of citrus. Plant Biotechnol. J. 2019, 17, 1928–1937. [Google Scholar] [CrossRef] [Green Version]
  10. Khodadadi, E.; Mehrabi, A.A.; Najafi, A.; Rastad, S.; Masoudi-Nejad, A. Systems biology study of transcriptional and post-transcriptional co-regulatory network sheds light on key regulators involved in important biological processes in Citrus sinensis. Physiol. Mol. Biol. Plants 2017, 23, 331–342. [Google Scholar] [CrossRef] [Green Version]
  11. Obernosterer, G.; Leuschner, P.J.; Alenius, M.; Martinez, J. Post-transcriptional regulation of microRNA expression. RNA 2006, 12, 1161–1167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Chekulaeva, M.; Filipowicz, W. Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr. Opin. Cell Biol. 2009, 21, 452–460. [Google Scholar] [CrossRef] [PubMed]
  13. Ouyang, S.; Park, G.; Atamian, H.S.; Han, C.S.; Stajich, J.E.; Kaloshian, I.; Borkovich, K.A. MicroRNAs suppress NB domain genes in tomato that confer resistance to Fusarium oxysporum. PLoS Pathog. 2014, 10, e1004464. [Google Scholar] [CrossRef] [PubMed]
  14. Pritchard, C.C.; Cheng, H.H.; Tewari, M. MicroRNA profiling: Approaches and considerations. Nat. Rev. Genet. 2012, 13, 358–369. [Google Scholar] [CrossRef]
  15. Khraiwesh, B.; Zhu, J.K.; Zhu, J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Biophys. Acta 2012, 1819, 137–148. [Google Scholar] [CrossRef] [Green Version]
  16. Fang, Y.; Xie, K.; Xiong, L. Conserved mir164-targeted NAC genes negatively regulate drought resistance in rice. J. Exp. Bot. 2014, 65, 2119–2135. [Google Scholar] [CrossRef] [Green Version]
  17. Li, Y.; Zhang, Q.; Zhang, J.; Wu, L.; Qi, Y.; Zhou, J.M. Identification of microRNAs involved in pathogen-associated molecular pattern-triggered plant innate immunity. Plant Physiol. 2010, 152, 2222–2231. [Google Scholar] [CrossRef] [Green Version]
  18. Benes, V.; Castoldi, M. Expression profiling of microRNA using real-time quantitative PCR, how to use it and what is available. Methods 2010, 50, 244–249. [Google Scholar] [CrossRef]
  19. Babion, I.; Snoek, B.C.; van de Wiel, M.A.; Wilting, S.M.; Steenbergen, R.D.M. A strategy to find suitable reference genes for miRNA quantitative PCR analysis and its application to cervical specimens. J. Mol. Diagn. 2017, 19, 625–637. [Google Scholar] [CrossRef] [Green Version]
  20. Leitao Mda, C.; Coimbra, E.C.; de Lima Rde, C.; Guimaraes Mde, L.; Heraclio Sde, A.; Silva Neto Jda, C.; de Freitas, A.C. Quantifying mRNA and microRNA with qPCR in cervical carcinogenesis: A validation of reference genes to ensure accurate data. PLoS ONE 2014, 9, e111021. [Google Scholar]
  21. Wang, X.; Gardiner, E.J.; Cairns, M.J. Optimal consistency in microRNA expression analysis using reference-gene-based normalization. Mol. BioSyst. 2015, 11, 1235–1240. [Google Scholar] [CrossRef] [PubMed]
  22. Carvalho, K.; de Campos, M.K.; Pereira, L.F.; Vieira, L.G. Reference gene selection for real-time quantitative polymerase chain reaction normalization in “swingle” citrumelo under drought stress. Anal. Biochem. 2010, 402, 197–199. [Google Scholar] [CrossRef] [PubMed]
  23. Mafra, V.; Kubo, K.S.; Alves-Ferreira, M.; Ribeiro-Alves, M.; Stuart, R.M.; Boava, L.P.; Rodrigues, C.M.; Machado, M.A. Reference genes for accurate transcript normalization in citrus genotypes under different experimental conditions. PLoS ONE 2012, 7, e31263. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, Z.; Ge, X.-X.; Wu, X.-M.; Kou, S.-J.; Chai, L.-J.; Guo, W.-W. Selection and validation of suitable reference genes for mRNA qRT-PCR analysis using somatic embryogenic cultures, floral and vegetative tissues in citrus. Plant Cell Tiss. Org. Cult. 2013, 113, 469–481. [Google Scholar] [CrossRef]
  25. Wu, J.X.; Su, S.Y.; Fu, L.L.; Zhang, Y.J.; Chai, L.J.; Yi, H.L. Selection of reliable reference genes for gene expression studies using quantitative real-time PCR in navel orange fruit development and pummelo floral organs. Sci. Hortic. 2014, 176, 180–188. [Google Scholar] [CrossRef]
  26. Thomson, J.M.; Newman, M.; Parker, J.S.; Morin-Kensicki, E.M.; Wright, T.; Hammond, S.M. Extensive post-transcriptional regulation of microRNAs and its implicaitons for cancer. Genes Dev. 2006, 20, 2202–2207. [Google Scholar] [CrossRef] [Green Version]
  27. Peltier, H.J.; Latham, G.J. Normalization of microRNA expression levels in quantitative RT-PCR assays: Identification of suitable reference RNA targets in normal and cancerous human solid tissues. RNA 2008, 14, 844–852. [Google Scholar] [CrossRef] [Green Version]
  28. Chen, C.; Ridzon, D.A.; Broomer, A.J.; Zhou, Z.; Lee, D.H.; Nguyen, J.T.; Barbisin, M.; Xu, N.L.; Mahuvakar, V.R.; Andersen, M.R.; et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33, e179. [Google Scholar] [CrossRef]
  29. Fu, H.J.; Zhu, J.; Yang, M.; Zhang, Z.Y.; Tie, Y.; Jiang, H.; Sun, Z.X.; Zheng, X.F. A novel method to monitor the expression of microRNAs. Mol. Biotechnol. 2006, 32, 197–204. [Google Scholar] [CrossRef]
  30. Cassol, D.; Cruz, F.P.; Espindola, K.; Mangeon, A.; Muller, C.; Loureiro, M.E.; Correa, R.L.; Sachetto-Martins, G. Identification of reference genes for quantitative RT-PCR analysis of microRNAs and mRNAs in castor bean (Ricinus communis L.) under drought stress. Plant Physiol. Biochem. 2016, 106, 101–107. [Google Scholar] [CrossRef]
  31. Wu, W.; Deng, Q.; Shi, P.; Yang, J.; Hu, Z.; Zhang, M. Identification of appropriate reference genes for normalization of miRNA expression in grafted watermelon plants under different nutrient stresses. PLoS ONE 2016, 11, e0164725. [Google Scholar] [CrossRef] [PubMed]
  32. Yang, Y.; Zhang, X.; Chen, Y.; Guo, J.; Ling, H.; Gao, S.; Su, Y.; Que, Y.; Xu, L. Selection of reference genes for normalization of microRNA expression by RT-qPCR in sugarcane buds under cold stress. Front. Plant Sci. 2016, 7, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Fausto, A.K.S.; Silva, T.D.F.; Romanel, E.; Vaslin, M.F.S. MicroRNAs as reference genes for quantitative PCR in cotton. PLoS ONE 2017, 12, e0174722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Luo, X.Y.; Shi, T.; Sun, H.L.; Song, J.; Ni, Z.J.; Gao, Z.H. Selection of suitable inner reference genes for normalisation of microRNA expression response to abiotic stresses by RT-qPCR in leaves, flowers and young stems of peach. Sci. Hortic. 2014, 165, 281–287. [Google Scholar] [CrossRef]
  35. Jones-Rhoades, M.W.; Bartel, D.P. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 2004, 14, 787–799. [Google Scholar] [CrossRef]
  36. Sunkar, R. Novel and stress-regulated microRNAs and other small rnas from Arabidopsis. Plant Cell 2004, 16, 2001–2019. [Google Scholar] [CrossRef] [Green Version]
  37. Xie, Z.; Allen, E.; Fahlgren, N.; Calamar, A.; Givan, S.A.; Carrington, J.C. Expression of Arabidopsis miRNA genes. Plant Physiol. 2005, 138, 2145–2154. [Google Scholar] [CrossRef] [Green Version]
  38. Sunkar, R.; Girke, T.; Jain, P.K.; Zhu, J.K. Cloning and characterization of microRNAs from rice. Plant Cell 2005, 17, 1397–1411. [Google Scholar] [CrossRef] [Green Version]
  39. Lu, S.; Sun, Y.H.; Shi, R.; Clark, C.; Li, L.; Chiang, V.L. Novel and mechanical stress-responsive microRNAs in Populus trichocarpa that are absent from Arabidopsis. Plant Cell 2005, 17, 2186–2203. [Google Scholar] [CrossRef] [Green Version]
  40. Yao, Y.; Guo, G.; Ni, Z.; Sunkar, R.; Du, J.; Zhu, J.K.; Sun, Q. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 2007, 8, R96. [Google Scholar] [CrossRef] [Green Version]
  41. Wu, X.-M.; Liu, M.-Y.; Xu, Q.; Guo, W.-W. Identification and characterization of microRNAs from citrus expressed sequence tags. Tree Genet. Genomes 2010, 7, 117–133. [Google Scholar] [CrossRef]
  42. Xu, Q.; Liu, Y.; Zhu, A.; Wu, X.; Ye, J.; Yu, K.; Guo, W.; Deng, X. Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type. BMC Genom. 2010, 11, 246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Lu, Y.B.; Yang, L.T.; Qi, Y.P.; Li, Y.; Li, Z.; Chen, Y.B.; Huang, Z.R.; Chen, L.S. Identification of boron-deficiency-responsive microRNAs in Citrus sinensis roots by illumina sequencing. BMC Plant Biol. 2014, 14, 123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Huang, J.H.; Qi, Y.P.; Wen, S.X.; Guo, P.; Chen, X.M.; Chen, L.S. Illumina microRNA profiles reveal the involvement of mir397a in citrus adaptation to long-term boron toxicity via modulating secondary cell-wall biosynthesis. Sci. Rep. 2016, 6, 22900. [Google Scholar] [CrossRef] [Green Version]
  45. Luan, Y.; Cui, J.; Zhai, J.; Li, J.; Han, L.; Meng, J. High-throughput sequencing reveals differential expression of miRNAs in tomato inoculated with Phytophthora infestans. Planta 2015, 241, 1405–1416. [Google Scholar] [CrossRef]
  46. Qiu, Z.; Li, X.; Zhao, Y.; Zhang, M.; Wan, Y.; Cao, D.; Lu, S.; Lin, J. Genome-wide analysis reveals dynamic changes in expression of microRNAs during vascular cambium development in chinese fir, Cunninghamia lanceolata. J. Exp. Bot. 2015, 66, 3041–3054. [Google Scholar] [CrossRef] [Green Version]
  47. Yang, L.; Mu, X.; Liu, C.; Cai, J.; Shi, K.; Zhu, W.; Yang, Q. Overexpression of potato mir482e enhanced plant sensitivity to Verticillium dahliae infection. J. Integr. Plant Biol. 2015, 57, 1078–1088. [Google Scholar] [CrossRef]
  48. Das, A.K. Citrus canker-a review. J. Appl. Hortic. 2003, 5, 52–60. [Google Scholar]
  49. Song, H.; Zhang, X.; Shi, C.; Wang, S.; Wu, A.; Wei, C. Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis). Genes 2016, 7, 25. [Google Scholar] [CrossRef] [Green Version]
  50. Han, R.; Yan, Y.; Zhou, P.; Zhao, H.X. Comparison of two microRNA quantification methods for assaying microRNA expression profiles in wheat (Triticum aestivum L.). J. Integr. Agric. 2014, 13, 733–740. [Google Scholar] [CrossRef] [Green Version]
  51. Luo, M.; Gao, Z.; Li, H.; Li, Q.; Zhang, C.; Xu, W.; Song, S.; Ma, C.; Wang, S. Selection of reference genes for miRNA qRT-PCR under abiotic stress in grapevine. Sci. Rep. 2018, 8, 4444. [Google Scholar] [CrossRef]
  52. Kou, S.J.; Wu, X.M.; Liu, Z.; Liu, Y.L.; Xu, Q.; Guo, W.W. Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues. Plant Cell Rep. 2012, 31, 2151–2163. [Google Scholar] [CrossRef]
  53. Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M.K.; Scheible, W.R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005, 139, 5–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Paolacci, A.R.; Tanzarella, O.A.; Porceddu, E.; Ciaffi, M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol. Biol. 2009, 10, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Marum, L.; Miguel, A.; Ricardo, C.P.; Miguel, C. Reference gene selection for quantitative real-time PCR normalization in Quercus suber. PLoS ONE 2012, 7, e35113. [Google Scholar] [CrossRef]
  56. Yue, H.; Deng, P.; Liu, S.; Wang, M.; Song, W.; Nie, X. Selection and evaluation of reference genes for quantitative gene expression analysis in broomcorn millet (Panicum miliaceum L.). J. Plant Biol. 2016, 59, 435–443. [Google Scholar] [CrossRef]
  57. Udvardi, M.K.; Czechowski, T.; Scheible, W.R. Eleven golden rules of quantitative RT-PCR. Plant Cell 2008, 20, 1736–1737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034-1. [Google Scholar] [CrossRef] [Green Version]
  60. Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Green Version]
  61. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: Bestkeeper—Excel-based tool using pair-wise correlations. Biotechnol. Let. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
  62. Xie, F.; Sun, G.; Stiller, J.W.; Zhang, B. Genome-wide functional analysis of the cotton transcriptome by creating an integrated EST database. PLoS ONE 2011, 6, e26980. [Google Scholar] [CrossRef] [PubMed]
  63. Hu, Y.; Zhang, J.; Jia, H.; Sosso, D.; Li, T.; Frommer, W.B.; Yang, B.; White, F.F.; Wang, N.; Jones, J.B. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease. Proc. Natl. Acad. Sci. USA 2014, 111, E521–E529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Kulcheski, F.R.; Marcelino-Guimaraes, F.C.; Nepomuceno, A.L.; Abdelnoor, R.V.; Margis, R. The use of microRNAs as reference genes for quantitative polymerase chain reaction in soybean. Anal. Biochem. 2010, 406, 185–192. [Google Scholar] [CrossRef] [PubMed]
  65. Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.; Moorman, A.F. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef] [Green Version]
  66. Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef] [Green Version]
  67. Gifford, M.L.; Dean, A.; Gutierrez, R.A.; Coruzzi, G.M.; Birnbaum, K.D. Cell-specific nitrogen responses mediate developmental plasticity. Proc. Natl. Acad. Sci. USA 2008, 105, 803–808. [Google Scholar] [CrossRef] [Green Version]
  68. Li, J.; Han, X.; Wang, C.; Qi, W.; Zhang, W.; Tang, L.; Zhao, X. Validation of suitable reference genes for RT-qPCR data in Achyranthes bidentata blume under different experimental conditions. Front. Plant Sci. 2017, 8, 776. [Google Scholar] [CrossRef] [Green Version]
  69. Lin, F.; Jiang, L.; Liu, Y.; Lv, Y.; Dai, H.; Zhao, H. Genome-wide identification of housekeeping genes in maize. Plant Mol. Biol. 2014, 86, 543–554. [Google Scholar] [CrossRef]
  70. Maroufi, A.; Van Bockstaele, E.; De Loose, M. Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR. BMC Mol. Biol. 2010, 11, 15. [Google Scholar] [CrossRef] [Green Version]
  71. Xiao, Z.; Sun, X.; Liu, X.; Li, C.; He, L.; Chen, S.; Su, J. Selection of reliable reference genes for gene expression studies on Rhododendron molle g. Don. Front. Plant Sci. 2016, 7, 1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Barsalobres-Cavallari, C.F.; Severino, F.E.; Maluf, M.P.; Maia, I.G. Identification of suitable internal control genes for expression studies in Coffea arabica under different experimental conditions. BMC Mol. Biol. 2009, 10, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Niu, K.; Shi, Y.; Ma, H. Selection of candidate reference genes for gene expression analysis in kentucky bluegrass (Poa pratensis L.) under abiotic stress. Front. Plant Sci. 2017, 8, 193. [Google Scholar] [CrossRef] [PubMed]
  74. Liu, Y.; Liu, J.; Xu, L.; Lai, H.; Chen, Y.; Yang, Z.; Huang, B. Identification and validation of reference genes for seashore paspalum response to abiotic stresses. Int. J. Mol. Sci. 2017, 18, 1322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Niu, X.; Chen, M.; Huang, X.; Chen, H.; Tao, A.; Xu, J.; Qi, J. Reference gene selection for qRT-PCR normalization analysis in kenaf (Hibiscus cannabinus L.) under abiotic stress and hormonal stimuli. Front. Plant Sci. 2017, 8, 771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Wu, J.; Zhang, H.; Liu, L.; Li, W.; Wei, Y.; Shi, S. Validation of reference genes for RT-qPCR studies of gene expression in preharvest and postharvest longan fruits under different experimental conditions. Front. Plant Sci. 2016, 7, 780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Duan, M.; Wang, J.; Zhang, X.; Yang, H.; Wang, H.; Qiu, Y.; Song, J.; Guo, Y.; Li, X. Identification of optimal reference genes for expression analysis in radish (Raphanus sativus L.) and its relatives based on expression stability. Front. Plant Sci. 2017, 8, 1605. [Google Scholar] [CrossRef] [Green Version]
  78. Wan, H.; Zhao, Z.; Qian, C.; Sui, Y.; Malik, A.A.; Chen, J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal. Biochem. 2010, 399, 257–261. [Google Scholar] [CrossRef]
  79. Tian, C.; Jiang, Q.; Wang, F.; Wang, G.L.; Xu, Z.S.; Xiong, A.S. Selection of suitable reference genes for qPCR normalization under abiotic stresses and hormone stimuli in carrot leaves. PLoS ONE 2015, 10, e0117569. [Google Scholar] [CrossRef] [Green Version]
  80. Zhang, S.; Zeng, Y.; Yi, X.; Zhang, Y. Selection of suitable reference genes for quantitative RT-PCR normalization in the halophyte Halostachys caspica under salt and drought stress. Sci. Rep. 2016, 6, 30363. [Google Scholar] [CrossRef] [Green Version]
  81. Liu, H.H.; Tian, X.; Li, Y.J.; Wu, C.A.; Zheng, C.C. Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 2008, 14, 836–843. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Jia, X.; Wang, W.X.; Ren, L.; Chen, Q.J.; Mendu, V.; Willcut, B.; Dinkins, R.; Tang, X.; Tang, G. Differential and dynamic regulation of mir398 in response to aba and salt stress in Populus tremula and Arabidopsis thaliana. Plant Mol. Biol. 2009, 71, 51–59. [Google Scholar] [CrossRef] [PubMed]
  83. Zhang, L.W.; Song, J.B.; Shu, X.X.; Zhang, Y.; Yang, Z.M. Mir395 is involved in detoxification of cadmium in Brassica napus. J. Hazard. Mater. 2013, 250, 204–211. [Google Scholar] [CrossRef] [PubMed]
  84. Ma, C.L.; Qi, Y.P.; Liang, W.W.; Yang, L.T.; Lu, Y.B.; Guo, P.; Ye, X.; Chen, L.S. MicroRNA regulatory mechanisms on Citrus sinensis leaves to magnesium-deficiency. Front. Plant Sci. 2016, 7, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  85. Mutum, R.D.; Kumar, S.; Balyan, S.; Kansal, S.; Mathur, S.; Raghuvanshi, S. Identification of novel miRNAs from drought tolerant rice variety nagina 22. Sci. Rep. 2016, 6, 30786. [Google Scholar] [CrossRef] [Green Version]
  86. Xie, R.; Zhang, J.; Ma, Y.; Pan, X.; Dong, C.; Pang, S.; He, S.; Deng, L.; Yi, S.; Zheng, Y.; et al. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots. Sci. Rep. 2017, 7, 42094. [Google Scholar] [CrossRef] [Green Version]
  87. Naqvi, A.R.; Haq, Q.M.; Mukherjee, S.K. MicroRNA profiling of tomato leaf curl new delhi virus (tolcndv) infected tomato leaves indicates that deregulation of mir159/319 and mir172 might be linked with leaf curl disease. Virol. J. 2010, 7, 281. [Google Scholar] [CrossRef] [Green Version]
  88. Varallyay, E.; Valoczi, A.; Agyi, A.; Burgyan, J.; Havelda, Z. Plant virus-mediated induction of mir168 is associated with repression of argonaute1 accumulation. EMBO J. 2010, 29, 3507–3519. [Google Scholar] [CrossRef] [Green Version]
  89. Wu, J.; Yang, R.; Yang, Z.; Yao, S.; Zhao, S.; Wang, Y.; Li, P.; Song, X.; Jin, L.; Zhou, T.; et al. ROS accumulation and antiviral defence control by microRNA528 in rice. Nat. Plants 2017, 3, 16203. [Google Scholar] [CrossRef]
  90. Perez-Quintero, A.L.; Quintero, A.; Urrego, O.; Vanegas, P.; Lopez, C. Bioinformatic identification of cassava miRNAs differentially expressed in response to infection by Xanthomonas axonopodis pv. Manihotis. BMC Plant Biol. 2012, 12, 29. [Google Scholar] [CrossRef] [Green Version]
  91. Kurubanjerdjit, N.; Tsai, J.J.; Huang, C.H.; Ng, K.L. Disturbance of Arabidopsis thaliana microrna-regulated pathways by xcc bacterial effector proteins. Amino Acids 2014, 46, 953–961. [Google Scholar] [CrossRef] [PubMed]
  92. Ma, C.; Lu, Y.; Bai, S.; Zhang, W.; Duan, X.; Meng, D.; Wang, Z.; Wang, A.; Zhou, Z.; Li, T. Cloning and characterization of miRNAs and their targets, including a novel miRNA-targeted NBS-LRR protein class gene in apple (golden delicious). Mol. Plant 2014, 7, 218–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  93. Baldrich, P.; Campo, S.; Wu, M.T.; Liu, T.T.; Hsing, Y.I.; San Segundo, B. MicroRNA-mediated regulation of gene expression in the response of rice plants to fungal elicitors. RNA Biol. 2015, 12, 847–863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  94. Luan, Y.; Cui, J.; Wang, W.; Meng, J. Mir1918 enhances tomato sensitivity to Phytophthora infestans infection. Sci. Rep. 2016, 6, 35858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  95. Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Green Version]
  96. Zhang, B.; Pan, X.; Cobb, G.P.; Anderson, T.A. Plant microRNA: A small regulatory molecule with big impact. Dev. Biol. 2006, 289, 3–16. [Google Scholar] [CrossRef]
  97. Selvey, S.; Thompson, E.; Matthaei, K.; Lea, R.; Irving, M.; Griffiths, L. β-Actin-an unsuitable internal control for RT-PCR. Mol. Cell. Probes 2001, 15, 307–311. [Google Scholar] [CrossRef]
  98. Gutierrez, L.; Mauriat, M.; Guenin, S.; Pelloux, J.; Lefebvre, J.F.; Louvet, R.; Rusterucci, C.; Moritz, T.; Guerineau, F.; Bellini, C.; et al. The lack of a systematic validation of reference genes: A serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnol. J. 2008, 6, 609–618. [Google Scholar] [CrossRef] [Green Version]
  99. Ambroise, V.; Legay, S.; Guerriero, G.; Hausman, J.F.; Cuypers, A.; Sergeant, K. Selection of appropriate reference genes for gene expression analysis under abiotic stresses in Salix viminalis. Int. J. Mol. Sci. 2019, 20, 4210. [Google Scholar] [CrossRef] [Green Version]
  100. Cao, A.; Shao, D.; Cui, B.; Tong, X.; Zheng, Y.; Sun, J.; Li, H. Screening the reference genes for quantitative gene expression by RT-qPCR during se initial dedifferentiation in four Gossypium hirsutum cultivars that have different se capability. Genes 2019, 10, 497. [Google Scholar] [CrossRef] [Green Version]
  101. Turner, M.; Nizampatnam, N.R.; Baron, M.; Coppin, S.; Damodaran, S.; Adhikari, S.; Arunachalam, S.P.; Yu, O.; Subramanian, S. Ectopic expression of mir160 results in auxin hypersensitivity, cytokinin hyposensitivity, and inhibition of symbiotic nodule development in soybean. Plant Physiol. 2013, 162, 2042–2055. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  102. Nizampatnam, N.R.; Schreier, S.J.; Damodaran, S.; Adhikari, S.; Subramanian, S. MicroRNA160 dictates stage-specific auxin and cytokinin sensitivities and directs soybean nodule development. Plant J. 2015, 84, 140–153. [Google Scholar] [CrossRef] [PubMed]
  103. Liu, Z.; Li, J.; Wang, L.; Li, Q.; Lu, Q.; Yu, Y.; Li, S.; Bai, M.Y.; Hu, Y.; Xiang, F. Repression of callus initiation by the miRNA-directed interaction of auxin-cytokinin in Arabidopsis thaliana. Plant J. 2016, 87, 391–402. [Google Scholar] [CrossRef] [PubMed]
  104. Xie, Z.; Kasschau, K.D.; Carrington, J.C. Negative feedback regulation of dicer-like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 2003, 13, 784–789. [Google Scholar] [CrossRef] [Green Version]
  105. Hirsch, J.; Lefort, V.; Vankersschaver, M.; Boualem, A.; Lucas, A.; Thermes, C.; d’Aubenton-Carafa, Y.; Crespi, M. Characterization of 43 non-protein-coding mRNA genes in Arabidopsis, including the mir162a-derived transcripts. Plant Physiol. 2006, 140, 1192–1204. [Google Scholar] [CrossRef] [Green Version]
  106. Shao, F.; Qiu, D.; Lu, S. Comparative analysis of the dicer-like gene family reveals loss of mir162 target site in smdcl1 from Salvia miltiorrhiza. Sci. Rep. 2015, 5, 9891. [Google Scholar] [CrossRef] [Green Version]
  107. Eichmeier, A.; Kiss, T.; Penazova, E.; Pecenka, J.; Berraf-Tebbal, A.; Baranek, M.; Pokluda, R.; Cechova, J.; Gramaje, D.; Grzebelus, D. MicroRNAs in Vitis vinifera cv. Chardonnay are differentially expressed in response to diaporthe species. Genes 2019, 10, 905. [Google Scholar] [CrossRef] [Green Version]
  108. Becker, C.; Hammerle-Fickinger, A.; Riedmaier, I.; Pfaffl, M.W. mRNA and microRNA quality control for RT-qPCR analysis. Methods 2010, 50, 237–243. [Google Scholar] [CrossRef]
  109. Sirover, M.A. On the functional diversity of glyceraldehyde-3-phosphate dehydrogenase: Biochemical mechanisms and regulatory control. Biochim. Biophys. Acta 2011, 1810, 741–751. [Google Scholar] [CrossRef]
  110. Tristan, C.; Shahani, N.; Sedlak, T.W.; Sawa, A. The diverse functions of GAPDH: Views from different subcellular compartments. Cell. Signal. 2011, 23, 317–323. [Google Scholar] [CrossRef] [Green Version]
  111. Sirover, M.A. Subcellular dynamics of multifunctional protein regulation: Mechanisms of GAPDH intracellular translocation. J. Cell. Biochem. 2012, 113, 2193–2200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  112. Yan, J.; Yuan, F.; Long, G.; Qin, L.; Deng, Z. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Mol. Biol. Rep. 2012, 39, 1831–1838. [Google Scholar] [CrossRef] [PubMed]
  113. Sinha, P.; Saxena, R.K.; Singh, V.K.; Krishnamurthy, L.; Varshney, R.K. Selection and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanus cajan) under heat and salt stress conditions. Front. Plant Sci. 2015, 6, 1071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  114. Martins, P.K.; Mafra, V.; de Souza, W.R.; Ribeiro, A.P.; Vinecky, F.; Basso, M.F.; da Cunha, B.A.; Kobayashi, A.K.; Molinari, H.B. Selection of reliable reference genes for RT-qPCR analysis during developmental stages and abiotic stress in Setaria viridis. Sci. Rep. 2016, 6, 28348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  115. Zhang, Y.; Han, X.; Chen, S.; Zheng, L.; He, X.; Liu, M.; Qiao, G.; Wang, Y.; Zhuo, R. Selection of suitable reference genes for quantitative real-time PCR gene expression analysis in Salix matsudana under different abiotic stresses. Sci. Rep. 2017, 7, 40290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  116. Zhou, B.; Chen, P.; Khan, A.; Zhao, Y.; Chen, L.; Liu, D.; Liao, X.; Kong, X.; Zhou, R. Candidate reference genes selection and application for RT-qPCR analysis in kenaf with cytoplasmic male sterility background. Front. Plant Sci. 2017, 8, 1520. [Google Scholar] [CrossRef] [Green Version]
  117. Zeng, L.; Deng, R.; Guo, Z.; Yang, S.; Deng, X. Genome-wide identification and characterization of glyceraldehyde-3-phosphate dehydrogenase genes family in wheat (Triticum aestivum). BMC Genom. 2016, 17, 240. [Google Scholar] [CrossRef] [Green Version]
  118. Dunnett, H.; van der Meer, D.; Williams, A.G. Evaluation of stem-loop reverse transcription and poly-A tail extension in microRNA analysis of body fluids. MicroRNA 2015, 3, 150–154. [Google Scholar] [CrossRef] [Green Version]
  119. Kantar, M.; Lucas, S.J.; Budak, H. miRNA expression patterns of Triticum dicoccoides in response to shock drought stress. Planta 2011, 233, 471–484. [Google Scholar] [CrossRef]
Figure 1. The cycle threshold (Ct) variation of individual candidate reference gene. The Box-whisker plot shows Ct variation of 18 candiates in (A) sweet orange and (B) Ponkan. A line across the box depicts the median. In each box, the upper and lower edges indicate the 25th and 75th percentiles. Whisker caps are the minimum and maximum values.
Figure 1. The cycle threshold (Ct) variation of individual candidate reference gene. The Box-whisker plot shows Ct variation of 18 candiates in (A) sweet orange and (B) Ponkan. A line across the box depicts the median. In each box, the upper and lower edges indicate the 25th and 75th percentiles. Whisker caps are the minimum and maximum values.
Genes 11 00017 g001
Figure 2. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by statistical program geNorm. The most stable genes are on the left and the least stable genes on the right.
Figure 2. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by statistical program geNorm. The most stable genes are on the left and the least stable genes on the right.
Genes 11 00017 g002
Figure 3. Pairwise variation (Vn/Vn+1) analysis of the candidate reference genes in (A) sweet orange and (B) Ponkan. The pairwise variation (Vn/Vn+1) was analyzed based on geNorm algorithm to determine the optimal number of reference genes for accurate normalization. We proposed 0.15 as a threshold value, which suggested that adding one more gene into the combination of reference genes is not required.
Figure 3. Pairwise variation (Vn/Vn+1) analysis of the candidate reference genes in (A) sweet orange and (B) Ponkan. The pairwise variation (Vn/Vn+1) was analyzed based on geNorm algorithm to determine the optimal number of reference genes for accurate normalization. We proposed 0.15 as a threshold value, which suggested that adding one more gene into the combination of reference genes is not required.
Genes 11 00017 g003
Figure 4. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by statistical program NormFinder. The most stable genes are on the left and the least stable genes on the right.
Figure 4. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by statistical program NormFinder. The most stable genes are on the left and the least stable genes on the right.
Genes 11 00017 g004
Figure 5. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by Delta Ct method. The most stable genes are on the left and the least stable genes on the right.
Figure 5. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by Delta Ct method. The most stable genes are on the left and the least stable genes on the right.
Genes 11 00017 g005
Figure 6. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by the statistical program RefFinder. The most stable genes are on the left, and the least stable genes on the right.
Figure 6. Expression stability analysis of candidate reference genes in (A) sweet orange and (B) Ponkan calculated by the statistical program RefFinder. The most stable genes are on the left, and the least stable genes on the right.
Genes 11 00017 g006
Figure 7. Relative expression of CsLOB1 in C. sinensis after Xcc infection or mock using the selected candidate reference genes: miR162-3p and miR160 (A) and GAPDH (B) for normalization. Means ± standard deviation (SE) were calculated from four discs per treatment (n = 4) per given day.
Figure 7. Relative expression of CsLOB1 in C. sinensis after Xcc infection or mock using the selected candidate reference genes: miR162-3p and miR160 (A) and GAPDH (B) for normalization. Means ± standard deviation (SE) were calculated from four discs per treatment (n = 4) per given day.
Genes 11 00017 g007
Table 1. Selected candidate reference gene primers and their parameters derived from RT-qPCR analysis
Table 1. Selected candidate reference gene primers and their parameters derived from RT-qPCR analysis
Gene NameForward PrimerReverse PrimerEfficiency (E) (%)rGene TypeReference
st-miR162-3pGCGGGCTCGATAAACCTCTGCGTGCAGGGTCCGAGGT104.70.9999miRNA
st-miR166bAGCGGTCGGACCAGGCTTCATGTGCAGGGTCCGAGGT87.510.9976miRNA[31]
st-miR396aCGCGGCTTCCACAGCTTTCTTGTGCAGGGTCCGAGGT86.840.9988miRNA
st-miR472CGCGGCTTTTCCCACACCTCCGTGCAGGGTCCGAGGT94.170.9975miRNA
st-miR482bTCATCTCTTGCCCACCCCTCCGTGCAGGGTCCGAGGT99.570.998miRNA
st-miR3954GCGGCGTGGACAGAGAAATCAGTGCAGGGTCCGAGGT87.730.9992miRNA
st-miR403GTCGGCTTAGATTCACGCACAGTGCAGGGTCCGAGGT87.860.9965miRNA
st-miR160GCGTCGGCCTGGCTCCCTGTAGTGCAGGGTCCGAGGT89.460.9962miRNA[30,67]
csi-miR162-3pTCGATAAACCTCTGCATCCAGGATCGCCCTTCTACGTCTAT103.000.9730miRNA
csi-miR166bTCGGACCAGGCTTCATTCCCGTGATCGCCCTTCTACGTCTAT102.510.9752miRNA
csi-miR396aTTCCACAGCTTTCTTGAACTGGATCGCCCTTCTACGTCTAT99.310.9912miRNA
csi-miR472TTTTCCCACACCTCCCATCCCGATCGCCCTTCTACGTCTAT99.300.9869miRNA
csi-miR482bTCTTGCCCACCCCTCCCATTCCGATCGCCCTTCTACGTCTAT103.590.9918miRNA
csi-miR3954TGGACAGAGAAATCACGGTCAGATCGCCCTTCTACGTCTAT99.730.9896miRNA
csi-miR403TTAGATTCACGCACAAACTCGGATCGCCCTTCTACGTCTAT103.060.9968miRNA
csi-miR160GCCTGGCTCCCTGTATGCCATGATCGCCCTTCTACGTCTAT101.150.9878miRNA
Csi-U4 *GCAATGACGCAGCTTATGAGGCAAAGGGAGCCCTTCCAGAA88.640.9936Non-coding RNA[52]
Csi-U5 *GTGGGCACAGAGCGAACTATCGAAGAGAAACCCTCCAAAAA89.570.9978Non-coding RNA[52]
Csi-U6 *ACAGAGAAGATTAGCATGGCCGACCAATTCTCGATTTGTGCG91.560.9999Non-coding RNA[52]
Csi-snoR14TTCATGTCTGTCAATCCACTGAACCTGTCGGGATTCAAGATA93.250.9958Non-coding RNA[52]
CsACT1ACGCTATCCTTCGTCTTGGCTTCTCCTTCATATCCCT102.250.9732Protein coding RNA[68]
CsACT2AGTGCTTGATGGGTGAGTTCGCAAGGAAGACGGTTGAGTA96.290.9979Protein coding RNA[69]
CsEF1αTGACTGTGCCGTCCTTATCTCATCGTACCTAGCCTTTG103.80.9796Protein coding RNA[68,70,71]
CsGAPDHCCGTCTGCGATGTTCCACTTCCAATGGGTCTCCGCTTCC91.550.9972Protein coding RNA[72,73]
CsPP2ATCGTAATCCGCAACCCTATACGGCATCGTTTCACTCTAA97.870.9942Protein coding RNA[74,75]
CsTUA5CTATCTACCCTTCTCCTCAGTTAGTGTAAGTTGGCCTCT97.790.9917Protein coding RNA[76,77]
CsTUB4ATCCCGCCTAAGGGTCTGCTCGGTGAACTCCATCTCG98.640.9923Protein coding RNA[78,79]
CsUBC28GGTAGCATTTGCCTTGATAGCAGTGACCTAACCCATT103.650.9988Protein coding RNA[52,80]
* The primers were obtained from Kou et al., 2012 [52] and the reference referred to citrus homologous genes being screened as stable internal reference genes in other plants.
Table 2. Ranking of selected candidate genes based on the expression stability values calculated by Delta Ct, BestKeeper, NormFinder, geNorm and RefFinder in sweet orange (blue columns) and Ponkan (black columns).
Table 2. Ranking of selected candidate genes based on the expression stability values calculated by Delta Ct, BestKeeper, NormFinder, geNorm and RefFinder in sweet orange (blue columns) and Ponkan (black columns).
RankingDelta CtBestKeeperNormFindergeNormRefFinderDelta CtBestKeeperNormfindergeNormRefFinder
1miR162-3pst-miR472miR162-3pUBC28miR162-3pmiR403miR162-3pmiR403miR162-3p miR162-3p
2miR472miR160miR472miR166bmiR472miR428bmiR472miR428bmiR472miR403
3miR160st-miR428bmiR160miR472miR160miR162-3pst-miR166bmiR160miR428bmiR472
4st-miR428bmiR166bst-miR428bmiR162-3pmiR166bmiR160miR160miR162-3pmiR403miR428b
5st-miR472miR472st-miR472miR160st-miR472st-miR472miR166bst-miR472miR160miR160
6UBC28miR428bUBC28miR428bUBC28miR472miR403UBC28st-miR166bst-miR472
7miR166bmiR162-3pmiR166bACTIN2 st-miR428bUBC28miR428bmiR472st-miR472st-miR166b
8miR428bmiR396amiR428bmiR396amiR428bPP2Ast-miR472PP2APP2AUBC28
9miR396asnoR14miR396ast-miR472miR396ast-miR166bUBC28st-miR162-3pUBC28PP2A
10ACTIN2ACTIN2ACTIN2st-miR428bACTIN2st-miR162-3pPP2Ast-miR428bst-miR403miR166b
11st-miR166bst-miR166bst-miR166bmiR403st-miR166bst-miR428bst-miR403st-miR166bst-miR162-3pst-miR162-3p
12st-miR396aUBC28st-miR396aU4st-miR396ast-miR403st-miR160st-miR403st-miR428bst-miR403
13miR403st-miR396amiR403st-miR166bsnoR14miR396ast-miR428bmiR396amiR166bst-miR428b
14U4U4U4st-miR396aU4miR166bst-miR162-3pmiR166bmiR396amiR396a
15snoR14miR3954snoR14snoR14miR403st-miR396amiR396ast-miR396ast-miR396ast-miR396a
16PP2Ast-miR3954PP2APP2AEF1aEF1aEF1aEF1ast-miR160EF1a
17EF1aEF1aEF1aEF1aPP2AACTIN2st-miR396aACTIN2EF1ast-miR160
18TUB4st-miR160TUB4st-miR160st-miR160TUA5snoR14TUA5st-miR3954ACTIN2
19st-miR160U6st-miR160TUB4miR3954st-miR160ACTIN2miR3954miR3954TUA5
20miR3954miR403miR3954miR3954TUB4miR3954U6st-miR160ACTIN2miR3954
21st-miR403PP2AACTIN1st-miR403st-miR3954st-miR3954TUA5st-miR3954TUA5st-miR3954
22st-miR3954TUB4st-miR403st-miR3954st-miR403snoR14U4snoR14U6snoR14
23ACTIN1ACTIN1st-miR3954st-miR162-3pACTIN1U4st-miR3954TUB4U4U6
24st-miR162-3pst-miR403st-miR162-3pACTIN1U6TUB4miR3954U4snoR14U4
25U6st-miR162-3pU6U6st-miR162-3pU6TUB4U6TUB4TUB4
26TUA5TUA5TUA5TUA5TUA5ACTIN1U5ACTIN1ACTIN1ACTIN1
27U5U5U5U5U5U5ACTIN1U5U5U5
28GAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDH
Table 3. Descriptive statistics of candidate genes based on BestKeeper in sweet orange.
Table 3. Descriptive statistics of candidate genes based on BestKeeper in sweet orange.
Geo Mean (Ct)AR Mean (Ct)Min (Ct)Max (Ct)Std dev (± Ct)CV (% Ct)Min (x-fold)Max (x-fold)Std. dev. (± x-fold)Coeff. of corr. (r)p-Value
U412.5712.619.8314.110.836.6−6.662.921.780.6690.005
U510.9611.088.3814.761.4412.95−5.9713.962.70.5550.026
U612.6612.729.1614.350.967.53−11.293.231.940.2710.309
snoR1416.3716.4113.7518.080.744.53−6.163.271.670.580.019
ACTIN220.220.2218.8621.930.753.7−2.543.311.680.4470.083
ACTIN124.0324.0721.9627.391.044.31−4.1910.292.050.5560.025
UBC2819.9119.9318.8222.280.783.93−2.125.181.720.7690.001
TUA521.1621.2218.0625.371.175.5−8.618.452.250.5750.02
EF1a22.722.7320.0625.120.944.12−6.245.351.910.5750.02
TUB423.1323.1721.1526.011.024.39−3.947.362.020.6320.009
GAPDH20.2320.3318.1125.31.748.57−4.3433.663.350.5820.018
PP2A23.4423.4721.7127.040.974.14−3.3112.131.960.7540.001
miR162-3p18.1718.1917.1819.180.673.68−1.992.011.590.8090.001
miR396a13.5313.5611.715.10.735.35−3.572.961.650.5840.018
miR428b14.7114.7313.1316.710.664.5−2.9941.580.5350.033
miR16019.7119.7218.720.990.482.43−2.012.431.390.6210.01
miR40317.0417.0815.3619.280.975.69−3.24.731.960.7090.002
miR47214.514.5212.8115.870.614.17−3.232.581.520.6850.003
miR166b19.8719.8918.8222.230.582.91−2.075.131.490.6680.005
miR395419.9319.9618.1622.270.874.38−3.415.061.830.2490.352
st-miR47222.5522.5521.6123.750.421.86−1.912.31.340.3310.21
st-miR428b25.4125.4224.0127.080.512−2.653.181.420.5430.03
st-miR396a20.3420.3618.9622.380.813.99−2.64.111.760.4580.075
st-miR166b23.7823.822.7925.580.753.15−1.993.481.680.3870.138
st-miR395427.9327.9525.6530.440.923.28−4.855.711.890.1530.573
st-miR16036.0436.0634.4139.030.962.65−3.097.951.940.4950.051
st-miR162-3p28.0928.1325.8331.311.124−4.799.322.180.4380.089
st-miR40323.0223.0621.6126.971.044.52−2.6715.412.060.4210.105
Geo mean (Ct): the geometric mean of Ct; AR mean (Ct): the arithmetic mean of Ct; Min (Ct) and Max (Ct): the extreme values of Ct; SD (± Ct): the standard deviation of the Ct; CV (%Ct): the coefficient of variance expressed as a percentage on the Ct level; Min (x-fold) and Max (x-fold): the extreme values of expression levels expressed as an absolute x-fold over- or under-regulation coefficient; SD (± x-fold): standard deviation of the absolute regulation coefficients.
Table 4. Descriptive statistics of candidate genes based on BestKeeper in Ponkan.
Table 4. Descriptive statistics of candidate genes based on BestKeeper in Ponkan.
Geo Mean (Ct)AR Mean (Ct)Min (Ct)Max (Ct)Std (± Ct)CV (% Ct)Min (x-fold)Max (x-fold)Std dev (± x-fold)Coeff. of corr. (r)p-Value
U412.3312.399.7714.050.957.67−5.913.291.930.2960.266
U511.2211.338.914.241.3111.55−4.988.132.480.3390.199
U613.113.1411.0814.870.896.75−4.053.411.850.0010.843
snoR1416.3416.3912.4318.090.855.21−14.983.381.810.5950.015
ACTIN219.619.6317.8522.90.864.36−3.359.881.810.6310.009
ACTIN124.3824.4421.9128.041.536.26−5.5412.652.890.6940.003
UBC2819.8119.8317.0120.560.52.52−6.961.681.410.8030.001
TUA521.4221.4618.2224.450.94.18−9.218.151.860.7220.002
EF1a23.0823.1120.7725.580.793.44−4.975.651.730.5790.019
TUB423.0623.1219.9526.81.114.8−8.6513.342.160.8230.001
GAPDH20.2920.4318.1427.171.959.54−4.43117.993.860.5060.046
PP2A23.1123.1320.3723.80.52.18−6.691.611.420.7060.002
miR162−3p18.5818.5818.0319.460.251.33−1.461.841.190.4150.11
miR396a14.7514.7813.1816.980.785.28−2.974.71.720.6980.003
miR428b15.8815.8914.5217.020.442.77−2.562.211.360.6870.003
miR16020.4920.4919.3121.160.422.07−2.261.61.340.6270.009
miR40317.3517.3615.9318.430.442.52−2.682.111.350.8510.001
miR47215.3715.3714.9216.060.261.66−1.361.621.190.2060.444
miR166b20.2320.2319.0921.290.432.15−2.22.091.350.040.883
miR395419.5719.6117.621.071.045.29−3.932.822.050.4960.051
St-miR47223.423.4122.1924.360.451.93−2.311.941.370.540.031
St-miR428b26.7126.7225.7227.790.682.54−1.982.121.60.430.097
st-miR396a21.4621.4820.0123.240.833.86−2.733.431.780.3890.136
st-miR166b24.3224.3223.3225.460.411.67−22.211.330.180.504
st-miR395427.9727.9925.9300.993.52−4.184.091.980.3150.235
st-miR16036.8736.8834.8238.740.651.77−4.143.651.570.0010.928
st-miR162-3p28.9228.9326.9530.160.72.44−3.912.361.630.6480.007
st-miR40323.5223.5322.2724.530.62.53−2.382.011.510.3480.187
Table 5. Gene expression stability of candidate reference genes calculated by RefFinder in sweet orange and Ponkan infected by Xcc.
Table 5. Gene expression stability of candidate reference genes calculated by RefFinder in sweet orange and Ponkan infected by Xcc.
RankingSweet OrangePonkanProtein Coding
Poly(A) RTStem-loop RTPoly(A) RTStem-Loop RTSweet OrangePonkan
1miR162-3pst-miR396amiR160st-miR472UBC28UBC28
2miR160st-miR162-3pmiR162-3pst-miR403PP2APP2A
3miR472st-miR166bmiR472st-miR162-3pEF1aEF1a
4miR166bst-miR472miR403st-miR166bACTIN2TUA5
5miR396ast-miR428bmiR428bst-miR160ACTIN1ACTIN2
6miR428bst-miR403miR166bst-miR428bTUB4TUB4
7miR403st-miR160miR396ast-miR396aTUA5ACTIN1
8miR3954st-miR3954miR3954st-miR3954GAPDHGAPDH

Share and Cite

MDPI and ACS Style

Lyu, S.; Yu, Y.; Xu, S.; Cai, W.; Chen, G.; Chen, J.; Pan, D.; She, W. Identification of Appropriate Reference Genes for Normalizing miRNA Expression in Citrus Infected by Xanthomonas citri subsp. citri. Genes 2020, 11, 17. https://0-doi-org.brum.beds.ac.uk/10.3390/genes11010017

AMA Style

Lyu S, Yu Y, Xu S, Cai W, Chen G, Chen J, Pan D, She W. Identification of Appropriate Reference Genes for Normalizing miRNA Expression in Citrus Infected by Xanthomonas citri subsp. citri. Genes. 2020; 11(1):17. https://0-doi-org.brum.beds.ac.uk/10.3390/genes11010017

Chicago/Turabian Style

Lyu, Shiheng, Ying Yu, Shirong Xu, Weiwei Cai, Guixin Chen, Jianjun Chen, Dongming Pan, and Wenqin She. 2020. "Identification of Appropriate Reference Genes for Normalizing miRNA Expression in Citrus Infected by Xanthomonas citri subsp. citri" Genes 11, no. 1: 17. https://0-doi-org.brum.beds.ac.uk/10.3390/genes11010017

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop