Next Article in Journal
Cold Adapted Nitrosospira sp.: A Potential Crucial Contributor of Ammonia Oxidation in Cryosols of Permafrost-Affected Landscapes in Northeast Siberia
Previous Article in Journal
The Potential of Microbial Fuel Cells for Remediation of Heavy Metals from Soil and Water—Review of Application
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 7
Issue 12
10.3390/microorganisms7120698
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms

by
Christopher Concha
1,2,
Claudio D. Miranda
3,4,*,
Luz Hurtado
3 and
Jaime Romero
4,5
1
Laboratorio de Tecnología Enzimática para Bioprocesos (TEB), Universidad de La Serena, La Serena 1700000, Chile
2
Laboratorio de Silvigenómica y Biotecnología (SILGENBIO), Universidad de La Serena, La Serena 1700000, Chile
3
Laboratorio de Patobiología Acuática, Departamento de Acuicultura, Universidad Católica del Norte, Coquimbo 1780000, Chile
4
Centro AquaPacífico, Coquimbo 1780000, Chile
5
Laboratorio de Biotecnología, Instituto de Nutrición y Tecnología de los Alimentos (INTA), Universidad de Chile, Macul, Santiago 7810000, Chile
*
Author to whom correspondence should be addressed.
Microorganisms 2019, 7(12), 698; https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698
Submission received: 31 October 2019 / Revised: 22 November 2019 / Accepted: 3 December 2019 / Published: 14 December 2019
(This article belongs to the Section Environmental Microbiology)
Browse Figure
Versions Notes

Abstract

:
Despite their great importance for human therapy, quinolones are still used in Chilean salmon farming, with flumequine and oxolinic acid currently approved for use in this industry. The aim of this study was to improve our knowledge of the mechanisms conferring low susceptibility or resistance to quinolones among bacteria recovered from Chilean salmon farms. Sixty-five isolates exhibiting resistance, reduced susceptibility, or susceptibility to flumequine recovered from salmon farms were identified by their 16S rRNA genes, detecting a high predominance of species belonging to the Pseudomonas genus (52%). The minimum inhibitory concentrations (MIC) of flumequine in the absence and presence of the efflux pump inhibitor (EPI) Phe-Arg-β-naphthylamide and resistance patterns of isolates were determined by a microdilution broth and disk diffusion assays, respectively, observing MIC values ranging from 0.25 to >64 µg/mL and a high level of multi-resistance (96%), mostly showing resistance to florfenicol and oxytetracycline. Furthermore, mechanisms conferring low susceptibility to quinolones mediated by efflux pump activity, quinolone target mutations, or horizontally acquired resistance genes (qepA, oqxA, aac(6′)-lb-cr, qnr) were investigated. Among isolates exhibiting resistance to flumequine (≥16 µg/mL), the occurrence of chromosomal mutations in target protein GyrA appears to be unusual (three out of 15), contrasting with the high incidence of mutations in GyrB (14 out of 17). Bacterial isolates showing resistance or reduced susceptibility to quinolones mediated by efflux pumps appear to be highly prevalent (49 isolates, 75%), thus suggesting a major role of intrinsic resistance mediated by active efflux.

1. Introduction

The Chilean salmon farming industry is commonly affected by an important number of bacterial diseases causing high mortalities, consequently prompting the necessity of using high amounts of antibiotics to ensure salmon production [1,2]. However, it is well known that intensive use of antibiotics is responsible for therapy failures, probably due to a reduction in the susceptibility to antibacterials of the bacterial pathogens associated with this industry [2,3,4,5,6,7].
Quinolones are one of the most important classes of antimicrobials used in human therapy, but their use has been compromised by the increasing emergence of resistant isolates, becoming a prevalent clinical problem [8,9,10]. Quinolones inhibit the activity of DNA gyrase and topoisomerase IV, two essential bacterial enzymes that modulate the chromosomal supercoiling required for critical nucleic acid processes [11,12]. The main resistance mechanisms that additively contribute to quinolone resistance include one or a combination of target-site gene mutations that alter the drug-binding affinity of target enzymes, mutations that lead to reduced intracellular drug concentrations by either decreased uptake or increased efflux, and plasmid-encoded resistance genes that produce target protection proteins, drug-modifying enzymes, or multidrug efflux pumps [13,14,15,16].
Although quinolones are intensively used in human therapy, they are still currently used in aquaculture [2,17,18], and although the worldwide use of quinolones in the aquaculture industry has drastically decreased, the occurrence of bacteria resistant to this antibiotic group in fish farms has been previously detected [19,20,21]. Furthermore, quinolone resistance associated with target protective enzymes mainly encoded by the qnr genes as well as the quinolone-modifying enzymes encoded by the aac(6′)-lb-cr gene and the quinolone efflux pumps encoded by the qepA and oqxAB genes, which are usually associated with plasmids, have been previously detected among bacteria isolated from fish farm-associated environments [22,23,24,25]. To a greater extent, quinolone resistance has been described in several pathogenic bacterial species [22,26,27,28], but it has never been found in fish pathogenic species isolated from diseased fish.
Currently, the intracellular bacteria Piscirickettsia salmonis causes the highest rates of mortalities in Chilean marine farms [29], and the current absence of effective vaccines to prevent the high mortalities caused by this pathogen in the Chilean salmon farming industry has prompted the necessity of using large quantities of antimicrobials [1,2]. It should be noted that between 2005 and 2010, quinolones were widely used in Chilean salmon farms, reaching approximately 560 tons [2,30], but their use has been reduced considerably, with flumequine being the most used quinolone in Chilean salmon farms [1].
The emergence and dissemination of antibiotic-resistant bacteria in the fish farm-associated aquatic environments can be a serious threat for this industry. Thus, studies to advance a comprehensive knowledge of the mechanisms involved in quinolone resistance in the microbiota associated with fish culture will be of great value to develop efficient strategies to reduce antimicrobial resistance in Chilean salmon farms to prevent future therapy failures as well as to reduce the probability of their spread to the humans.

2. Materials and Methods

2.1. Bacterial Isolates and Culture Conditions

A total of 65 isolates exhibiting resistance, reduced susceptibility, or susceptibility to flumequine were included in the study. The bacterial isolates used in this study were recovered from various sources of land-based and lake-based Chilean salmonid farms, as previously described [31]. Isolates from land-based culture centers were isolated from various sources including unmedicated fish food pellets, mucus of healthy salmonid fingerlings, and water samples from fish farm influents, effluents, and fish rearing tanks. Isolates recovered from lake-based salmonid cultures were isolated from samples of mucus and intestinal content of healthy reared fingerlings, surface water samples from salmon cages, and samples of sediments beneath salmonid cages. Isolates were obtained from a collection of bacteria obtained from various salmonid farms. Isolates were previously recovered using plates with Tryptic soy agar (Difco labs) containing oxytetracycline (30 μg/mL) or florfenicol (30 μg/mL) and incubated at 22 °C for 5 days. Isolates were stored at −85 °C in CryoBankTM vials (Mast Diagnostica, Reinfeld, Germany) and were grown in Trypticase soy agar (Oxoid, Hants, UK) at 22 °C for 24 h prior to use.

2.2. Identification of Isolates

Isolates were cultured in Tryptic soy broth (Oxoid, Hants, UK) at 22 °C for 12–24 h and centrifuged at 9000 g for 3 min using an Eppendorf 5415D microcentrifuge to obtain a pellet. DNA extraction was carried out using the Wizard Genomic DNA Purification commercial kit (Promega, Madison, WI, USA) following the supplier’s instructions, and the obtained DNA samples were stored at −20 °C until analysis. The amplification of the 16S ribosomal genes of the isolates was carried out by PCR, following the methodology described by Opazo et al. [32]. The resulting amplified PCR products were sequenced by Macrogen (Rockville, MD, USA) using the ABI PRISM 373 DNA Sequencer (Applied Biosystems, Foster City, CA, USA). The sequences were edited and matched to the Ribosomal Database Project [33] to identify the bacterial isolates. Isolates exhibiting in their 16S rRNA gene sequence a similarity score of ≤99.4% with a nearest neighbor were not identified to the species level.

2.3. Minimum Inhibitory Concentrations (MICs) of Flumequine

The minimum inhibitory concentrations (MICs) of isolates to flumequine were determined by a broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) guideline M07-A10 [34]. Conical bottom 96-well microplates containing 0.1 mL of Mueller-Hinton broth (BBL-Becton Dickinson, Cockeysville, USA) were inoculated in triplicate with duplicate concentrations of flumequine (Sigma-Aldrich, Darmstadt, Germany) ranging from 0.0625 µg/mL to 64 µg/mL. Bacterial culture suspensions grown at exponential phase were adjusted at a 0.5 McFarland turbidity (1 × 108 CFU/mL), and an aliquot of 0.01 mL of each bacterial suspension was inoculated into each well in triplicate. Microplates were incubated at 22 °C for 24 h according to CLSI guidelines [35]. The turbidity of the medium in each well was measured by using the Mindray MR-96A microplate reader at an optical density of 600 nm. The MIC was defined as the lowest concentration of flumequine capable of inhibiting visible growth in at least two wells. Three wells without the antibiotic were used as controls for bacterial growth for each strain, and Escherichia coli ATCC 25922 was used as a control strain as recommended by the CLSI [34]. Considering that no MIC breakpoints for flumequine are currently stated, we categorized the isolates using as a reference the flumequine epidemiological cut-off (ECOFF) value stated by European Committee on Antimicrobial Susceptibility Testing (EUCAST) [36] for Escherichia coli and Salmonella spp. (≤2 µg/mL for susceptible). We decided to consider susceptibility, reduced susceptibility, and resistance as those isolates exhibiting MIC values of ≤2 µg/mL, 4–8 µg/mL, and ≥16 µg/mL, respectively.

2.4. Antibacterial Resistance Patterns

The susceptibility of isolates to various antimicrobials was determined by a disk diffusion test according to the CLSI [37]. Briefly, the bacterial isolates were resuspended in phosphate buffered saline (PBS) to obtain a turbidity corresponding to 0.5 McFarland standard (bioMerieux, Marcy-l’Etoile, France). Bacterial suspensions were seeded in plates containing Mueller-Hinton agar (MH, Difco Labs, NJ, USA) and the suspension excess was discarded using a micropipette, and disks (Oxoid, Basingstoke, Hampshire, England) containing the following antibiotics were used: cefotaxime (CTX, 30 μg), streptomycin (S, 10 μg), gentamicin (CN, 10 μg), kanamycin (K, 30 μg), oxytetracycline (OT, 30 μg), chloramphenicol (CM, 30 μg), florfenicol (FFC, 30 μg), oxolinic acid (OA, 2 μg), flumequine (UB, 30 μg), enrofloxacin (ENR, 5 μg), furazolidone (FR, 100 μg), and sulfamethoxazole trimethoprim (SXT, 25 μg). Plates were incubated at 22 °C for 24 h according to CLSI guidelines [38], and isolates were considered resistant according to the criteria established by the CLSI [34,39] or by Miranda and Rojas [20]. Escherichia coli ATCC 25922 was used as a quality control strain, as recommended by the CLSI [37]. A number of isolates (30%) were re-examined to check the reproducibility of the assay.

2.5. Detection of the Activity of Efflux Pumps

To detect the presence of efflux pump activity on flumequine, a modified methodology for the broth microdilution method described by Fernández-Alarcón et al. [40] was used. Briefly, the MIC assay was determined by a microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) guideline M07-A10 [34] and as previously described in the minimum inhibitory concentrations (MICs) in the flumequine section, but MIC assays were performed in the absence and the presence of 20 µg/mL of the broad spectrum efflux pump inhibitor (EPI) Phe-Arg β-naphthylamide (CAS 100929-99-5, Santa Cruz Biotechnology Inc., USA). Emax values were calculated, corresponding to the ratio between MIC without EPI and MIC in the presence of EPI [41]. Escherichia coli ATCC 25922 was included as a control strain, as recommended by the CLSI [34].

2.6. Detection of Mutations in DNA Gyrase and Topoisomerase IV Genes

Only isolates categorized as resistant and exhibiting a high MIC value (MIC ≥16 µg/mL) were considered for detection of mutations in the quinolone targets. To detect the presence of chromosomal mutations among these isolates, the sequence of the quinolone resistance determining region (QRDR) of the enzyme DNA gyrase (gyrA and gyrB genes) and the QRDR homologous section of the topoisomerase IV enzyme (parC and parE genes) were amplified by using the primers described in Table 1. The amplification conditions were as follows: for gyrA, denaturation at 94 °C for 5 min; 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and elongation at 72 °C for 1 min; and a final extension at 72 °C for 7 min; and for gyrB, denaturation at 95 °C for 5 min; 30 cycles of denaturation at 95 °C for 30 s, annealing at 49 °C for 30 s, and elongation at 72 °C for 1 min; and a final extension at 72 °C for 7 min. The amplification conditions used for parC and parE were denaturation at 95 °C for 5 min; 30 cycles of denaturation at 95 °C for 30 s, annealing at 54 °C for 30 s and elongation at 72 °C for 30 s; and finally extension at 72 °C for 7 min. The amplified PCR products were sequenced by Macrogen (Rockville, MD, USA); the amino acid sequences were obtained by using the BioEdit version 7.2.5 software (Ibis Therapeutics, Carlsbad, CA, United States) [42] and compared with the sequences described for the control strain Escherichia coli ATCC 9637 (GenBank: CP002185). For GyrA and ParC, a comparison from codon 69 to 110 was performed, whereas for GyrB and ParE, a comparison from codon 394 to 430 was performed.

2.7. Detection of Genes Encoding for Quinolone Resistance

All isolates were assayed for the presence of genes encoding for quinolone resistance. The presence of the qepA and oqxA genes, encoding for efflux pumps; the aac(6′)-Ib-cr gene, encoding for an aminoglycoside acetyltransferase that confers resistance by inactivating the antibiotic; and the qnr (qnrA, qnrB, qnrC, qnrD and qnrS) genes, encoding for Qnr proteins, conferring DNA gyrase protection were detected by using the methodology described by Albert et al. [54] using the primers shown in Table 1. The amplification conditions were as follows: for the qepA gene, denaturation at 95 °C for 5 min; 45 cycles of denaturation at 95 °C for 30 s, annealing at 54 °C for 30 s, and elongation at 72 °C for 30 s; and finally extension at 72 °C for 7 min. For the oqxA gene, denaturation at 95 °C for 5 min; 45 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s, and elongation at 72 °C for 30 s; and finally extension 72 °C for 7 min. For the aac(6′)-Ib-cr gene, denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s, and elongation at 72 °C for 30 s; and finally extension at 72 °C for 30 min. For the qnrA, qnrB and qnrS genes, denaturation at 95 °C (5 min), 35 cycles of 95 °C (30 s), 51 °C (30 s), and 72 °C (30 s); and finally extension at 72 °C (7 min). For the qnrC gene, denaturation at 95 °C (5 min), 35 cycles of 95 °C (30 s), 48 °C (30 s), and 72 °C (30 s); and finally extension at 72 °C (7 min). For the qnrD gene, denaturation step at 95 °C (5 min); 35 cycles of 95 °C (30 s), 50 °C (30 s), and 72 °C (30 s); and finally extension at 72 °C (7 min). The amplified PCR products were sequenced by Macrogen (Rockville, MD, USA), and genes were identified by a computational analysis of BLAST sequence alignment against the gene sequences included in the GenBank database.

2.8. Statistical Analysis

Significant differences between the presence of efflux systems and chromosomal mutations in the DNA gyrase of the isolates were determined by a proportion analysis [55] using the free access software RStudio version 1.2.5001 (RStudio Inc.). Analyses were carried out for all isolates included in the study as well as only for the flumequine-resistant isolates. Differences with a p ≤ 0.05 were considered significant.

3. Results

3.1. Bacterial Identification

Among the 65 isolates included in the study, a predominance of isolates belonging to various species of the genus Pseudomonas (34 isolates, 52%) and, to a lesser extent, some enteric species belonging to the Kluyvera (six isolates, 9%), Citrobacter (five isolates, 7%), and Hafnia (three isolates, 4%) genera were detected, as shown in Table 2. Sequences of amplified 16S rRNA genes of isolates were included in the GenBank database, and their accession numbers are included in Table 2.
It must be noted that among the isolates exhibiting MIC values of flumequine of ≥16 µg/mL, a high predominance (88.2%) of representatives of the genus Pseudomonas were observed, with the exception of the enteric species identified as Rahnella aquatilis and Kluyvera intermedia, which exhibited the highest flumequine MIC values (Table 2).

3.2. Antimicrobial Resistance of Isolates

A high incidence of resistance to the antibacterials chloramphenicol, florfenicol, and oxytetracycline (96.9%, 92.3%, and 81.5%, respectively) as well as a low incidence of resistance to gentamicin, furazolidone, and enrofloxacin (9.2%, 7.7%, and 4.6%, respectively) were detected among the isolates (Figure 1). In addition, a high occurrence of multiresistance or resistance to at least three classes of antibacterials was observed (63 isolates, 96%), showing a high proportion of isolates (55 isolates, 84%) presenting simultaneous resistance to five or more antibiotics. It was noted that a large number of isolates (48 isolates, 73%) exhibited simultaneous resistance to florfenicol and oxytetracycline and were mainly resistant to six or more antibiotics. Although no breakpoint values to categorize flumequine resistance are currently stated, all isolates categorized as resistant (17 isolates) using antibiogram results exhibited MIC values of ≥16 µg/mL (Table 2). A total of 28 isolates were resistant to oxolinic acid including 17 isolates resistant to flumequine and 10 isolates exhibiting a reduced susceptibility to flumequine (MIC of 8 µg/mL).
The MIC values of flumequine for the analyzed isolates ranged from 0.25 µg/mL to >64 µg/mL, with MIC50 and MIC90 values of 8 µg/mL and 64 µg/mL, respectively. The highest MIC values (≥64 µg/mL) were observed in six Pseudomonas isolates, one Kluyvera isolate, and one Rahnella isolate (Table 2). In addition, other high MIC values (32 µg/mL) were observed in two Pseudomonas isolates, whereas seven isolates of Pseudomonas exhibited MIC values of 16 µg/mL (Table 2). A number of 17 isolates were resistant to flumequine, exhibiting MIC values of ≥16 μg/mL and belonging to the Pseudomonas (15 isolates), Rahnella (one isolate), and Kluyvera (one isolate) genera, whereas 29 isolates exhibited a reduced susceptibility to flumequine (MIC of 4–8 µg/mL). Otherwise, 19 isolates exhibiting MIC values of ≤2 μg/mL and categorized as susceptible, but showing various levels of susceptibility (ranging from 0.25 to 2 µg/mL) were observed (Table 2).

3.3. Activity of Efflux Pumps

The results showed that the efflux pump inhibitor (EPI) decreased the MIC values of flumequine in a high percentage of the studied isolates (75%) (Table 2), demonstrating the active participation of efflux systems in quinolone resistance exhibited by isolates recovered from salmonid farms. In the presence of the EPI, the MIC values ranged from 0.0625 µg/mL to >64 µg/mL, with MIC50 and MIC90 values of 1 µg/mL and 8 µg/mL, respectively. Among the isolates exhibiting high MIC values (≥16 µg/mL), only the isolates Kluyvera intermedia OP29 and Rahnella aquatilis FM7 maintained MICs ≥64 µg/mL, and Pseudomonas vranovensis FR20 and Pseudomonas azotoformans FR27 (MIC of 16 µg/mL) maintained their MIC values in the presence of the EPI (Table 2). When the EPI was included in the MIC assay, the MIC values of 24 and 11 isolates were reduced by four and three times, respectively, whereas an MIC reduction of two times was detected in seven isolates. Otherwise, 16 isolates maintained their MIC values (Table 2). Among the 17 flumequine-resistant isolates, an increase in the susceptibility to flumequine was observed in 10 isolates, suggesting the occurrence of active efflux pumps, whereas the remaining seven isolates apparently did not exhibit efflux pump-mediated activity (Table 2). Furthermore, at least 43 isolates (66%) exhibiting reduced susceptibility or resistance to flumequine showed Emax values ≥4 (Table 2). Otherwise, as shown in Table 2, EPI induced hypersusceptibility to flumequine among an important number of fully susceptible isolates (15 out of 19). MIC values of flumequine of Escherichia coli ATCC 25922, were 0.5 µg/mL in the presence and absence of the EPI, within the acceptable range stated by CLSI [56].

3.4. Mutations in Quinolone Targets

Among the 17 flumequine-resistant isolates, no significant differences between the proportion of efflux systems and the presence of chromosomal mutations in the DNA gyrase (p = 0.6276) were observed. Thus, the probability of finding a resistance mechanism mediated by efflux systems or chromosomal mutations among the resistant isolates was not significantly different.
The detected amino acid substitutions exhibited by the flumequine-resistant isolates are shown in Table 3. A high number of flumequine-resistant isolates exhibited one to three mutations in the GyrB subunit of the DNA gyrase (14 isolates), and among these, five isolates showed a double mutation, leading to an amino acid substitution at positions 400 and 413 (according to the Escherichia coli numbering of protein sequence, which resulted in a Leu-to-Ile and Arg-to-Lys change, respectively), whereas the other two resistant isolates also exhibited a third mutation at position 423, resulting in a Val-to-Gly substitution. Otherwise, seven resistant isolates exhibited a single mutation at position 417, resulting in a Leu-to-His change (Table 3).
Only the isolates Pseudomonas fluorescens 275, Kluyvera intermedia OP29, and Rahnella aquatilis FM7 exhibited a mutation in the GyrA subunit, leading to a single amino acid substitution of serine to isoleucine at position 83, and showing the highest MIC values, despite the absence of efflux pump activity. Only four resistant isolates showed a mutation in the ParC protein subunit of topoisomerase IV, and of these, P. fluorescens 275 and R. aquatilis FM7 also harbored a double mutation in the GyrA and GyrB subunits, whereas K. intermedia OP29 harbored a single mutation in GyrA, and Pseudomonas libanensis FP37 showed three mutations in the GyrB subunit; thus, no resistant mutants with a mutation in ParC alone were observed, and the amino acid substitution Ser-80 to either Ile or Leu (Escherichia coli numbering) was observed in three of these resistant isolates (Table 3).

3.5. Genes Encoding for Quinolone Resistance

None of the 65 studied isolates carried any of the assayed aac(6′)-Ib-cr, qepA, oqxA, qnrA, qnrS, qnrD, and qnrC genes, which confer low-level resistance to fluoroquinolones, and only the strain Citrobacter gillenii FP75 was found to carry a new variant of the qnrB gene (qnrB89). The complete sequence of this gene exhibited a similarity with the qnrB gene of 82% and 90% at the nucleotide and amino acid sequence level, respectively (unpublished results).

4. Discussion

The projected worldwide use of antibiotics in livestock is approximately 106,000 tons for 2030 [57]. In the aquaculture industry, the use of antibiotics has been commonly adopted as the first choice strategy for the control of bacterial fish pathogens, for which no effective vaccines are currently available. The intracellular pathogen P. salmonis, which is currently the most important cause of losses in marine Chilean salmon farms [29], is consequently becoming the main target for antibacterial therapy in Chilean salmon farms [1].
The use of quinolones is currently of great importance for human health, but they are also commonly used in aquaculture [2,17,58]. Although the use of quinolones has decreased in the Chilean farming industry, the occurrence of resistant bacteria in water and sediments impacted by fish farms has been previously reported [19,20,21,59]. Chile is the world’s second largest salmon producer, and quinolones, mainly flumequine, with an annual use rate of 1% (3.75 tons) in marine farms for 2017, are still used in this industry [1]. Furthermore, it has been reported that quinolones used in fish culture have a high persistence in sediments, evidencing that flumequine and oxolinic acid can persist in the surface sedimentary layer for at least 60 and 151 days, respectively, whereas in deeper sedimentary layers, these antibacterials can persist for more than 300 days [60,61].
The analysis of susceptibility to different antimicrobials revealed that a high percentage of studied isolates (96%) showed antimicrobial multiresistance, as was previously reported for isolates recovered from Chilean salmon farms [19,20,40]. The results of the present study showed a high occurrence of resistance to phenicols and tetracyclines, with 96.9% and 92.3% of the isolates exhibiting resistance to chloramphenicol and florfenicol, respectively, and 81.5% of isolates resistant to oxytetracycline. These results suggest the occurrence of a selective process as a consequence of the use of antimicrobials in Chilean fish farms, considering that a high percentage of the isolates (73.8%) exhibited simultaneous resistance to florfenicol and oxytetracycline, which are currently the most used antibiotics in Chilean salmon farms [1,2].
As previously mentioned, the most commonly reported mechanisms of resistance to quinolones include mutations in the antibiotic target enzymes and a decrease in the antibiotic accumulation within the bacteria by the activity of efflux systems [15]. In this study, 42 isolates (64.6%) showed efflux system activity conferring at least a two times decrease in the MIC value of flumequine, showing that significant resistance as well as a decreased susceptibility to flumequine are frequently mediated by efflux mechanisms. A high proportion of isolates exhibiting resistance to flumequine (MIC ≥ 16 µg/mL) harbored mutations in their DNA gyrase genes mostly in the gyrB gene, and most of them evidenced an efflux pump activity.
DNA gyrase has been described as the main target of quinolone action in Gram-negative bacteria [46]; thus, the presence of mutations in this enzyme is a critical factor in the emergence of high-level resistance [46,62]. In this study, only a single mutation in the GyrA subunit of the DNA gyrase of three resistant isolates was observed, corresponding to an amino acid substitution of serine by isoleucine at position 83. It must be noted that the substitution of serine 83 of the GyrA protein subunit has been widely described as conferring a high-level resistance to quinolones among various species including clinical E. coli isolates [13,43] and the fish pathogen Aeromonas salmonicida [63]. All of these isolates also harbored an amino acid substitution of serine by isoleucine or leucine at position 80 of the ParC subunit of topoisomerase IV. The change of the amino acid serine at position 80 by isoleucine or leucine is a non-conserved amino acid change, producing a modification in the external structure of the amino acid skeleton of the protein, thus decreasing the enzymatic affinity for the antibiotic, as was previously described in clinical isolates of Staphylococcus aureus and Escherichia coli [64]. Furthermore, it has been reported that simultaneous mutations in GyrA and ParC can confer high-level resistance to fluoroquinolones [61], as was observed in the isolates K. intermedia OP29, R. aquatilis FM7 and P. fluorescens 275, which showed mutations in both enzymes and exhibited the highest MIC values for flumequine, which was not affected by the pump inhibitor. It must be noted that R. aquatilis has been previously reported as a causative agent of sepsis in immunocompromised and immunocompetent human patients [65,66].
Giraud et al. [41] found a high correlation between the presence of a mutation at codon 87 of gyrA leading to an Asp-87 » Asn substitution and the level of resistance to quinolones among A. salmonicida isolates, but in this study, no presence of a mutation at codon 87 of gyrA in the studied isolates were observed. In contrast to many previous studies [41,63], the occurrence of gyrA mutations in most of the resistant isolates was unusual, thus requiring further studies to explain this phenomenon.
When flumequine-resistant isolates exhibited a single (Leu-417 to His-417) or double (Leu-400 to Ileu-400 and Arg-413 to Lys-413) mutation in the GyrB subunit of DNA gyrase, MIC values decreased by at least three times when the efflux pump inhibitor was administered, suggesting that these mutations in GyrB could be causative of an increase in the level of resistance to fluoroquinolones as a consequence of a synergistic activity with efflux pumps among the Chilean salmonid farming-associated bacteria. Thus, novel mutations producing the amino acid changes observed in the GyrB subunit are probably not directly associated with high-level resistance as occurs with mutations in the GyrA and ParC subunits. Most probably, a high-level of resistance is only observed when active efflux and gyrB mutations are contributing independently to phenotypic flumequine resistance. Similar results have been observed in various bacterial species of clinical importance, where amino acid changes in GyrB do not confer fluoroquinolone resistance [46,64].
As previously mentioned, the efflux systems were active in 75% of the studied isolates, demonstrating their role as the main mechanisms of resistance to quinolones in the resistant microbiota associated with Chilean salmon farms. The results suggests that active efflux contributes significantly to the intrinsic resistance of a high number of isolates, in agreement with Lomovskaya et al. [67], who previously demonstrated that inhibition of efflux pumps significantly decreased the level of intrinsic resistance in P. aeruginosa. It has been previously noted that approximately 10% of the genes carried by a bacterium encode efflux systems [68]. Thus, efflux systems are an integral component of bacterial membranes, usually showing a high distribution among the different bacterial genera, so it is not surprising that they are active in both low and high levels of resistance to quinolones [69].
Frequently, the presence of efflux systems with enhanced expression as a consequence of an antibiotic selection pressure can be accompanied by chromosomal mutations producing a synergistic activity, consequently conferring a high-level of resistance, as was previously demonstrated [70] and exhibited by some isolates included in this study such as P. fluorescens 275, which exhibited an MIC value of >64 µg/mL, mediated both by chromosomal mutations in GyrA and by the activity of efflux systems because this value decreased to 32 µg/mL in the presence of the efflux pump inhibitor. However, isolates P. vranovensis FR20 and P. azotoformans FR27 neither showed amino acid changes in DNA gyrase and topoisomerase IV, nor a decrease in their flumequine MIC values in the presence of the efflux pump inhibitor, suggesting that resistance is mediated by a mechanism not currently described or by the activity of other efflux pumps not inhibited by the used pump inhibitor. Regarding the efflux pumps inhibitors, considering that in the study the Phe-Arg-βNA efflux pump inhibitor was the only one assayed, it was not possible to elucidate the effect of other efflux pump inhibitors on the flumequine susceptibility of isolates. Otherwise, it must be noted that a decrease in the MIC values after the addition of efflux pump inhibitors was not able to confirm the existence of efflux pumps inhibitors, thus it can be presumed that efflux pumps play a major role in the intrinsic resistance to flumequine among the bacterial isolates.
Considering that qnr genes encoding for quinolone target protection are unable by themselves to confer high-level resistance to quinolones and are only able to decrease quinolone susceptibility, their detection is more difficult to achieve because most studies only include bacterial isolates that are selected by their expression of resistance to quinolones. Consequently, it must be noted that most of these studies usually do not include isolates exhibiting low levels of resistance to quinolones; thus, their role and prevalence in environments impacted by fish farms are probably underestimated. In this trend, these studies could only detect qnr genes in isolates harboring qnr genes when they were combined with other mechanisms such as chromosomal resistance mutations. In this study, only the isolate Citrobacter gilleni FP75 was found to carry a variant of qnrB gene (qnrB89), most probably located in the chromosome, as has been extensively reported for other variants of the qnrB genes found in Citrobacter spp. [71,72,73].
Furthermore, it would be interesting to detect the occurrence of the crpP gene mainly among the Pseudomonas species, which encodes for a protein capable of specifically conferring resistance to ciprofloxacin through an ATP-dependent mechanism that involves phosphorylation of the antibiotic [74]. This novel protein has never been detected among bacteria associated with aquaculture, and its activity on flumequine remains unknown.

5. Conclusions

This study provides evidence for the importance of the Chilean salmon farming-related environment as a reservoir of bacteria exhibiting resistance as well as a reduction in the levels of susceptibility to quinolones, showing that bacterial resistance to quinolones in isolates associated with Chilean salmon farming is mainly mediated by nonspecific efflux pumps and to a much lesser extent by chromosomal mutations in the GyrA and ParC quinolone targets, whereas a high predominance of mutations in the subunit GyrB of DNA gyrase was observed and commonly associated with presumptive efflux activity. The carriage of plasmid-encoded efflux pump genes or transferable extrachromosomal genes encoding for quinolone target protection such as qnr genes, which provide low-level fluoroquinolone resistance, is apparently rare, In conclusion, microbiota associated with the Chilean salmon farm environment and exhibiting resistance or low susceptibility to quinolones, are mostly composed by the Pseudomonas species that are apparently mostly intrinsic, thus not contributing to the spread of horizontally transferred genes encoding for resistance to quinolones in these environments.

Author Contributions

Conceptualization, C.C. and C.D.M.; Methodology, C.C. and C.D.M.; Software, C.C. and J.R.; Validation, C.C. and C.D.M.; Formal analysis, C.C. and L.H.; Investigation, C.C. and L.H.; Resources, C.D.M. and J.R.; Writing—original draft preparation, C.C., C.D.M., and J.R.; Writing—review and editing, C.C. and C.D.M.; Visualization, C.C. and C.D.M.; Supervision, C.D.M. and J.R.; Project administration, C.D.M.; Funding acquisition, C.D.M.

Funding

This research was partially funded by the Science and Technology National Council (CONICYT) of Chile, grant number 1040924. Christopher Concha was supported by the PhD fellowship of the Science and Technology National Council (CONICYT) of Chile, grant number 21130017.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. SERNAPESCA. Informe Sobre Uso de Antimicrobianos en la Salmonicultura Nacional 2017. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sobre_uso_de_antimicrobianos_2017.pdf (accessed on 22 May 2019).
  2. Miranda, C.D.; Godoy, F.A.; Lee, M. Current status of the use of antibiotics and the antimicrobial resistance in the antimicrobial resistance in the Chilean salmon farms. Front. Microbiol. 2018, 9, 1284. [Google Scholar] [CrossRef] [PubMed]
  3. Miranda, C.D. Antimicrobial resistance in salmonid farming. In Antimicrobial Resistance in the Environment, 1st ed.; Monforts, H.M.M., Keen, P.L., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2012; Chapter 22; pp. 423–451. [Google Scholar]
  4. Henríquez, P.; Bohle, H.; Bustamante, F.; Bustos, P.; Mancilla, M. Polymorphism in gyrA is associated to quinolones resistance in Chilean Piscirickettsia salmonis field isolates. J. Fish Dis. 2015, 38, 415–418. [Google Scholar] [CrossRef] [PubMed]
  5. Henríquez, P.; Kaiser, M.; Bohle, H.; Bustos, P.; Mancilla, M. Comprehensive antibiotic susceptibility profiling of Chilean Piscirickettsia salmonis field isolates. J. Fish Dis. 2016, 39, 441–448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Miranda, C.D.; Smith, P.; Rojas, R.; Contreras-Lynch, S.; Vega, J.M.A. Antimicrobial susceptibility of Flavobacterium psychrophilum from Chilean salmon farms and their epidemiological cut-off values using agar dilution and disk diffusion methods. Front. Microbiol. 2016, 7, 1880. [Google Scholar] [CrossRef]
  7. Saavedra, J.; Grandón, M.; Villelobos-Gonzáles, J.; Bohle, H.; Bustos, P.; Mancilla, M. Isolation, functional characterization and transmissibility of p3PS10, a multidrug resistance plasmid of the fish pathogen Piscirickettsia salmonis. Front. Microbiol. 2018, 9, 923. [Google Scholar] [CrossRef]
  8. Dalhoff, A. Global fluoroquinolone resistance epidemiology and implications for clinical use. Interdiscip. Perspect. Infect. Dis. 2012, 2012, 976273. [Google Scholar] [CrossRef] [Green Version]
  9. Zheng, F.; Meng, X.-Z. Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients. Biomed. Res. 2017, 28, 7243–7247. [Google Scholar]
  10. Baker, S.; Thomson, N.; Weil, F.-X.; Holt, K.E. Genomic insights into the emergence and spread of antimicrobial-resistant bacterial pathogens. Science 2018, 360, 733–738. [Google Scholar] [CrossRef] [Green Version]
  11. Ashley, R.E.; Dittmore, A.; McPherson, S.A.; Turnbough, C.L., Jr.; Neuman, K.C.; Osheroff, N. Activities of gyrase and topoisomerase IV on positively supercoiled DNA. Nucleic Acids Res. 2017, 45, 9611–9624. [Google Scholar] [CrossRef] [Green Version]
  12. Correia, S.; Poeta, P.; Hébraud, M.; Capelo, J.L.; Igrejas, G. Mechanisms of quinolone action and resistance: Where do we stand? J. Med. Microbiol. 2017, 66, 551–559. [Google Scholar] [CrossRef]
  13. Ruiz, J. Mechanisms of resistance to quinolones: Target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother. 2003, 51, 1109–1117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Aldred, K.J.; Kerns, R.J.; Osheroff, N. Mechanism of quinolone action and resistance. Biochemistry 2014, 53, 1565–1574. [Google Scholar] [CrossRef] [PubMed]
  15. Fàbrega, A.; Madurga, S.; Giralt, E.; Vila, J. Mechanism of action of and resistance to quinolones. Microb. Biotechnol. 2009, 2, 40–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Hooper, D.C.; Jacoby, G.A. Mechanisms of drug resistance: Quinolone resistance. Ann. N. Y. Acad. Sci. 2015, 1354, 12–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Sapkota, A.; Sapkota, A.R.; Kucharski, M.; Burke, J.; McKenzie, S.; Walker, P.; Lawrence, R. Aquaculture practices and potential human health risks: Current knowledge and future priorities. Environ. Int. 2008, 34, 1215–1226. [Google Scholar] [CrossRef]
  18. Cabello, F.C.; Godfrey, H.P.; Tomova, A.; Ivanova, L.; Dölz, H.; Millanao, A.; Buschmann, A.H. Antimicrobial use in aquaculture re-examined: Its relevance to antimicrobial resistance and to animal and human health. Environ. Microbiol. 2013, 15, 1917–1942. [Google Scholar] [CrossRef]
  19. Miranda, C.D.; Zemelman, R. Antimicrobial multiresistance in bacteria isolated from freshwater Chilean salmon farms. Sci. Total Environ. 2002, 293, 207–218. [Google Scholar] [CrossRef]
  20. Miranda, C.D.; Rojas, R. Occurrence of florfenicol resistance in bacteria associated with two Chilean salmon farms with different history of antibacterial usage. Aquaculture 2007, 266, 39–46. [Google Scholar] [CrossRef]
  21. Buschmann, A.H.; Tomova, A.; López, A.; Maldonado, M.A.; Henríquez, L.A.; Ivanova, L.; Moy, F.; Godfrey, H.P.; Cabello, F.C. Salmon aquaculture and antimicrobial resistance in the marine environment. PLoS ONE 2012, 7, e42724. [Google Scholar] [CrossRef]
  22. Ishida, Y.; Ahmed, A.; Mahfouz, N.; Kimura, T.; El-Khodery, S.; Moawad, A.; Shimamoto, T. Molecular analysis of antimicrobial resistance in Gram-negative bacteria isolated from fish farms in Egypt. J. Vet. Med. Sci. 2010, 72, 727–734. [Google Scholar] [CrossRef] [Green Version]
  23. Takasu, H.; Suzuki, S.; Reungsang, A.; Pham, H.V. Fluoroquinolone (FQ) contamination does not correlate with occurrence of FQ-resistant bacteria in aquatic environments of Vietnam and Thailand. Microbes Environ. 2011, 26, 135–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Jiang, H.; Tang, D.; Liu, Y.; Zhang, X.; Zeng, Z.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of β-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef] [PubMed]
  25. Tomova, A.; Ivanova, L.; Buschmann, A.H.; Godfrey, H.P.; Cabello, F.C. Plasmid-mediated quinolone resistance (PMQR) genes and class 1 integrons in quinolone-resistant marine bacteria and clinical isolates of Escherichia coli from an aquacultural area. Microb. Ecol. 2018, 75, 104–112. [Google Scholar] [CrossRef] [PubMed]
  26. Poirel, L.; Liard, A.; Rodriguez-Martinez, J.M.; Nordmann, P. Vibrionaceae as a possible source of Qnr-like quinolone resistance determinants. J. Antimicrob. Chemother. 2005, 56, 1118–1121. [Google Scholar] [CrossRef]
  27. Xiong, X.; Bromley, E.H.C.; Oelschlaeger, P.; Woolfson, D.N.; Spencer, J. Structural insights into quinolone antibiotic resistance mediated by pentapeptide repeat proteins: Conserved surface loops direct the activity of a Qnr protein from a Gram-negative bacterium. Nucleic Acids Res. 2011, 39, 3917–3927. [Google Scholar] [CrossRef] [Green Version]
  28. Pons, M.J.; Gomes, C.; Ruiz, J. QnrVC, a new transferable Qnr-like family. Enferm. Infecc. Microbiol. Clin. 2013, 31, 191–192. [Google Scholar] [CrossRef]
  29. SERNAPESCA. Informe Sanitario de Salmonicultura en Centros Marinos 2016. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sanitario_salmonicultura_en_centros_marinos_2018_final.pdf (accessed on 22 May 2019).
  30. SERNAPESCA. Informe Sobre Uso de Antimicrobianos en la Salmonicultura Nacional 2010. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sobre_uso_de_antimicrobianos_2010.pdf (accessed on 22 May 2019).
  31. Domínguez, M.; Miranda, C.D.; Fuentes, O.; de la Fuente, M.; Godoy, F.A.; Bello-Toledo, H.; González-Rocha, G. Occurrence of transferable integrons and sul and dfr genes among sulfonamide-and/or trimethoprim-resistant bacteria isolated from Chilean salmonid farms. Front. Microbiol. 2019, 10, 748. [Google Scholar] [CrossRef]
  32. Opazo, R.; Ortúzar, F.; Navarrete, P.; Espejo, R.; Romero, J. Reduction of soybean meal non-starch polysaccharides and α-Galactosides by solid-state fermentation using cellulolytic bacteria obtained from different environments. PLoS ONE 2012, 7, e44783. [Google Scholar] [CrossRef]
  33. Ribosomal Database Project. Available online: http://rdp.cme.msu.edu/ (accessed on 22 November 2019).
  34. CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard—Tenth Edition; M07-A10; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2015. [Google Scholar]
  35. CLSI. Methods for Broth Dilution Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Approved Guideline M49-A; Number 24; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2006; Volume 26. [Google Scholar]
  36. European Committee on Antimicrobial Susceptibility Testing (EUCAST). Available online: https://mic.eucast.org/Eucast2/ (accessed on 22 November 2019).
  37. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Test; Approved Standard—Twelfth Edition; M02-A12; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2015. [Google Scholar]
  38. CLSI. Methods for Antimicrobial Disk Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Approved Guideline VET03-A; Number 23; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2006; Volume 26. [Google Scholar]
  39. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; CLSI Supplement VET08; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2018. [Google Scholar]
  40. Fernández-Alarcón, C.; Miranda, C.D.; Singer, R.S.; López, Y.; Rojas, R.; Bello, H.; Domínguez, M.; González-Rocha, G. Detection of the floR gene in a diversity of florfenicol resistant Gram-negative bacilli from freshwater salmon farms in Chile. Zoonoses Public Health 2010, 57, 181–188. [Google Scholar] [CrossRef]
  41. Giraud, E.; Blanc, G.; Bouju-Albert, A.; Weill, F.-X.; Donnay-Moreno, C. Mechanisms of quinolone resistance and clonal relationship among Aeromonas salmonicida strains isolated from reared fish with furunculosis. J. Med. Microbiol. 2004, 53, 895–901. [Google Scholar] [CrossRef] [Green Version]
  42. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  43. Weigel, L.M.; Steward, C.D.; Tenover, F.D. gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrob. Agents Chemother. 1998, 42, 2661–2667. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Brown, J.C.; Ames, S.G. Quinolone resistance. Methods Mol. Med. 1998, 15, 617–639. [Google Scholar] [CrossRef] [PubMed]
  45. Akasaka, T.; Tanaka, M.; Yamaguchi, A.; Sato, K. Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: Role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob. Agents Chemother. 2001, 45, 2263–2268. [Google Scholar] [CrossRef] [Green Version]
  46. De la Fuente, M.; Dauros, P.; Bello, H.; Domínguez, M.; Mella, S.; Sepúlveda, M.; Zemelman, R.; González, G. Mutaciones en genes gyrA y gyrB en cepas de bacilos Gram negativos aislados en hospitales chilenos y su relación con la resistencia a fluoroquinolonas. Rev. Méd. Chile 2007, 135, 1103–1110. [Google Scholar] [CrossRef] [Green Version]
  47. Rodríguez-Martínez, J.M.; Velasco, C.; Pascual, A.; García, I.; Martínez-Martínez, L. Correlation of quinolone resistance levels and differences in basal and quinolone-induced expression from three qnrA-containing plasmids. Clin. Microbiol. Infect. 2006, 12, 440–445. [Google Scholar] [CrossRef] [Green Version]
  48. Komp, P.; Karlsson, Å.; Hughes, D. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob. Agents Chemother. 2003, 47, 3222–3232. [Google Scholar] [CrossRef] [Green Version]
  49. Robicsek, A.; Strahilevitz, J.; Jacoby, G.A.; Macielag, M.; Abbanat, D.; Park, C.H.; Bush, K.; Hooper, D.C. Fluoroquinolone modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006, 12, 83–88. [Google Scholar] [CrossRef]
  50. Wang, M.; Guo, Q.; Xu, X.; Wang, X.; Ye, X.; Wu, S.; Hooper, D.C. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 2009, 53, 1892–1897. [Google Scholar] [CrossRef] [Green Version]
  51. Cavaco, L.M.; Hasman, H.; Xia, S.; Aarestrup, F.M. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovis morbificans strains of human origin. Antimicrob. Agents Chemother. 2009, 53, 603–608. [Google Scholar] [CrossRef] [Green Version]
  52. Cattoir, V.; Poirel, L.; Mazel, D.; Soussy, C.J.; Nordmann, P. Vibrio splendidus as the source of plasmid-mediated QnrS-like quinolone resistance determinants. Antimicrob. Agents Chemother. 2007, 51, 2650–2651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. El-Badawy, M.F.; Tawakol, W.M.; El-Far, S.W.; Maghrabi, I.A.; Al-Ghamdi, S.A.; Mansy, M.S.; Ashour, M.S.; Shohayeb, M.M. Molecular identification of aminoglycoside-modifying enzymes and plasmid-mediated quinolone resistance genes among Klebsiella pneumoniae clinical isolates recovered from Egyptian patients. Int. J. Microbiol. 2017, 16, 8050432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Albert, M.; Yagüe, G.; Fernández, M.; Viñuela, L.; Segovia, M.; Muñoz, J.L. Prevalence of plasmid-mediated quinolone resistance determinants in extended-spectrum β-lactamase-producing and -non-producing enterobacteria in Spain. Int. J. Antimicrob. Agents 2014, 43, 390–391. [Google Scholar] [CrossRef] [PubMed]
  55. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2016; Available online: http://www.r-project.org (accessed on 22 May 2019).
  56. CLSI. Performance Standards for Antimicrobial Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Second Informational Supplement; CLSI document VET03/VET04-S2; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2014. [Google Scholar]
  57. Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Lalumera, G.M.; Calamari, D.; Galli, P.; Castiglioni, S.; Crosa, G.; Fanelli, R. Preliminary investigation on the environmental occurrence and effects of antibiotics used in aquaculture in Italy. Chemosphere 2004, 54, 661–668. [Google Scholar] [CrossRef]
  59. Shah, S.; Cabello, F.C.; L’Abée-Lund, T.; Tomova, A.; Godfrey, H.; Buschmann, A.; Sørum, H. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites. Environ. Microbiol. 2014, 16, 1310–1320. [Google Scholar] [CrossRef]
  60. Björklund, H.; Bondestam, J.; Bylund, G. Residues of oxytetracycline in wild fish and sediments from fish farms. Aquaculture 1990, 86, 359–367. [Google Scholar] [CrossRef]
  61. Hektoen, H.; Berge, J.A.; Hormazabal, V.; Yndestad, M. Persistence of antibacterial agents in marine sediments. Aquaculture 1995, 133, 175–184. [Google Scholar] [CrossRef]
  62. Jacoby, G.A. Mechanisms of resistance to quinolones. Clin. Infect. Dis. 2005, 41, 120–126. [Google Scholar] [CrossRef] [Green Version]
  63. Oppegaard, H.; Sørum, H. gyrA mutation in quinolone-resistant isolates of the fish pathogen Aeromonas salmonicida. Antimicrob. Agents Chemother. 1994, 38, 2460–2464. [Google Scholar] [CrossRef] [Green Version]
  64. Sierra, J.M.; Cabeza, J.G.; Ruiz, M.; Montero, T.; Hernandez, J.; Mensa, J.; Llagostera, M.; Vila, J. The selection of resistance to and the mutagenicity of different fluoroquinolones in Staphylococcus aureus and Streptococcus pneumoniae. Clin. Microbiol. Infect. 2005, 11, 750–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Chang, C.L.; Jeong, J.; Shin, J.H.; Lee, E.Y.; Son, H.C. Rahnella aquatilis sepsis in an immunocompetent adult. J. Clin. Microbiol. 1999, 37, 4161–4162. [Google Scholar] [PubMed]
  66. Tash, K. Rahnella aquatilis bacteremia from a suspected urinary source. J. Clin. Microbiol. 2005, 43, 2526–2528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Lomovskaya, O.; Warren, M.S.; Lee, A.; Galazzo, J.; Fronko, R.; Lee, M.; Blais, J.; Cho, D.; Chamberland, S.; Renau, T.; et al. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: Novel agents for combination therapy. Antimicrob. Agents Chemother. 2001, 45, 105–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Webber, M.A.; Piddock, L.J. The importance of efflux pumps in bacterial antibiotic resistance. J. Antimicrob. Chemother. 2003, 51, 9–11. [Google Scholar] [CrossRef] [PubMed]
  69. Tavio, M.; Vile, J.; Ruiz, J.; Martín-Sánchez, A.M.; Jiménez de Anta, M.T. Decreased permeability and enhanced proton dependent active efflux in the development of resistance to quinolones in Morganella morganii strains. Int. J. Antimicrob. Agents 2000, 14, 157–160. [Google Scholar] [CrossRef]
  70. Taneja, N.; Mishra, A.; Kumar, A.; Verma, G.; Sharma, M. Enhanced resistance to fluoroquinolones in laboratory-grown mutants and clinical isolates of Shigella due to synergism between efflux pump expression and mutations in quinolone resistance determining region. Indian J. Med. Res. 2015, 141, 81–89. [Google Scholar] [CrossRef]
  71. Jacoby, G.A.; Griffin, C.M.; Hooper, D.C. Citrobacter spp. as a source of qnrB alleles. Antimicrob. Agents Chemother. 2011, 55, 4979–4984. [Google Scholar] [CrossRef] [Green Version]
  72. Saga, T.; Sabtcheva, S.; Mitsutake, K.; Ishii, Y.; Tateda, K.; Yamaguchi, K.; Kaku, M. Characterization of qnrB-like genes in Citrobacter species of the American type culture collection. Antimicrob. Agents Chemother. 2013, 57, 2863–2866. [Google Scholar] [CrossRef] [Green Version]
  73. Campos, M.J.; Palomo, G.; Hormeño, L.; Rodrigues, A.P.; Sánchez-Benito, R.; Píriz, S.; Quesada, A. Detection of QnrB54 and its novel genetic context in Citrobacter freundii isolated from a clinical case. Antimicrob. Agents Chemother. 2015, 59, 1375–1376. [Google Scholar] [CrossRef] [Green Version]
  74. Chávez-Jacobo, V.M.; Hernández-Ramírez, K.C.; Romo-Rodríguez, P.; Pérez-Gallardo, R.V.; Campos-García, J.; Gutiérrez-Corona, J.F.; García-Merinos, J.P.; Meza-Carmen, V.; Silva-Sánchez, J.; Ramírez-Díaz, M.I. CrpP is a novel ciprofloxacin-modifying enzyme encoded by the Pseudomonas aeruginosa pUM505 plasmid. Antimicrob. Agents Chemother. 2018, 62, e02629-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Microorganisms 07 00698 g001 550
Figure 1. Antibacterial resistance of studied strain (n = 65) used in the study. CTX, Cefotaxime; S, Streptomycin; CN, Gentamicin; K, Kanamycin; OT, Oxytetracycline; CM, Chloramphenicol; FFC, Florfenicol; OA, Oxolinic acid; UB, Flumequine; ENR, Enrofloxacin; FR, Furazolidone; SXT, Sulfamethoxazole-trimethoprim.
Figure 1. Antibacterial resistance of studied strain (n = 65) used in the study. CTX, Cefotaxime; S, Streptomycin; CN, Gentamicin; K, Kanamycin; OT, Oxytetracycline; CM, Chloramphenicol; FFC, Florfenicol; OA, Oxolinic acid; UB, Flumequine; ENR, Enrofloxacin; FR, Furazolidone; SXT, Sulfamethoxazole-trimethoprim.
Microorganisms 07 00698 g001
Table
Table 1. Primers used in the study.
Table 1. Primers used in the study.
GeneForward (5′-3′)Reverse (5′–3′)Amplicon Size (bp)Reference
16SAGAGTTTGATCCTGGCTCAGGGTTACCTTGTTACGACTT1200–1500[32]
gyrA *AAATCTGCCCGTGTCGTTGGTGCCATACCTACGGCGATACC344[43]
TACACCGGTCAACATTGAGGTTAATGATTGCCGCCGTCGG629[43]
GAGCTGGGCAACGACTGGAACAAGCCCGATACCGCTGGAACCGTTGACCAGCAG363[44]
gyrB *GGACAAAGAAGGCTACAGCACGTCGCGTTGTACTCAGATA850[45]
TGCTGTGGTAGCGCAGTTTAGCAGATGAACGAACTGCTGA425[46]
GTGAAATGACGCGTCGTAAGCGAATGTGTGAACCATCGAC355[46]
parC *CTGAATGCCAGCGCCAAATTGCGAACGATTTCGGATCGTC168[47]
GTCACTTTTTGCARCTCYTCTGAGCAGAAACTGCTGATG384This study
GGCGCAGTTTGATCTTACGATAACGCCCGTGTGATGC250This study
CAACTACTCGATGTACGTVATCGAAGGACTTGGGRTCRT290This study
parE *GACCGAAAGCTACGTCAACCGTTCGGATCAAGCGTGGTTT932[48]
ATCTTCCGCAGACAGCTTCAGGTAAACGCAATACCGGHAC450This study
ATATCTTCCGCCGACAGCTTGGACCAGCGTCCACTTCTG440This study
GATCAGGTTGACGTARCTYTGTCGGCAAGCGCAAYACC330This study
qnrAATTTCTCACGCCAGGATTTGGATCGGCAAAGGTTAGGTCA516[49]
qnrBGATCGTGAAAGCCAGAAAGGACGATGCCTGGTAGTTGTCC469[49]
qnrCGGGTTGTACATTTATTGATCCACTTTACGAGGTTCT447[50]
qnrDCGAGATCAATTTACGGGGAATAAACAAGCTGAAGCGCCTG582[51]
qnrSGCAAGTTCATTGAACAGGGTTCTAAACCGTCGAGTTCGGCG428[52]
qepAAACTGCTTGAGCCCGTAGATGTCTACGCCATGGACCTCAC596[53]
oqxACTCGGCGCGATGATGCTCCACTCTTCACGGGAGACGA390[53]
aac(6′)-lb-crTTGCGATGCTCTATGAGTGGCTACTCGAATGCCTGGCGTGTTT482[53]
* Chromosomal mutations were investigated only in isolates exhibiting resistance to flumequine according to their antibiograms, and MIC values of ≥16 µg/mL.
Table
Table 2. Identification, source, antibiotic resistance, and minimum inhibitory concentrations (MIC) of flumequine (FLU) of isolates.
Table 2. Identification, source, antibiotic resistance, and minimum inhibitory concentrations (MIC) of flumequine (FLU) of isolates.
StrainSourceAccess NoClosest Species (% Identity)MIC FLU (µg/mL)EmaxResistance Pattern
Without EPIWith EPI
275Fingerling mucusMH620734.1Pseudomonas fluorescens (99.7)>6432>2CM-FFC-OT-OA-UB-ENR-FR-SXT
FB13Fingerling mucusKX279647.1Pseudomonas putida (99.9)>648>8CTX-CM-FFC-OA-UB-FR-SXT
FM7Fingerling mucusMH620756.1Rahnella aquatilis (99.7)>64>64NDS-CM-FFC-OT-OA-UB-FR
FR34Fingerling mucusKX279664.1Pseudomonas baetica (99.5)>640.5>128CTX-CM-FFC-OA-UB-ENR-FR-SXT
OP29Under-cage sedimentKX279666.1Kluyvera intermedia (99.6)>64>64NDS-CM-FFC-OT-OA-UB
FB15Fingerling mucusKX279648.1Pseudomonas putida (99.9)64416CM-FFC-OA-UB-FR-SXT
FE24Intestinal contentMH620733.1Pseudomonas baetica (99.7)640.5128CTX-CM-FFC-OA-UB-FR-SXT
FP37Fingerling mucusKX279659.1Pseudomonas libanensis (99.9)6488S-K-CM-FFC-OT-OA-UB-FR-SXT
FB90Fingerling mucusMH620722.1Pseudomonas oryzihabitans (99.5)3248CM-FFC-OT-OA-UB-FR-SXT
FP42Fingerling mucusMH620723.1Pseudomonas oryzihabitans (99.3)32132CM-FFC-OA-UB-FR-SXT
118Fingerling mucusMH620730.1Pseudomonas migulae (99.2)160.2564CM-FFC-OT-OA-UB-FR-SXT
FM4Fingerling mucusKX279655.1Pseudomonas putida (99.6)16116CTX- S-CM-FFC-OT-OA-UB-FR-SXT
FM15Fingerling mucusKX279657.1Pseudomonas putida (99.2)16116S-CN-CM-FFC-OT-OA-UB-ENR-FR-SXT
FM22Cage waterKX279658.1Pseudomonas japonica (99.9)16116CTX-S-CN-K-CM-FFC-OT-OA-UB-FR-SXT
FP68Fingerling mucusMH620724.1Pseudomonas migulae (99.5)16116CTX-CM-FFC-OA-UB-FR-SXT
FR20Fingerling mucusMH620720.1Pseudomonas vranovensis (100.0)16161CTX-S-CM-FFC-OA-UB-FR-SXT
FR27Fingerling mucusKX279663.1Pseudomonas azotoformans (100.0)16161CTX-S-CM-FFC-OA-UB-FR-SXT
133Fingerling mucusMH620717.1Pseudomonas gessardii (99.8)881CM-FFC-OT-OA-FR-SXT
144Fingerling mucusMH620718.1Pseudomonas gessardii (99.7)881CTX-S-CM-FFC-OT-FR
145Fingerling mucusMH620729.1Pseudomonas fluorescens (99.6)881CM-FFC-OT-FR-SXT
167Fingerling mucusMH620747.1Acinetobacter johnsonii (99.0)881OT-OA
C2EffluentMH620749.1Stenotrophomonas maltophilia (99.5)842S-CM-OT-OA
C6InfluentMH620748.1Stenotrophomonas rhizophila (99.1)824CTX-S-CM-FFC-OT-OA-FR
FE22Intestinal contentMH620738.1Kluyvera intermedia (99.4)881S-CM-FFC-OT-FR
FE23Intestinal contentMH620739.1Kluyvera intermedia (98.7)80.12564S-K-CM-FFC-OT-FR
FF10Fingerling mucusMH620726.1Pseudomonas lurida (99.6)818CTX-CM-FFC-OA-FR-SXT
FF32Cage waterKX279652.1Pseudomonas putida (99.6)80.12564CM-FFC-OT-FR-SXT
FM2Cage waterKX279653.1Sphingobacterium anhuiense (99.3)842S-CN-K-CM-FFC-OT-OA-FR-SXT
FM26Fingerling mucusMH620736.1Kluyvera intermedia (99.8)842S-CN-K-CM-FFC-OT-OA-FR
FR50Fingerling mucusMH620721.1Pseudomonas lini (100.0)881CTX-CM-FFC-FR-SXT
OT30Fingerling mucusMH620725.1Pseudomonas poae (100.0)818CTX-CM-FFC-OT-OA-FR-SXT
OT42Fingerling mucusKX279667.1Pseudomonas fluorescens (99.9)80.516CTX-CM-FFC-OT-FR-SXT
SX37Under-cage sedimentMH620727.1Pseudomonas putida (99.6)80.12564S-CM-FFC-OA-FR-SXT
SX53Fingerling mucusMH620731.1Pseudomonas reinekei (99.9)80.12564CM-FFC-OT-FR-SXT
Q20Fingerling mucusKX279669.1Pseudomonas fluorescens (99.8)80.516CTX-S-CM-FFC-OT-OA-FR-SXT
Q23Fingerling mucusKX279670.1Pseudomonas fluorescens (100.0)80.516CTX-S-CM-FFC-OT-FR-SXT
177Fingerling mucusMH620735.1Pseudomonas fluorescens (99.1)40.58CM-FFC-OT-FR
227Fingerling mucusMH620728.1Pseudomonas fluorescens (100.0)40.12532CM-FFC-OT-FR-SXT
264EffluentMH620719.1Pseudomonas migulae (99.6)40.12532CTX-CM-FFC-OT-FR-SXT
CH3EffluentMH620740.1Kluyvera intermedia (99.7)40.2516S-CM-OT
FB133Fingerling mucusMH620751.1Lelliottia amnigena (99.2)40.58S-CM-FFC-OT
FE12Fingerling mucusMH620745.1Hafnia alvei (99.2)441CTX-S-CM-FFC-OT-FR
FE15Fingerling mucusMH620737.1Kluyvera intermedia (99.2)441S-K-CM-FFC-OT
Q11Rearing tank waterKX279668.1Pseudomonas migulae (99.8)40.062564CTX-CM-FFC-OT-FR-SXT
Q73InfluentMH620759.1Escherichia coli (99.4)40.062564S-CM-FFC-OT-SXT
SX57Fingerling mucusMH620732.1Pseudomonas fluorescens (99.6)40.58CTX-S-CM-FFC-OA-FR
CH83EffluentMH620755.1Serratia liquefaciens (99.5)212CM-FFC-OT-FR
FB38Fingerling mucusMH620742.1Citrobacter freundii (99.5)221S-K-CM-FFC-OT
FB98Fingerling mucusKX279649.1Citrobacter gillenii (99.8)221S-K-CM-FFC-OT-SXT
Q61EffluentMH620758.1Providencia vermicola (97.2)20.258CM-OT-FR
Q64EffluentKX279671.1Pseudomonas syringae (99.6)20.062532CM-FFC-OT-FR-SXT
FB1Fingerling mucusMH620750.1Lelliottia amnigena (97.1)10.062516S-CM-FFC-OT
FB11Fingerling mucusMH620741.1Citrobacter gillenii (99.8)10.254S-K-CM-FFC-OT
FB96Fingerling mucusMH620752.1Lelliottia amnigena (97.3)10.062516S-CM-FFC-OT
FE21Intestinal contentMH620754.1Serratia myotis (99.3)111S-K-CM-FFC-OT-FR
FM1Cage waterMH620753.1Enterobacter ludwigii (98.3)111S-CN-K-CM-FFC-OT-FR
OP21Under-cage sedimentMH620743.1Citrobacter braakii (99.5)10.254S-K-CM-FFC-OT-SXT
Q75Pelletized feedKX279673.1Acinetobacter johnsonii (99.7)10.254CM-FFC-OT-FR
FE20Intestinal contentMH620746.1Hafnia alvei (99.7)0.50.1254CTX-S-CM-FFC-OT-FR
FM3Cage waterMH620757.1Comamonas jiangduensis (99.9)0.50.1254S-CM-FFC-OT-SXT
233Cage waterMH424518.1Pseudomonas putida (98.4)0.250.06254CTX-CM-FFC-OT-FR-SXT
C11Pelletized feedMH620761.1Morganella psychrotolerans (99.6)0.250.1252OT
FE11Under-cage sedimentMH620744.1Hafnia alvei (99.6)0.250.06254CTX-S-CM-FFC-OT-FR
FM16Fingerling mucusMH620760.1Leclercia adecarboxylata (98.2)0.250.06254S-CN-CM-FFC-OT-FR
FP75Under-cage sedimentKX279662.1Citrobacter gillenii (99.6)0.250.1252S-CM-FFC-OT-FR-SXT
EPI: Efflux pump inhibitor; Emax: MIC without EPI/MIC in the presence of EPI; ND: Not determined; CTX: Cefotaxime; S: Streptomycin; K: Kanamycin; CN: Gentamicin; CM: Chloramphenicol; FFC: Florfenicol; OT: Oxytetracycline; OA: Oxolinic acid; UB: Flumequine; ENR: Enrofloxacin; FR: Furazolidone; SXT: Sulfamethoxazole-trimethoprim.
Table
Table 3. Aminoacidic substitutions in isolates exhibiting resistance to flumequine.
Table 3. Aminoacidic substitutions in isolates exhibiting resistance to flumequine.
StrainAminoacidic Substitution a
DNA GyraseTopoisomerase IV
Pseudomonas fluorescens 275GyrA: S83 by I; GyrB: L417 by HParC: Y74 by F; S80 by L; P98 by T
Pseudomonas putida FB13GyrB: L400 by I; R413 by K; V423 by GNone
Rahnella aquatilis FM7GyrA: S83 by I; GyrB: L417 by HParC: S80 by I
Pseudomonas baetica FR34GyrB: L417 by HNone
Kluyvera intermedia OP29GyrA: S83 by IParC: S80 by I
Pseudomonas putida FB15GyrB: L417 by HNone
Pseudomonas baetica FE24GyrB: L417 by HNone
Pseudomonas libanensis FP37GyrB: L400 by I; R413 by K; V423 by GParC: D101 by N
Pseudomonas oryzihabitans FB90GyrB: L417 by HNone
Pseudomonas sp. FP42GyrB: L400 by I; R413 by KNone
Pseudomonas sp. 118GyrB: L417 by HNone
Pseudomonas putida FM4GyrB: L400 by I; R413 by KNone
Pseudomonas sp. FM15GyrB: L400 by I; R413 by KNone
Pseudomonas japonica FM22GyrB: L400 by I; R413 by KNone
Pseudomonas migulae FP68GyrB: L400 by I; R413 by KNone
Pseudomonas vranovensis FR20NoneNone
Pseudomonas azotoformans FR27NoneNone
a: S, Serine; I, Isoleucine; L, Leucine; H, Histidine, Y, Tyrosine; F, Phenyl-alanine; P, Proline; T, Threonine; R, Arginine; K, Lysine; V, Valine; G, Glycine; D, Aspartic acid; N, Asparagine.

Share and Cite

MDPI and ACS Style

Concha, C.; Miranda, C.D.; Hurtado, L.; Romero, J. Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms. Microorganisms 2019, 7, 698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698

AMA Style

Concha C, Miranda CD, Hurtado L, Romero J. Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms. Microorganisms. 2019; 7(12):698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698

Chicago/Turabian Style

Concha, Christopher, Claudio D. Miranda, Luz Hurtado, and Jaime Romero. 2019. "Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms" Microorganisms 7, no. 12: 698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop