Mechanism of Apoptosis in Porcine Ovarian Granulosa Cells Triggered by T-2 Toxin
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Collection, pGCs Cultured In Vitro and Exposed to T-2
2.3. Cell Morphological Assay
2.4. Cell Apoptosis Analysis
2.5. Cell Cycle Detection
2.6. Phalloidin Staining
2.7. Total RNA Extraction, Library Construction and Sequencing
2.8. Real-Time Quantitative PCR
2.9. Statistical Analysis
3. Results
3.1. Effect of T-2 on pGCs Morphology Changes
3.2. Effect of T-2 on pGCs Apoptosis
3.3. T-2 Induced Cell Cycle Alteration
3.4. Sequencing Analysis of Gene Expression
3.5. Analysis of Differentially Expressed Genes
3.6. RNA-Seq Data Bioinformatic Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wu, Y.-P.; Zhao, H.H.; Zhou, Y.-X.; Wang, L.P. The Role of Granulosa Cells in Oocyte Maturation. J. Int. Reprod. Health/Fam. Plan. 2017, 36, 503–506. [Google Scholar]
- M’Baye, M.; Hua, G.H.; Khan, H.A.; Yang, L.G. RNAi-mediated knockdown of INHBB increases apoptosis and inhibits steroidogenesis in mouse granulosa cells. J. Reprod. Dev. 2015, 61, 391–397. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Wang, L.; Li, X.; Zhao, H.F. The effects of chronic lead exposure on the ovaries of female juvenile Japanese quails (Coturnix japonica): Developmental delay, histopathological alterations, hormone release disruption and gene expression disorder. Ecotoxicol. Environ. Saf. 2020, 205, 111338. [Google Scholar] [CrossRef] [PubMed]
- Marin, S.; Ramos, A.; Cano-Sancho, G.; Sanchis, V. Mycotoxins: Occurrence, toxicology, and exposure assessment. Food Chem. Toxicol. 2013, 60, 218–237. [Google Scholar] [CrossRef] [PubMed]
- Makowska, K.; Gonkowski, S.; Zielonka, L.; Dabrowski, M.; Calka, J. T2 Toxin-Induced Changes in Cocaine- and Amphetamine-Regulated Transcript (CART)-Like Immunoreactivity in the Enteric Nervous System within Selected Fragments of the Porcine Digestive Tract. Neurotox. Res. 2017, 31, 136–147. [Google Scholar] [CrossRef] [PubMed]
- Obremski, K.; Podlasz, P.; Zmigrodzka, M.; Winnicka, A.; Wozny, M.; Brzuzan, P.; Jakimiuk, E.; Wojtacha, P.; Gajecka, M.; Zielonka, L.; et al. The effect of T-2 toxin on percentages of CD4+, CD8+, CD4+CD8+ and CD21+ lymphocytes, and mRNA expression levels of selected cytokines in porcine ileal Peyer’s patches. Pol. J. Vet. Sci. 2013, 16, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Blanco, C.; Elmo, L.; Waldner, T.; Ruiz, M.J. Cytotoxic effects induced by patulin, deoxynivalenol and toxin T2 individually and in combination in hepatic cells (HepG2). Food Chem. Toxicol. 2018, 120, 12–23. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zhang, X.L.; Yao, Q.C.; Song, M.; Han, Y.F.; Shao, B.; Li, Y.F. T-2 toxin impairs male fertility by disrupting hypothalamic-pituitary-testis axis and declining testicular function in mice. Chemosphere 2019, 234, 909–916. [Google Scholar] [CrossRef]
- Caloni, F.; Ranzenigo, G.; Cremonesi, F.; Spicer, L.J. Effects of a trichothecene, T-2 toxin, on proliferation and steroid production by porcine granulosa cells. Toxicon 2009, 54, 337–344. [Google Scholar] [CrossRef]
- Quail, M.A.; Smith, M.; Coupland, P.; Otto, T.D.; Harris, S.R.; Connor, T.R.; Bertoni, A.; Swerdlow, H.P.; Gu, Y. A tale of three next generation sequencing platforms: Comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genom. 2012, 13, 341. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.K.; Mangalam, A.K.; Dwivedi, S.; Naik, S. Primer premier: Program for design of degenerate primers from a protein sequence. BioTechniques 1998, 24, 318–319. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Lv, Q.Z.; Liu, J.Y.; Qi, S.K.; Fu, D.G. miR-431 regulates granulosa cell function through the IRS2/PI3K/AKT signaling pathway. J. Reprod. Dev. 2020, 66, 231–239. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.J.L. Effect of Ras-MAPK Signaling Pathways on Protein Expression of STMN2 in Granulosa Cells by Hens Ovaries. J. Heilongjiang Aug. First Land Reclam. Univ. 2017, 29, 35–37+63. [Google Scholar] [CrossRef]
- Kim, M.S.; Park, H.R.; Park, M.; Kim, S.J.; Kwon, M.; Yu, B.P.; Chung, H.Y.; Kim, H.S.; Kwack, S.J.; Kang, T.S.; et al. Neurotoxic effect of 2,5-hexanedione on neural progenitor cells and hippocampal neurogenesis. Toxicology 2009, 260, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, T.; Okamoto, A.; Ikeda, M.; Tate, S.; Sumita, M.; Kawamoto, R.; Tonai, S.; Lee, J.Y.; Shimada, M.; Yamashita, Y. Cortisol induces follicle regression, while FSH prevents cortisol-induced follicle regression in pigs. Mol. Hum. Reprod. 2021, 27, gaab038. [Google Scholar] [CrossRef] [PubMed]
- Montaño, E.; Olivera, M.; Ruiz-Cortés, Z.T. Association Between Leptin, LH and its Receptor and Luteinization and Progesterone Accumulation (P4) in Bovine Granulosa Cell In Vitro. Reprod. Domest. Anim. 2009, 44, 699–704. [Google Scholar] [CrossRef]
- Janik, E.; Niemcewicz, M.; Podogrocki, M.; Ceremuga, M.; Stela, M.; Bijak, M. T-2 Toxin-The Most Toxic Trichothecene Mycotoxin: Metabolism, Toxicity, and Decontamination Strategies. Molecules 2021, 26, 6868. [Google Scholar] [CrossRef]
- Li, M.X.; Harkema, J.R.; Islam, Z.; Cuff, C.F.; Pestka, J.J. T-2 toxin impairs murine immune response to respiratory reovirus and exacerbates viral bronchiolitis. Toxicol. Appl. Pharmacol. 2006, 217, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Liu, P.L.; Cui, Y.L.; Xiao, B.N.; Liu, M.L.; Song, M.; Huang, W.Y.; Li, Y.F. Review of the Reproductive Toxicity of T-2 Toxin. J. Agric. Food. Chem. 2020, 68, 727–734. [Google Scholar] [CrossRef]
- Maruniakova, N.; Kadasi, A.; Sirotkin, A.V.; Bulla, J.; Kolesarova, A. T-2 toxin and its metabolite HT-2 toxin combined with insulin-like growth factor-I modify progesterone secretion by porcine ovarian granulosa cells. J. Environ. Sci. Health Part A-Toxic/Hazard. Subst. Environ. Eng. 2014, 49, 404–409. [Google Scholar] [CrossRef]
- Quiroga, M.A.; Itagaki, S.-I.; Doi, K. Early ultrastructural changes of thymocytes in T-2 toxicated mice. J. Toxicol. Pathol. 1993, 6, 109–112. [Google Scholar] [CrossRef]
- Shinozuka, J.; Li, G.; Kiatipattanasakul, W.; Uetsuka, K.; Nakayama, H.; Doi, K. T-2 toxin-induced apoptosis in lymphoid organs of mice. Exp. Toxicol. Pathol. 1997, 49, 387–392. [Google Scholar] [CrossRef] [PubMed]
- Fatima, Z.; Guo, P.; Huang, D.Y.; Lu, Q.R.; Wu, Q.H.; Dai, M.H.; Chen, G.Y.; Peng, D.P.; Tao, Y.F.; Ayub, M.; et al. The critical role of p16/Rb pathway in the inhibition of GH3 cell cycle induced by T-2 toxin. Toxicology 2018, 400, 28–39. [Google Scholar] [CrossRef]
- Rosenstein, Y.; Lafarge-Frayssinet, C. Inhibitory effect of Fusarium T2-toxin on lymphoid DNA and protein synthesis. Toxicol. Appl. Pharmacol. 1983, 70, 283–288. [Google Scholar] [CrossRef] [PubMed]
- Chaudhari, M.; Jayaraj, R.; Santhosh, S.R.; Rao, P.V.L. Oxidative Damage and Gene Expression Profile of Antioxidant Enzymes After T-2 Toxin Exposure in Mice. J. Biochem. Mol. Toxicol. 2009, 23, 212–221. [Google Scholar] [CrossRef]
- Guo, P.; Qiao, F.; Huang, D.Y.; Wu, Q.H.; Chen, T.L.; Badawy, S.; Cheng, G.Y.; Hao, H.H.; Xie, S.Y.; Wang, X. MiR-155-5p plays as a “janus” in the expression of inflammatory cytokines induced by T-2 toxin. Food Chem. Toxicol. 2020, 140, 111258. [Google Scholar] [CrossRef]
- Ling, A.R.; Sun, L.W.; Guo, W.B.; Sun, S.Y.; Yang, J.H.; Zhao, Z.H. Individual and combined cytotoxic effects of T-2 toxin and its four metabolites on porcine Leydig cells. Food Chem. Toxicol. 2020, 139, 111277. [Google Scholar] [CrossRef]
- Liu, A.M.; Xu, X.Q.; Hou, R.; Badawy, S.; Tao, Y.F.; Chen, D.M.; Ihsan, A.; Wang, X.; Wu, Q.H.; Yuan, Z.H. DNA methylation and RASSF4 expression are involved in T-2 toxin-induced hepatotoxicity. Toxicology 2019, 425, 152246. [Google Scholar] [CrossRef] [PubMed]
- Zeyen, L.; Seternes, O.M.; Mikkola, I. Crosstalk between p38 MAPK and GR Signaling. Int. J. Mol. Sci. 2022, 23, 3322. [Google Scholar] [CrossRef] [PubMed]
- Gramling, M.W.; Eischen, C.M. Suppression of Ras/Mapk pathway signaling inhibits Myc-induced lymphomagenesis. Cell Death Differ. 2012, 19, 1220–1227. [Google Scholar] [CrossRef] [PubMed]
- Reddy, D.; Kumavath, R.; Ghosh, P.; Barh, D. Lanatoside C induces G2/M cell cycle arrest and suppresses cancer cell growth by attenuating MAPK, Wnt, JAK-STAT, and PI3K/AKT/mTOR signaling pathways. Biomolecules 2019, 9, 792. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.-Y.; Park, H.-J. T-2 mycotoxin Induces male germ cell apoptosis by ROS-mediated JNK/p38 MAPK pathway. Ecotoxicol. Environ. Saf. 2023, 262, 115323. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Liu, B.; Li, J.; Liao, S.; Bi, Y.; Huang, W.; Yuan, L.; Yang, Y.; Qin, A. Talin1 regulates endometrial adhesive capacity through the Ras signaling pathway. Life Sci. 2021, 274, 119332. [Google Scholar] [CrossRef] [PubMed]
- Nystul, T.; Spradling, A. Regulation of Epithelial Stem Cell Replacement and Follicle Formation in the Drosophila Ovary. Genetics 2010, 184, 503–515. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.H.; Rivas, B.; Agoulnik, A.I. NOTCH1 Gain of Function in Germ Cells Causes Failure of Spermatogenesis in Male Mice. PLoS ONE 2013, 8, e71213. [Google Scholar] [CrossRef]
- Vanorny, D.A.; Prasasya, R.D.; Chalpe, A.J.; Kilen, S.M.; Mayo, K.E. Notch signaling regulates ovarian follicle formation and coordinates follicular growth. Mol. Endocrinol. 2014, 28, 499–511. [Google Scholar] [CrossRef]
- Kang, R.; Wang, M.; Shen, J.; Li, C. T-2 Toxin Induced Inflammatory Response of Intestinal Porcine Epithelial Cells by Activating Reactive Oxygen Species/Nuclear Factor-κB Signaling Pathway. Chin. J. Anim. Nutr 2021, 33, 474–483. (In Chinese) [Google Scholar] [CrossRef]
- He, S.; Chen, M.; Lin, X.; Lv, Z.; Liang, R.; Huang, L. Triptolide inhibits PDGF-induced proliferation of ASMCs through G0/G1 cell cycle arrest and suppression of the AKT/NF-κB/cyclinD1 signaling pathway. Eur. J. Pharmacol. 2020, 867, 172811. [Google Scholar] [CrossRef] [PubMed]
- Lyu, Z.; Qin, N.; Tyasi, T.L.; Zhu, H.; Liu, D.; Yuan, S.; Xu, R. The Hippo/MST pathway member SAV1 plays a suppressive role in development of the prehierarchical follicles in hen ovary. PLoS ONE 2016, 11, e0160896. [Google Scholar] [CrossRef] [PubMed]
- Plewes, M.R.; Hou, X.; Zhang, P.; Liang, A.; Hua, G.; Wood, J.R.; Cupp, A.S.; Lv, X.; Wang, C.; Davis, J.S. Yes-associated protein 1 is required for proliferation and function of bovine granulosa cells in vitro. Biol. Reprod. 2019, 101, 1001–1017. [Google Scholar] [CrossRef] [PubMed]
- Garner, J.M.; Fan, M.; Yang, C.H.; Du, Z.; Sims, M.; Davidoff, A.M.; Pfeffer, L.M. Constitutive activation of signal transducer and activator of transcription 3 (STAT3) and nuclear factor κB signaling in glioblastoma cancer stem cells regulates the Notch pathway. J. Biol. Chem. 2013, 288, 26167–26176. [Google Scholar] [CrossRef]
- Meng, L.; Wu, Z.F.; Zhao, K.; Tao, J.; Chit, T.; Zhang, S.Q.; Wang, C.C.; Teerds, K. Transcriptome Analysis of Porcine Granulosa Cells in Healthy and Atretic Follicles: Role of Steroidogenesis and Oxidative Stress. Antioxidants 2021, 10, 22. [Google Scholar] [CrossRef]
Gene Name | Primer Sequence (5′-3′) | Up/Down |
---|---|---|
ATM | CCTGCAAACCTTCATGTCCTAC | Down |
TTCTCCATTCCCGTTTCAACTG | ||
CCNE2 | AGGAATTGTTGGCCACCTGTA | Down |
CAAACATCCTGTGAGCATCCC | ||
SOS1 | GCAGAGGAACTGGCATTTGAC | Down |
AAATAAAGTGCCGCTCCAGG | ||
SORT1 | TGGGGCAGGAGCAGTTCTA | Down |
TGGTGCCAAATCCGGTATCT | ||
MRAS | ATGAGTGACGGGGATGTTGA | Down |
GAAGGCTTTGTCCACGTTGA | ||
AKT3 | AGGACCGCACACGTTTCTATG | Down |
CAACTTGAGATCCCGGTACACA | ||
BAD | CGGAGGATGAGTGACGAGTT | Up |
TTCCGGTACCACCAGGACT | ||
MAP3K4 | GTGGAGAATGCGGAGGAATAC | Up |
TGAAGGAGCACTGCACGTTTT | ||
BAX | AGCTGCAGAGGATGATCGC | Up |
CCAGTTGAAGTTGCCGTCAG | ||
PDPK1 | TGTGGGAGAACCTGCATCAT | Up |
TGGCTCAGGAGGTTGTCGTA | ||
RELA | CTGCCCCTAAAACCAACCAG | Up |
CACGGTCGGGTCAGTGTTAT | ||
GADD45B | GTGTCAGGAATGCAGCGACT | Up |
GGCTTTTCCAGGCATCTGTG | ||
GAPDH | ATTCCACCCACGGCAAGTT | GAPDH-F |
TTTGATGTTGGCGGGATCT | GAPDH-R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Zheng, X.; Zhou, R.; Zhang, H.; Liu, Y.; Hu, X.; Yin, Z. Mechanism of Apoptosis in Porcine Ovarian Granulosa Cells Triggered by T-2 Toxin. Genes 2024, 15, 579. https://0-doi-org.brum.beds.ac.uk/10.3390/genes15050579
Chen Y, Zheng X, Zhou R, Zhang H, Liu Y, Hu X, Yin Z. Mechanism of Apoptosis in Porcine Ovarian Granulosa Cells Triggered by T-2 Toxin. Genes. 2024; 15(5):579. https://0-doi-org.brum.beds.ac.uk/10.3390/genes15050579
Chicago/Turabian StyleChen, Yige, Xianrui Zheng, Ren Zhou, Huibin Zhang, Yangguang Liu, Xiaojing Hu, and Zongjun Yin. 2024. "Mechanism of Apoptosis in Porcine Ovarian Granulosa Cells Triggered by T-2 Toxin" Genes 15, no. 5: 579. https://0-doi-org.brum.beds.ac.uk/10.3390/genes15050579