Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates and Culture Conditions
2.2. Identification of Isolates
2.3. Minimum Inhibitory Concentrations (MICs) of Flumequine
2.4. Antibacterial Resistance Patterns
2.5. Detection of the Activity of Efflux Pumps
2.6. Detection of Mutations in DNA Gyrase and Topoisomerase IV Genes
2.7. Detection of Genes Encoding for Quinolone Resistance
2.8. Statistical Analysis
3. Results
3.1. Bacterial Identification
3.2. Antimicrobial Resistance of Isolates
3.3. Activity of Efflux Pumps
3.4. Mutations in Quinolone Targets
3.5. Genes Encoding for Quinolone Resistance
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- SERNAPESCA. Informe Sobre Uso de Antimicrobianos en la Salmonicultura Nacional 2017. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sobre_uso_de_antimicrobianos_2017.pdf (accessed on 22 May 2019).
- Miranda, C.D.; Godoy, F.A.; Lee, M. Current status of the use of antibiotics and the antimicrobial resistance in the antimicrobial resistance in the Chilean salmon farms. Front. Microbiol. 2018, 9, 1284. [Google Scholar] [CrossRef] [PubMed]
- Miranda, C.D. Antimicrobial resistance in salmonid farming. In Antimicrobial Resistance in the Environment, 1st ed.; Monforts, H.M.M., Keen, P.L., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2012; Chapter 22; pp. 423–451. [Google Scholar]
- Henríquez, P.; Bohle, H.; Bustamante, F.; Bustos, P.; Mancilla, M. Polymorphism in gyrA is associated to quinolones resistance in Chilean Piscirickettsia salmonis field isolates. J. Fish Dis. 2015, 38, 415–418. [Google Scholar] [CrossRef] [PubMed]
- Henríquez, P.; Kaiser, M.; Bohle, H.; Bustos, P.; Mancilla, M. Comprehensive antibiotic susceptibility profiling of Chilean Piscirickettsia salmonis field isolates. J. Fish Dis. 2016, 39, 441–448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miranda, C.D.; Smith, P.; Rojas, R.; Contreras-Lynch, S.; Vega, J.M.A. Antimicrobial susceptibility of Flavobacterium psychrophilum from Chilean salmon farms and their epidemiological cut-off values using agar dilution and disk diffusion methods. Front. Microbiol. 2016, 7, 1880. [Google Scholar] [CrossRef]
- Saavedra, J.; Grandón, M.; Villelobos-Gonzáles, J.; Bohle, H.; Bustos, P.; Mancilla, M. Isolation, functional characterization and transmissibility of p3PS10, a multidrug resistance plasmid of the fish pathogen Piscirickettsia salmonis. Front. Microbiol. 2018, 9, 923. [Google Scholar] [CrossRef]
- Dalhoff, A. Global fluoroquinolone resistance epidemiology and implications for clinical use. Interdiscip. Perspect. Infect. Dis. 2012, 2012, 976273. [Google Scholar] [CrossRef] [Green Version]
- Zheng, F.; Meng, X.-Z. Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients. Biomed. Res. 2017, 28, 7243–7247. [Google Scholar]
- Baker, S.; Thomson, N.; Weil, F.-X.; Holt, K.E. Genomic insights into the emergence and spread of antimicrobial-resistant bacterial pathogens. Science 2018, 360, 733–738. [Google Scholar] [CrossRef] [Green Version]
- Ashley, R.E.; Dittmore, A.; McPherson, S.A.; Turnbough, C.L., Jr.; Neuman, K.C.; Osheroff, N. Activities of gyrase and topoisomerase IV on positively supercoiled DNA. Nucleic Acids Res. 2017, 45, 9611–9624. [Google Scholar] [CrossRef] [Green Version]
- Correia, S.; Poeta, P.; Hébraud, M.; Capelo, J.L.; Igrejas, G. Mechanisms of quinolone action and resistance: Where do we stand? J. Med. Microbiol. 2017, 66, 551–559. [Google Scholar] [CrossRef]
- Ruiz, J. Mechanisms of resistance to quinolones: Target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother. 2003, 51, 1109–1117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aldred, K.J.; Kerns, R.J.; Osheroff, N. Mechanism of quinolone action and resistance. Biochemistry 2014, 53, 1565–1574. [Google Scholar] [CrossRef] [PubMed]
- Fàbrega, A.; Madurga, S.; Giralt, E.; Vila, J. Mechanism of action of and resistance to quinolones. Microb. Biotechnol. 2009, 2, 40–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hooper, D.C.; Jacoby, G.A. Mechanisms of drug resistance: Quinolone resistance. Ann. N. Y. Acad. Sci. 2015, 1354, 12–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sapkota, A.; Sapkota, A.R.; Kucharski, M.; Burke, J.; McKenzie, S.; Walker, P.; Lawrence, R. Aquaculture practices and potential human health risks: Current knowledge and future priorities. Environ. Int. 2008, 34, 1215–1226. [Google Scholar] [CrossRef]
- Cabello, F.C.; Godfrey, H.P.; Tomova, A.; Ivanova, L.; Dölz, H.; Millanao, A.; Buschmann, A.H. Antimicrobial use in aquaculture re-examined: Its relevance to antimicrobial resistance and to animal and human health. Environ. Microbiol. 2013, 15, 1917–1942. [Google Scholar] [CrossRef]
- Miranda, C.D.; Zemelman, R. Antimicrobial multiresistance in bacteria isolated from freshwater Chilean salmon farms. Sci. Total Environ. 2002, 293, 207–218. [Google Scholar] [CrossRef]
- Miranda, C.D.; Rojas, R. Occurrence of florfenicol resistance in bacteria associated with two Chilean salmon farms with different history of antibacterial usage. Aquaculture 2007, 266, 39–46. [Google Scholar] [CrossRef]
- Buschmann, A.H.; Tomova, A.; López, A.; Maldonado, M.A.; Henríquez, L.A.; Ivanova, L.; Moy, F.; Godfrey, H.P.; Cabello, F.C. Salmon aquaculture and antimicrobial resistance in the marine environment. PLoS ONE 2012, 7, e42724. [Google Scholar] [CrossRef]
- Ishida, Y.; Ahmed, A.; Mahfouz, N.; Kimura, T.; El-Khodery, S.; Moawad, A.; Shimamoto, T. Molecular analysis of antimicrobial resistance in Gram-negative bacteria isolated from fish farms in Egypt. J. Vet. Med. Sci. 2010, 72, 727–734. [Google Scholar] [CrossRef] [Green Version]
- Takasu, H.; Suzuki, S.; Reungsang, A.; Pham, H.V. Fluoroquinolone (FQ) contamination does not correlate with occurrence of FQ-resistant bacteria in aquatic environments of Vietnam and Thailand. Microbes Environ. 2011, 26, 135–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, H.; Tang, D.; Liu, Y.; Zhang, X.; Zeng, Z.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of β-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef] [PubMed]
- Tomova, A.; Ivanova, L.; Buschmann, A.H.; Godfrey, H.P.; Cabello, F.C. Plasmid-mediated quinolone resistance (PMQR) genes and class 1 integrons in quinolone-resistant marine bacteria and clinical isolates of Escherichia coli from an aquacultural area. Microb. Ecol. 2018, 75, 104–112. [Google Scholar] [CrossRef] [PubMed]
- Poirel, L.; Liard, A.; Rodriguez-Martinez, J.M.; Nordmann, P. Vibrionaceae as a possible source of Qnr-like quinolone resistance determinants. J. Antimicrob. Chemother. 2005, 56, 1118–1121. [Google Scholar] [CrossRef]
- Xiong, X.; Bromley, E.H.C.; Oelschlaeger, P.; Woolfson, D.N.; Spencer, J. Structural insights into quinolone antibiotic resistance mediated by pentapeptide repeat proteins: Conserved surface loops direct the activity of a Qnr protein from a Gram-negative bacterium. Nucleic Acids Res. 2011, 39, 3917–3927. [Google Scholar] [CrossRef] [Green Version]
- Pons, M.J.; Gomes, C.; Ruiz, J. QnrVC, a new transferable Qnr-like family. Enferm. Infecc. Microbiol. Clin. 2013, 31, 191–192. [Google Scholar] [CrossRef]
- SERNAPESCA. Informe Sanitario de Salmonicultura en Centros Marinos 2016. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sanitario_salmonicultura_en_centros_marinos_2018_final.pdf (accessed on 22 May 2019).
- SERNAPESCA. Informe Sobre Uso de Antimicrobianos en la Salmonicultura Nacional 2010. Servicio Nacional de Pesca y Acuicultura: Valparaíso, Chile. Available online: http://www.sernapesca.cl/sites/default/files/informe_sobre_uso_de_antimicrobianos_2010.pdf (accessed on 22 May 2019).
- Domínguez, M.; Miranda, C.D.; Fuentes, O.; de la Fuente, M.; Godoy, F.A.; Bello-Toledo, H.; González-Rocha, G. Occurrence of transferable integrons and sul and dfr genes among sulfonamide-and/or trimethoprim-resistant bacteria isolated from Chilean salmonid farms. Front. Microbiol. 2019, 10, 748. [Google Scholar] [CrossRef]
- Opazo, R.; Ortúzar, F.; Navarrete, P.; Espejo, R.; Romero, J. Reduction of soybean meal non-starch polysaccharides and α-Galactosides by solid-state fermentation using cellulolytic bacteria obtained from different environments. PLoS ONE 2012, 7, e44783. [Google Scholar] [CrossRef]
- Ribosomal Database Project. Available online: http://rdp.cme.msu.edu/ (accessed on 22 November 2019).
- CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard—Tenth Edition; M07-A10; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2015. [Google Scholar]
- CLSI. Methods for Broth Dilution Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Approved Guideline M49-A; Number 24; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2006; Volume 26. [Google Scholar]
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Available online: https://mic.eucast.org/Eucast2/ (accessed on 22 November 2019).
- CLSI. Performance Standards for Antimicrobial Disk Susceptibility Test; Approved Standard—Twelfth Edition; M02-A12; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2015. [Google Scholar]
- CLSI. Methods for Antimicrobial Disk Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Approved Guideline VET03-A; Number 23; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2006; Volume 26. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; CLSI Supplement VET08; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2018. [Google Scholar]
- Fernández-Alarcón, C.; Miranda, C.D.; Singer, R.S.; López, Y.; Rojas, R.; Bello, H.; Domínguez, M.; González-Rocha, G. Detection of the floR gene in a diversity of florfenicol resistant Gram-negative bacilli from freshwater salmon farms in Chile. Zoonoses Public Health 2010, 57, 181–188. [Google Scholar] [CrossRef]
- Giraud, E.; Blanc, G.; Bouju-Albert, A.; Weill, F.-X.; Donnay-Moreno, C. Mechanisms of quinolone resistance and clonal relationship among Aeromonas salmonicida strains isolated from reared fish with furunculosis. J. Med. Microbiol. 2004, 53, 895–901. [Google Scholar] [CrossRef] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Weigel, L.M.; Steward, C.D.; Tenover, F.D. gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrob. Agents Chemother. 1998, 42, 2661–2667. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, J.C.; Ames, S.G. Quinolone resistance. Methods Mol. Med. 1998, 15, 617–639. [Google Scholar] [CrossRef] [PubMed]
- Akasaka, T.; Tanaka, M.; Yamaguchi, A.; Sato, K. Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: Role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob. Agents Chemother. 2001, 45, 2263–2268. [Google Scholar] [CrossRef] [Green Version]
- De la Fuente, M.; Dauros, P.; Bello, H.; Domínguez, M.; Mella, S.; Sepúlveda, M.; Zemelman, R.; González, G. Mutaciones en genes gyrA y gyrB en cepas de bacilos Gram negativos aislados en hospitales chilenos y su relación con la resistencia a fluoroquinolonas. Rev. Méd. Chile 2007, 135, 1103–1110. [Google Scholar] [CrossRef] [Green Version]
- Rodríguez-Martínez, J.M.; Velasco, C.; Pascual, A.; García, I.; Martínez-Martínez, L. Correlation of quinolone resistance levels and differences in basal and quinolone-induced expression from three qnrA-containing plasmids. Clin. Microbiol. Infect. 2006, 12, 440–445. [Google Scholar] [CrossRef] [Green Version]
- Komp, P.; Karlsson, Å.; Hughes, D. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob. Agents Chemother. 2003, 47, 3222–3232. [Google Scholar] [CrossRef] [Green Version]
- Robicsek, A.; Strahilevitz, J.; Jacoby, G.A.; Macielag, M.; Abbanat, D.; Park, C.H.; Bush, K.; Hooper, D.C. Fluoroquinolone modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006, 12, 83–88. [Google Scholar] [CrossRef]
- Wang, M.; Guo, Q.; Xu, X.; Wang, X.; Ye, X.; Wu, S.; Hooper, D.C. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 2009, 53, 1892–1897. [Google Scholar] [CrossRef] [Green Version]
- Cavaco, L.M.; Hasman, H.; Xia, S.; Aarestrup, F.M. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovis morbificans strains of human origin. Antimicrob. Agents Chemother. 2009, 53, 603–608. [Google Scholar] [CrossRef] [Green Version]
- Cattoir, V.; Poirel, L.; Mazel, D.; Soussy, C.J.; Nordmann, P. Vibrio splendidus as the source of plasmid-mediated QnrS-like quinolone resistance determinants. Antimicrob. Agents Chemother. 2007, 51, 2650–2651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-Badawy, M.F.; Tawakol, W.M.; El-Far, S.W.; Maghrabi, I.A.; Al-Ghamdi, S.A.; Mansy, M.S.; Ashour, M.S.; Shohayeb, M.M. Molecular identification of aminoglycoside-modifying enzymes and plasmid-mediated quinolone resistance genes among Klebsiella pneumoniae clinical isolates recovered from Egyptian patients. Int. J. Microbiol. 2017, 16, 8050432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albert, M.; Yagüe, G.; Fernández, M.; Viñuela, L.; Segovia, M.; Muñoz, J.L. Prevalence of plasmid-mediated quinolone resistance determinants in extended-spectrum β-lactamase-producing and -non-producing enterobacteria in Spain. Int. J. Antimicrob. Agents 2014, 43, 390–391. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2016; Available online: http://www.r-project.org (accessed on 22 May 2019).
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing of Bacteria Isolated from Aquatic Animals; Second Informational Supplement; CLSI document VET03/VET04-S2; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2014. [Google Scholar]
- Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lalumera, G.M.; Calamari, D.; Galli, P.; Castiglioni, S.; Crosa, G.; Fanelli, R. Preliminary investigation on the environmental occurrence and effects of antibiotics used in aquaculture in Italy. Chemosphere 2004, 54, 661–668. [Google Scholar] [CrossRef]
- Shah, S.; Cabello, F.C.; L’Abée-Lund, T.; Tomova, A.; Godfrey, H.; Buschmann, A.; Sørum, H. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites. Environ. Microbiol. 2014, 16, 1310–1320. [Google Scholar] [CrossRef]
- Björklund, H.; Bondestam, J.; Bylund, G. Residues of oxytetracycline in wild fish and sediments from fish farms. Aquaculture 1990, 86, 359–367. [Google Scholar] [CrossRef]
- Hektoen, H.; Berge, J.A.; Hormazabal, V.; Yndestad, M. Persistence of antibacterial agents in marine sediments. Aquaculture 1995, 133, 175–184. [Google Scholar] [CrossRef]
- Jacoby, G.A. Mechanisms of resistance to quinolones. Clin. Infect. Dis. 2005, 41, 120–126. [Google Scholar] [CrossRef] [Green Version]
- Oppegaard, H.; Sørum, H. gyrA mutation in quinolone-resistant isolates of the fish pathogen Aeromonas salmonicida. Antimicrob. Agents Chemother. 1994, 38, 2460–2464. [Google Scholar] [CrossRef] [Green Version]
- Sierra, J.M.; Cabeza, J.G.; Ruiz, M.; Montero, T.; Hernandez, J.; Mensa, J.; Llagostera, M.; Vila, J. The selection of resistance to and the mutagenicity of different fluoroquinolones in Staphylococcus aureus and Streptococcus pneumoniae. Clin. Microbiol. Infect. 2005, 11, 750–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.L.; Jeong, J.; Shin, J.H.; Lee, E.Y.; Son, H.C. Rahnella aquatilis sepsis in an immunocompetent adult. J. Clin. Microbiol. 1999, 37, 4161–4162. [Google Scholar] [PubMed]
- Tash, K. Rahnella aquatilis bacteremia from a suspected urinary source. J. Clin. Microbiol. 2005, 43, 2526–2528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lomovskaya, O.; Warren, M.S.; Lee, A.; Galazzo, J.; Fronko, R.; Lee, M.; Blais, J.; Cho, D.; Chamberland, S.; Renau, T.; et al. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: Novel agents for combination therapy. Antimicrob. Agents Chemother. 2001, 45, 105–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Webber, M.A.; Piddock, L.J. The importance of efflux pumps in bacterial antibiotic resistance. J. Antimicrob. Chemother. 2003, 51, 9–11. [Google Scholar] [CrossRef] [PubMed]
- Tavio, M.; Vile, J.; Ruiz, J.; Martín-Sánchez, A.M.; Jiménez de Anta, M.T. Decreased permeability and enhanced proton dependent active efflux in the development of resistance to quinolones in Morganella morganii strains. Int. J. Antimicrob. Agents 2000, 14, 157–160. [Google Scholar] [CrossRef]
- Taneja, N.; Mishra, A.; Kumar, A.; Verma, G.; Sharma, M. Enhanced resistance to fluoroquinolones in laboratory-grown mutants and clinical isolates of Shigella due to synergism between efflux pump expression and mutations in quinolone resistance determining region. Indian J. Med. Res. 2015, 141, 81–89. [Google Scholar] [CrossRef]
- Jacoby, G.A.; Griffin, C.M.; Hooper, D.C. Citrobacter spp. as a source of qnrB alleles. Antimicrob. Agents Chemother. 2011, 55, 4979–4984. [Google Scholar] [CrossRef] [Green Version]
- Saga, T.; Sabtcheva, S.; Mitsutake, K.; Ishii, Y.; Tateda, K.; Yamaguchi, K.; Kaku, M. Characterization of qnrB-like genes in Citrobacter species of the American type culture collection. Antimicrob. Agents Chemother. 2013, 57, 2863–2866. [Google Scholar] [CrossRef] [Green Version]
- Campos, M.J.; Palomo, G.; Hormeño, L.; Rodrigues, A.P.; Sánchez-Benito, R.; Píriz, S.; Quesada, A. Detection of QnrB54 and its novel genetic context in Citrobacter freundii isolated from a clinical case. Antimicrob. Agents Chemother. 2015, 59, 1375–1376. [Google Scholar] [CrossRef] [Green Version]
- Chávez-Jacobo, V.M.; Hernández-Ramírez, K.C.; Romo-Rodríguez, P.; Pérez-Gallardo, R.V.; Campos-García, J.; Gutiérrez-Corona, J.F.; García-Merinos, J.P.; Meza-Carmen, V.; Silva-Sánchez, J.; Ramírez-Díaz, M.I. CrpP is a novel ciprofloxacin-modifying enzyme encoded by the Pseudomonas aeruginosa pUM505 plasmid. Antimicrob. Agents Chemother. 2018, 62, e02629-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward (5′-3′) | Reverse (5′–3′) | Amplicon Size (bp) | Reference |
---|---|---|---|---|
16S | AGAGTTTGATCCTGGCTCAG | GGTTACCTTGTTACGACTT | 1200–1500 | [32] |
gyrA * | AAATCTGCCCGTGTCGTTGGT | GCCATACCTACGGCGATACC | 344 | [43] |
TACACCGGTCAACATTGAGG | TTAATGATTGCCGCCGTCGG | 629 | [43] | |
GAGCTGGGCAACGACTGGAACAAGCCC | GATACCGCTGGAACCGTTGACCAGCAG | 363 | [44] | |
gyrB * | GGACAAAGAAGGCTACAGCA | CGTCGCGTTGTACTCAGATA | 850 | [45] |
TGCTGTGGTAGCGCAGTTTA | GCAGATGAACGAACTGCTGA | 425 | [46] | |
GTGAAATGACGCGTCGTAAG | CGAATGTGTGAACCATCGAC | 355 | [46] | |
parC * | CTGAATGCCAGCGCCAAATT | GCGAACGATTTCGGATCGTC | 168 | [47] |
GTCACTTTTTGCARCTCYTC | TGAGCAGAAACTGCTGATG | 384 | This study | |
GGCGCAGTTTGATCTTACG | ATAACGCCCGTGTGATGC | 250 | This study | |
CAACTACTCGATGTACGTVAT | CGAAGGACTTGGGRTCRT | 290 | This study | |
parE * | GACCGAAAGCTACGTCAACC | GTTCGGATCAAGCGTGGTTT | 932 | [48] |
ATCTTCCGCAGACAGCTTCA | GGTAAACGCAATACCGGHAC | 450 | This study | |
ATATCTTCCGCCGACAGCTT | GGACCAGCGTCCACTTCTG | 440 | This study | |
GATCAGGTTGACGTARCTYT | GTCGGCAAGCGCAAYACC | 330 | This study | |
qnrA | ATTTCTCACGCCAGGATTTG | GATCGGCAAAGGTTAGGTCA | 516 | [49] |
qnrB | GATCGTGAAAGCCAGAAAGG | ACGATGCCTGGTAGTTGTCC | 469 | [49] |
qnrC | GGGTTGTACATTTATTGA | TCCACTTTACGAGGTTCT | 447 | [50] |
qnrD | CGAGATCAATTTACGGGGAATA | AACAAGCTGAAGCGCCTG | 582 | [51] |
qnrS | GCAAGTTCATTGAACAGGGT | TCTAAACCGTCGAGTTCGGCG | 428 | [52] |
qepA | AACTGCTTGAGCCCGTAGAT | GTCTACGCCATGGACCTCAC | 596 | [53] |
oqxA | CTCGGCGCGATGATGCT | CCACTCTTCACGGGAGACGA | 390 | [53] |
aac(6′)-lb-cr | TTGCGATGCTCTATGAGTGGCTA | CTCGAATGCCTGGCGTGTTT | 482 | [53] |
Strain | Source | Access No | Closest Species (% Identity) | MIC FLU (µg/mL) | Emax | Resistance Pattern | |
---|---|---|---|---|---|---|---|
Without EPI | With EPI | ||||||
275 | Fingerling mucus | MH620734.1 | Pseudomonas fluorescens (99.7) | >64 | 32 | >2 | CM-FFC-OT-OA-UB-ENR-FR-SXT |
FB13 | Fingerling mucus | KX279647.1 | Pseudomonas putida (99.9) | >64 | 8 | >8 | CTX-CM-FFC-OA-UB-FR-SXT |
FM7 | Fingerling mucus | MH620756.1 | Rahnella aquatilis (99.7) | >64 | >64 | ND | S-CM-FFC-OT-OA-UB-FR |
FR34 | Fingerling mucus | KX279664.1 | Pseudomonas baetica (99.5) | >64 | 0.5 | >128 | CTX-CM-FFC-OA-UB-ENR-FR-SXT |
OP29 | Under-cage sediment | KX279666.1 | Kluyvera intermedia (99.6) | >64 | >64 | ND | S-CM-FFC-OT-OA-UB |
FB15 | Fingerling mucus | KX279648.1 | Pseudomonas putida (99.9) | 64 | 4 | 16 | CM-FFC-OA-UB-FR-SXT |
FE24 | Intestinal content | MH620733.1 | Pseudomonas baetica (99.7) | 64 | 0.5 | 128 | CTX-CM-FFC-OA-UB-FR-SXT |
FP37 | Fingerling mucus | KX279659.1 | Pseudomonas libanensis (99.9) | 64 | 8 | 8 | S-K-CM-FFC-OT-OA-UB-FR-SXT |
FB90 | Fingerling mucus | MH620722.1 | Pseudomonas oryzihabitans (99.5) | 32 | 4 | 8 | CM-FFC-OT-OA-UB-FR-SXT |
FP42 | Fingerling mucus | MH620723.1 | Pseudomonas oryzihabitans (99.3) | 32 | 1 | 32 | CM-FFC-OA-UB-FR-SXT |
118 | Fingerling mucus | MH620730.1 | Pseudomonas migulae (99.2) | 16 | 0.25 | 64 | CM-FFC-OT-OA-UB-FR-SXT |
FM4 | Fingerling mucus | KX279655.1 | Pseudomonas putida (99.6) | 16 | 1 | 16 | CTX- S-CM-FFC-OT-OA-UB-FR-SXT |
FM15 | Fingerling mucus | KX279657.1 | Pseudomonas putida (99.2) | 16 | 1 | 16 | S-CN-CM-FFC-OT-OA-UB-ENR-FR-SXT |
FM22 | Cage water | KX279658.1 | Pseudomonas japonica (99.9) | 16 | 1 | 16 | CTX-S-CN-K-CM-FFC-OT-OA-UB-FR-SXT |
FP68 | Fingerling mucus | MH620724.1 | Pseudomonas migulae (99.5) | 16 | 1 | 16 | CTX-CM-FFC-OA-UB-FR-SXT |
FR20 | Fingerling mucus | MH620720.1 | Pseudomonas vranovensis (100.0) | 16 | 16 | 1 | CTX-S-CM-FFC-OA-UB-FR-SXT |
FR27 | Fingerling mucus | KX279663.1 | Pseudomonas azotoformans (100.0) | 16 | 16 | 1 | CTX-S-CM-FFC-OA-UB-FR-SXT |
133 | Fingerling mucus | MH620717.1 | Pseudomonas gessardii (99.8) | 8 | 8 | 1 | CM-FFC-OT-OA-FR-SXT |
144 | Fingerling mucus | MH620718.1 | Pseudomonas gessardii (99.7) | 8 | 8 | 1 | CTX-S-CM-FFC-OT-FR |
145 | Fingerling mucus | MH620729.1 | Pseudomonas fluorescens (99.6) | 8 | 8 | 1 | CM-FFC-OT-FR-SXT |
167 | Fingerling mucus | MH620747.1 | Acinetobacter johnsonii (99.0) | 8 | 8 | 1 | OT-OA |
C2 | Effluent | MH620749.1 | Stenotrophomonas maltophilia (99.5) | 8 | 4 | 2 | S-CM-OT-OA |
C6 | Influent | MH620748.1 | Stenotrophomonas rhizophila (99.1) | 8 | 2 | 4 | CTX-S-CM-FFC-OT-OA-FR |
FE22 | Intestinal content | MH620738.1 | Kluyvera intermedia (99.4) | 8 | 8 | 1 | S-CM-FFC-OT-FR |
FE23 | Intestinal content | MH620739.1 | Kluyvera intermedia (98.7) | 8 | 0.125 | 64 | S-K-CM-FFC-OT-FR |
FF10 | Fingerling mucus | MH620726.1 | Pseudomonas lurida (99.6) | 8 | 1 | 8 | CTX-CM-FFC-OA-FR-SXT |
FF32 | Cage water | KX279652.1 | Pseudomonas putida (99.6) | 8 | 0.125 | 64 | CM-FFC-OT-FR-SXT |
FM2 | Cage water | KX279653.1 | Sphingobacterium anhuiense (99.3) | 8 | 4 | 2 | S-CN-K-CM-FFC-OT-OA-FR-SXT |
FM26 | Fingerling mucus | MH620736.1 | Kluyvera intermedia (99.8) | 8 | 4 | 2 | S-CN-K-CM-FFC-OT-OA-FR |
FR50 | Fingerling mucus | MH620721.1 | Pseudomonas lini (100.0) | 8 | 8 | 1 | CTX-CM-FFC-FR-SXT |
OT30 | Fingerling mucus | MH620725.1 | Pseudomonas poae (100.0) | 8 | 1 | 8 | CTX-CM-FFC-OT-OA-FR-SXT |
OT42 | Fingerling mucus | KX279667.1 | Pseudomonas fluorescens (99.9) | 8 | 0.5 | 16 | CTX-CM-FFC-OT-FR-SXT |
SX37 | Under-cage sediment | MH620727.1 | Pseudomonas putida (99.6) | 8 | 0.125 | 64 | S-CM-FFC-OA-FR-SXT |
SX53 | Fingerling mucus | MH620731.1 | Pseudomonas reinekei (99.9) | 8 | 0.125 | 64 | CM-FFC-OT-FR-SXT |
Q20 | Fingerling mucus | KX279669.1 | Pseudomonas fluorescens (99.8) | 8 | 0.5 | 16 | CTX-S-CM-FFC-OT-OA-FR-SXT |
Q23 | Fingerling mucus | KX279670.1 | Pseudomonas fluorescens (100.0) | 8 | 0.5 | 16 | CTX-S-CM-FFC-OT-FR-SXT |
177 | Fingerling mucus | MH620735.1 | Pseudomonas fluorescens (99.1) | 4 | 0.5 | 8 | CM-FFC-OT-FR |
227 | Fingerling mucus | MH620728.1 | Pseudomonas fluorescens (100.0) | 4 | 0.125 | 32 | CM-FFC-OT-FR-SXT |
264 | Effluent | MH620719.1 | Pseudomonas migulae (99.6) | 4 | 0.125 | 32 | CTX-CM-FFC-OT-FR-SXT |
CH3 | Effluent | MH620740.1 | Kluyvera intermedia (99.7) | 4 | 0.25 | 16 | S-CM-OT |
FB133 | Fingerling mucus | MH620751.1 | Lelliottia amnigena (99.2) | 4 | 0.5 | 8 | S-CM-FFC-OT |
FE12 | Fingerling mucus | MH620745.1 | Hafnia alvei (99.2) | 4 | 4 | 1 | CTX-S-CM-FFC-OT-FR |
FE15 | Fingerling mucus | MH620737.1 | Kluyvera intermedia (99.2) | 4 | 4 | 1 | S-K-CM-FFC-OT |
Q11 | Rearing tank water | KX279668.1 | Pseudomonas migulae (99.8) | 4 | 0.0625 | 64 | CTX-CM-FFC-OT-FR-SXT |
Q73 | Influent | MH620759.1 | Escherichia coli (99.4) | 4 | 0.0625 | 64 | S-CM-FFC-OT-SXT |
SX57 | Fingerling mucus | MH620732.1 | Pseudomonas fluorescens (99.6) | 4 | 0.5 | 8 | CTX-S-CM-FFC-OA-FR |
CH83 | Effluent | MH620755.1 | Serratia liquefaciens (99.5) | 2 | 1 | 2 | CM-FFC-OT-FR |
FB38 | Fingerling mucus | MH620742.1 | Citrobacter freundii (99.5) | 2 | 2 | 1 | S-K-CM-FFC-OT |
FB98 | Fingerling mucus | KX279649.1 | Citrobacter gillenii (99.8) | 2 | 2 | 1 | S-K-CM-FFC-OT-SXT |
Q61 | Effluent | MH620758.1 | Providencia vermicola (97.2) | 2 | 0.25 | 8 | CM-OT-FR |
Q64 | Effluent | KX279671.1 | Pseudomonas syringae (99.6) | 2 | 0.0625 | 32 | CM-FFC-OT-FR-SXT |
FB1 | Fingerling mucus | MH620750.1 | Lelliottia amnigena (97.1) | 1 | 0.0625 | 16 | S-CM-FFC-OT |
FB11 | Fingerling mucus | MH620741.1 | Citrobacter gillenii (99.8) | 1 | 0.25 | 4 | S-K-CM-FFC-OT |
FB96 | Fingerling mucus | MH620752.1 | Lelliottia amnigena (97.3) | 1 | 0.0625 | 16 | S-CM-FFC-OT |
FE21 | Intestinal content | MH620754.1 | Serratia myotis (99.3) | 1 | 1 | 1 | S-K-CM-FFC-OT-FR |
FM1 | Cage water | MH620753.1 | Enterobacter ludwigii (98.3) | 1 | 1 | 1 | S-CN-K-CM-FFC-OT-FR |
OP21 | Under-cage sediment | MH620743.1 | Citrobacter braakii (99.5) | 1 | 0.25 | 4 | S-K-CM-FFC-OT-SXT |
Q75 | Pelletized feed | KX279673.1 | Acinetobacter johnsonii (99.7) | 1 | 0.25 | 4 | CM-FFC-OT-FR |
FE20 | Intestinal content | MH620746.1 | Hafnia alvei (99.7) | 0.5 | 0.125 | 4 | CTX-S-CM-FFC-OT-FR |
FM3 | Cage water | MH620757.1 | Comamonas jiangduensis (99.9) | 0.5 | 0.125 | 4 | S-CM-FFC-OT-SXT |
233 | Cage water | MH424518.1 | Pseudomonas putida (98.4) | 0.25 | 0.0625 | 4 | CTX-CM-FFC-OT-FR-SXT |
C11 | Pelletized feed | MH620761.1 | Morganella psychrotolerans (99.6) | 0.25 | 0.125 | 2 | OT |
FE11 | Under-cage sediment | MH620744.1 | Hafnia alvei (99.6) | 0.25 | 0.0625 | 4 | CTX-S-CM-FFC-OT-FR |
FM16 | Fingerling mucus | MH620760.1 | Leclercia adecarboxylata (98.2) | 0.25 | 0.0625 | 4 | S-CN-CM-FFC-OT-FR |
FP75 | Under-cage sediment | KX279662.1 | Citrobacter gillenii (99.6) | 0.25 | 0.125 | 2 | S-CM-FFC-OT-FR-SXT |
Strain | Aminoacidic Substitution a | |
---|---|---|
DNA Gyrase | Topoisomerase IV | |
Pseudomonas fluorescens 275 | GyrA: S83 by I; GyrB: L417 by H | ParC: Y74 by F; S80 by L; P98 by T |
Pseudomonas putida FB13 | GyrB: L400 by I; R413 by K; V423 by G | None |
Rahnella aquatilis FM7 | GyrA: S83 by I; GyrB: L417 by H | ParC: S80 by I |
Pseudomonas baetica FR34 | GyrB: L417 by H | None |
Kluyvera intermedia OP29 | GyrA: S83 by I | ParC: S80 by I |
Pseudomonas putida FB15 | GyrB: L417 by H | None |
Pseudomonas baetica FE24 | GyrB: L417 by H | None |
Pseudomonas libanensis FP37 | GyrB: L400 by I; R413 by K; V423 by G | ParC: D101 by N |
Pseudomonas oryzihabitans FB90 | GyrB: L417 by H | None |
Pseudomonas sp. FP42 | GyrB: L400 by I; R413 by K | None |
Pseudomonas sp. 118 | GyrB: L417 by H | None |
Pseudomonas putida FM4 | GyrB: L400 by I; R413 by K | None |
Pseudomonas sp. FM15 | GyrB: L400 by I; R413 by K | None |
Pseudomonas japonica FM22 | GyrB: L400 by I; R413 by K | None |
Pseudomonas migulae FP68 | GyrB: L400 by I; R413 by K | None |
Pseudomonas vranovensis FR20 | None | None |
Pseudomonas azotoformans FR27 | None | None |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Concha, C.; Miranda, C.D.; Hurtado, L.; Romero, J. Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms. Microorganisms 2019, 7, 698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698
Concha C, Miranda CD, Hurtado L, Romero J. Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms. Microorganisms. 2019; 7(12):698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698
Chicago/Turabian StyleConcha, Christopher, Claudio D. Miranda, Luz Hurtado, and Jaime Romero. 2019. "Characterization of Mechanisms Lowering Susceptibility to Flumequine among Bacteria Isolated from Chilean Salmonid Farms" Microorganisms 7, no. 12: 698. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7120698