Phenotypic and Genetic Components for Growth, Morphology, and Flesh-Quality Traits of Meagre (Argyrosomus regius) Reared in Tank and Sea Cage
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals
2.3. Microsatellite Genotyping and Parental Assignment
2.4. Measurements
2.4.1. Manual Growth (MG) Measurements
2.4.2. Automatic Morphology (AM) Measurements
2.4.3. Flesh Chemical Composition
2.5. Statistical Data Analyses
- For phenotypical analysis:
Yij = µ + HSi + b ∗ BWj + eij; for flesh composition
- For genetic parameter estimates:
3. Results
3.1. Phenotyping
3.2. Microsatellite Genotyping and Parental Assignment
3.3. Heritabilities and Correlations
3.3.1. Heritabilities
3.3.2. Correlations
- Within group of traits:
- Between groups of traits:
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Diversify Diversify: New Species for EU Aquaculture. 2018. Available online: https://www.diversifyfish.eu/ (accessed on 16 November 2021).
- Cárdenas, S. Crianza de La Corvina (Argyrosomus regius). Cuad. Acuic. 2010, 3, 12–57. [Google Scholar]
- Griffiths, M.H.; Heemstra, P.C. A Contribution to the Taxonomy of the Marine Fish Genus Argyrosomus (Perciformes: Sciaenidae), with Descriptions of Two New Species from Southern Africa. Ichthyol. Bull. 1995, 65, 74–79. [Google Scholar]
- APROMAR. La Acuicultura en España. 2020, p. 95. (In Spanish). Available online: http://www.apromar.es/ (accessed on 16 November 2021).
- Fountoulaki, E.; Grigorakis, K.; Kounna, C.; Rigos, G.; Papandroulakis, N.; Diakogeorgakis, J.; Kokou, F. Growth Performance and Product Quality of Meagre (Argyrosomus regius) Fed Diets of Different Protein/Lipid Levels at Industrial Scale. Ital. J. Anim. Sci. 2017, 16, 685–694. [Google Scholar] [CrossRef] [Green Version]
- Luna, L.; Fernández, J.M.; Incera, T.; Duque, C.; Fernández, J.L.; García, R.; Torre, C. La Demanda del Filete de Dorada en el Mercado Español; Secretaria General Técnica: Madrid, Spain, 2006; ISBN 84-491-0707-5. [Google Scholar]
- Poli, B.M.; Zampacavallo, G.; Iurzan, F.; Mecatti, M.; Lupi, P.; Bonelli, A. Preliminary Results on Quality and Quality Changes in Reared Meagre (Argyrosomus regius): Body and Fillet Traits and Freshness Changes in Refrigerated Commercial-Size Fish. Aquac. Int. 2003, 11, 301–311. [Google Scholar] [CrossRef]
- Saavedra, M.; Pereira, T.G.; Carvalho, L.M.; Pousão-Ferreira, P.; Grade, A.; Teixeira, B.; Quental-Ferreira, H.; Mendes, R.; Bandarra, N.; Gonçalves, A. Wild and Farmed Meagre, Argyrosomus regius: A Nutritional, Sensory and Histological Assessment of Quality Differences. J. Food Compos. Anal. 2017, 63, 8–14. [Google Scholar] [CrossRef]
- Alexi, N.; Kogiannou, D.; Oikonomopoulou, I.; Kalogeropoulos, N.; Byrne, D.V.; Grigorakis, K. Culinary Preparation Effects on Lipid and Sensory Quality of Farmed Gilthead Seabream (Sparus aurata) and Meagre (Argyrosomus regius): An Inter-Species Comparison. Food Chem. 2019, 301, 125263. [Google Scholar] [CrossRef] [PubMed]
- Augustsson, K.; Michaud, D.S.; Rimm, E.B.; Leitzmann, M.F.; Stampfer, M.J.; Willett, W.C.; Giovannucci, E. A Prospective Study of Intake of Fish and Marine Fatty Acids and Prostate Cancer. Cancer Epidemiol. Biomark. Prev. 2003, 12, 64–67. [Google Scholar]
- Mccullough, M.L.; Feskanich, D.; Stampfer, M.J.; Giovannucci, E.L.; Rimm, E.B.; Hu, F.B.; Spiegelman, D.; Hunter, D.J.; Colditz, G.A.; Willett, W.C. Diet quality and major chronic disease risk in men and women: Moving toward improved dietary guidance. Am. J. Clin. Nutr. 2002, 76, 1261–1271. [Google Scholar] [CrossRef] [Green Version]
- Estévez, A.; Blanco, B.; Fernández, L.; Ferreira, M.; Soula, M. Effects of Alternative and Sustainable Ingredients, Insect Meal, Microalgae and Protein and Lipid from Tuna Cooking Water, on Meagre (Argyrosomus regius) Growth, Food Conversion and Muscle and Liver Composition. Aquaculture 2022, 548, 737549. [Google Scholar] [CrossRef]
- Piccolo, G.; Bovera, F.; de Riu, N.; Marono, S.; Salati, F.; Cappuccinelli, R.; Moniello, G. Effect of Two Different Protein/Fat Ratios of the Diet on Meagre (Argyrosomus regius) Traits. Ital. J. Anim. Sci. 2008, 7, 363–371. [Google Scholar] [CrossRef] [Green Version]
- Lozano, A.R.; Borges, P.; Robaina, L.; Betancor, M.; Hernández-Cruz, C.M.; García, J.R.; Caballero, M.J.; Vergara, J.M.; Izquierdo, M. Effect of Different Dietary Vitamin E Levels on Growth, Fish Composition, Fillet Quality and Liver Histology of Meagre (Argyrosomus regius). Aquaculture 2017, 468, 175–183. [Google Scholar] [CrossRef]
- Schiavone, R.; Zilli, L.; Storelli, C.; Vilella, S. Changes in Hormonal Profile, Gonads and Sperm Quality of Argyrosomus regius (Pisces, Scianidae) during the First Sexual Differentiation and Maturation. Theriogenology 2012, 77, 888–898. [Google Scholar] [CrossRef]
- Duncan, N.; Estévez, A.; Porta, J.; Carazo, I.; Norambuena, F.; Aguilera, C.; Gairin, I.; Bucci, F.; Valles, R.; Mylonas, C.C. Reproductive Development, GnRHa-Induced Spawning and Egg Quality of Wild Meagre (Argyrosomus regius) Acclimatised to Captivity. Fish Physiol. Biochem. 2012, 38, 1273–1286. [Google Scholar] [CrossRef]
- Duncan, N.J.; Mylonas, C.C.; Milton Sullon, E.; Karamanlidis, D.; França Nogueira, M.C.; Ibarra-Zatarain, Z.; Chiumento, M.; Aviles Carrillo, R.O. Paired Spawning with Male Rotation of Meagre Argyrosomus regius Using GnRHa Injections, as a Method for Producing Multiple Families for Breeding Selection Programs. Aquaculture 2018, 495, 506–512. [Google Scholar] [CrossRef]
- Fakriadis, I.; Zanatta, E.M.; Fleck, R.P.D.S.; Sena Mateo, D.L.; Papadaki, M.; Mylonas, C.C. Endocrine Regulation of Long-Term Enhancement of Spermiation in Meagre (Argyrosomus regius) with GnRHa Controlled-Delivery Systems. Gen. Comp. Endocrinol. 2020, 297, 113549. [Google Scholar] [CrossRef] [PubMed]
- Vallés, R.; Estévez, A. Light Conditions for Larval Rearing of Meagre (Argyrosomus regius). Aquaculture 2013, 376–379, 15–19. [Google Scholar] [CrossRef]
- Carvalho, M.; Castro, P.; Montero, D.; Peres, H.; Acosta, F.; Fontanillas, R.; Rosenlund, G.; Robaina, L.; Izquierdo, M. Essential Fatty Acid Deficiency Increases Hepatic Non-Infectious Granulomatosis Incidence in Meagre (Argyrosomus regius, Asso 1801) Fingerlings. Aquaculture 2019, 505, 393–404. [Google Scholar] [CrossRef]
- Andree, K.B.; Roque, A.; Duncan, N.; Gisbert, E.; Estevez, A.; Tsertou, M.I.; Katharios, P. Diplectanum Sciaenae (Van Beneden & Hesse, 1863) (Monogenea) Infecting Meagre, Argyrosomus regius (Asso, 1801) Broodstock in Catalonia, Spain. A Case Report. Vet. Parasitol. Reg. Stud. Rep. 2015, 1–2, 75–79. [Google Scholar] [CrossRef]
- Elkesh, A.; Kantham, K.P.L.; Shinn, A.P.; Crumlish, M.; Richards, R.H. Systemic Nocardiosis in a Mediterranean Population of Cultured Meagre, Argyrosomus regius Asso (Perciformes: Sciaenidae). J. Fish Dis. 2013, 36, 141–149. [Google Scholar] [CrossRef]
- Tsertou, M.I.; Smyrli, M.; Kokkari, C.; Antonopoulou, E.; Katharios, P. The Aetiology of Systemic Granulomatosis in Meagre (Argyrosomus regius): The “Nocardia” Hypothesis. Aquac. Rep. 2018, 12, 5–11. [Google Scholar] [CrossRef]
- López-Fanjul, C.; Toro, M.Á. Fundamentos de Mejora Genética En Acuicultura. In Genética y Genómica en Acuicultura; Editorial CSIC: Madrid, Spain, 2007; pp. 157–181. ISBN 978-84-00-08553-7. [Google Scholar]
- Janssen, K.; Chavanne, H.; Berentsen, P.; Komen, H. Impact of Selective Breeding on European Aquaculture. Aquaculture 2017, 472, 8–16. [Google Scholar] [CrossRef]
- Chavanne, H.; Janssen, K.; Hofherr, J.; Contini, F.; Haffray, P.; Aquatrace Consortium; Komen, H.; Nielsen, E.E.; Bargelloni, L. A Comprehensive Survey on Selective Breeding Programs and Seed Market in the European Aquaculture Fish Industry. Aquac. Int. 2016, 24, 1287–1307. [Google Scholar] [CrossRef]
- Navarro, A.; Zamorano, M.J.; Hildebrandt, S.; Ginés, R.; Aguilera, C.; Afonso, J.M. Estimates of Heritabilities and Genetic Correlations for Growth and Carcass Traits in Gilthead Seabream (Sparus auratus L.), under Industrial Conditions. Aquaculture 2009, 289, 225–230. [Google Scholar] [CrossRef]
- Navarro, A.; Lee-Montero, I.; Santana, D.; Henríquez, P.; Ferrer, M.A.; Morales, A.; Soula, M.; Badilla, R.; Negrín-Báez, D.; Zamorano, M.J.; et al. IMAFISH_ML: A Fully-Automated Image Analysis Software for Assessing Fish Morphometric Traits on Gilthead Seabream (Sparus aurata L.), Meagre (Argyrosomus regius) and Red Porgy (Pagrus pagrus). Comput. Electron. Agric. 2016, 121, 66–73. [Google Scholar] [CrossRef]
- Costa, C.; Antonucci, F.; Boglione, C.; Menesatti, P.; Vandeputte, M.; Chatain, B. Automated Sorting for Size, Sex and Skeletal Anomalies of Cultured Seabass Using External Shape Analysis. Aquac. Eng. 2013, 52, 58–64. [Google Scholar] [CrossRef]
- Nousias, O.; Tsakogiannis, A.; Duncan, N.; Villa, J.; Tzokas, K.; Estevez, A.; Chatziplis, D.; Tsigenopoulos, C.S. Parentage Assignment, Estimates of Heritability and Genetic Correlation for Growth-Related Traits in Meagre Argyrosomus regius. Aquaculture 2020, 518, 734663. [Google Scholar] [CrossRef]
- Perera, E.; Simó-Mirabet, P.; Shin, H.S.; Rosell-Moll, E.; Naya-Catalá, F.; de las Heras, V.; Martos-Sitcha, J.A.; Karalazos, V.; Armero, E.; Arizcun, M.; et al. Selection for Growth Is Associated in Gilthead Sea Bream (Sparus aurata) with Diet Flexibility, Changes in Growth Patterns and Higher Intestine Plasticity. Aquaculture 2019, 507, 349–360. [Google Scholar] [CrossRef]
- Vallecillos, A.; Chaves-Pozo, E.; Arizcun, M.; Perez, R.; Afonso, J.M.; Berbel, C.; Pérez-Sánchez, J.; María-Dolores, E.; Armero, E. Genetic Parameters for Photobacterium Damselae Subsp. Piscicida Resistance, Immunological Markers and Body Weight in Gilthead Seabream (Sparus aurata). Aquaculture 2021, 543, 736892. [Google Scholar] [CrossRef]
- Massault, C.; Franch, R.; Haley, C.; de Koning, D.J.; Bovenhuis, H.; Pellizzari, C.; Patarnello, T.; Bargelloni, L. Quantitative Trait Loci for Resistance to Fish Pasteurellosis in Gilthead Sea Bream (Sparus aurata). Anim. Genet. 2011, 42, 191–203. [Google Scholar] [CrossRef]
- Palaiokostas, C.; Ferraresso, S.; Franch, R.; Houston, R.D.; Bargelloni, L. Genomic Prediction of Resistance to Pasteurellosis in Gilthead Sea Bream (Sparus aurata) Using 2B-RAD Sequencing. G3 2016, 6, 3693–3700. [Google Scholar] [CrossRef] [Green Version]
- Campoverde, C.; Milne, D.J.; Secombes, C.J.; Estévez, A.; Gisbert, E.; Andree, K.B. Gene Expression Analysis of the Innate Immune System during Early Rearing and Weaning of Meagre (Argyrosomus regius). Fish Shellfish. Immunol. 2019, 94, 819–832. [Google Scholar] [CrossRef] [PubMed]
- Navarro, A.; Oliva, V.; Zamorano, M.J.; Ginés, R.; Izquierdo, M.S.; Astorga, N.; Afonso, J.M. Evaluation of PIT System as a Method to Tag Fingerlings of Gilthead Seabream (Sparus Auratus L.): Effects on Growth, Mortality and Tag Loss. Aquaculture 2006, 257, 309–315. [Google Scholar] [CrossRef]
- Vandeputte, M.; Mauger, S.; Dupont-Nivet, M. An Evaluation of Allowing for Mismatches as a Way to Manage Genotyping Errors in Parentage Assignment by Exclusion. Mol. Ecol. Notes 2006, 6, 265–267. [Google Scholar] [CrossRef]
- Porta, D.; Porta, J.M.; Porta, J.; Andree, K.; Duncan, N. Isolation and Characterization of Microsatellite Loci from Argyrosomus Regius (Asso, 1801). 2010; unpublished. Available online: https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/nuccore/?term=porta%20D (accessed on 16 November 2021).
- Archangi, B.; Chand, V.; Mather, P.B. Isolation and Characterization of 15 Polymorphic Microsatellite DNA Loci from Argyrosomus Japonicus (Mulloway), a New Aquaculture Species in Australia. Mol. Ecol. Resour. 2009, 9, 412–414. [Google Scholar] [CrossRef] [PubMed]
- Farias, I.P.; Muniz, L.B.; Astolfi-Filho, S.; Sampaio, I. Isolation and Characterization of DNA Microsatellite Primers for Cynoscion Acoupa, the Most Exploited Sciaenid Fish along the Coast of Brazil. Mol. Ecol. Notes 2006, 6, 660–663. [Google Scholar] [CrossRef]
- O’malley, K.G.; Abbey, C.A.; Ross, K.; Gold, J.R. Microsatellite DNA Markers for Kinship Analysis and Genetic Mapping in Red Drum, Sciaenops Ocellatus (Sciaenidae, Teleostei). Mol. Ecol. Notes 2003, 3, 242–244. [Google Scholar] [CrossRef]
- Saillant, E.; Cizdziel, K.; O’Malley, K.G.; Turner, T.F.; Pruett, C.L.; Gold, J.R. Microsatellite Markers for Red Drum, Sciaenops Ocellatus. Gulf Mex. Sci. 2004, 22, 101–107. [Google Scholar] [CrossRef]
- IBM. SPSS Statistics for Windows; IBM Corp: Armonk, NY, USA, 2017. [Google Scholar]
- Misztal, I.; Tsuruta, S.; Lourenco, D.; Aguilar, I.; Legarra, A.; Vitezica, Z. BLUPF90 Family of Programs; University of Georgia: Athens, GA, USA, 2015; pp. 1–125. [Google Scholar]
- R Development Core Team. A Language and Environment for Statistical Computing; R foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.R-project.org/ (accessed on 16 November 2021).
- Cardellino, R.; Rovira, J. Mejoramiento Genético Animal; Hemisferio Sur: Buenos Aires, Argentina, 1987; p. 253. [Google Scholar]
- Navarro, A.; Zamorano, M.J.; Hildebrandt, S.; Ginés, R.; Aguilera, C.; Afonso, J.M. Estimates of Heritabilities and Genetic Correlations for Body Composition Traits and G × E Interactions, in Gilthead Seabream (Sparus auratus L.). Aquaculture 2009, 295, 183–187. [Google Scholar] [CrossRef]
- Lee-Montero, I.; Navarro, A.; Borrell, Y.; García-Celdrán, M.; Martín, N.; Negrín-Báez, D.; Blanco, G.; Armero, E.; Berbel, C.; Zamorano, M.J.; et al. Development of the First Standardised Panel of Two New Microsatellite Multiplex PCRs for Gilthead Seabream (Sparus aurata L.). Anim. Genet. 2013, 44, 533–546. [Google Scholar] [CrossRef]
- Navarro, A.; Badilla, R.; Zamorano, M.J.; Pasamontes, V.; Hildebrandt, S.; Sánchez, J.J.; Afonso, J.M. Development of Two New Microsatellite Multiplex PCRs for Three Sparid Species: Gilthead Seabream (Sparus auratus L.), Red Porgy (Pagrus pagrus L.) and Redbanded Seabream (P. auriga, Valenciennes, 1843) and Their Application to Paternity Studies. Aquaculture 2008, 285, 30–37. [Google Scholar] [CrossRef]
- García-Celdrán, M.; Ramis, G.; Manchado, M.; Estévez, A.; Navarro, A.; Armero, E. Estimates of Heritabilities and Genetic Correlations of Raw Flesh Quality Traits in a Reared Gilthead Sea Bream (Sparus aurata L.) Population Sourced from Broodstocks along the Spanish Coasts. Aquaculture 2015, 446, 181–186. [Google Scholar] [CrossRef]
- Villanueva, B.; Verspoor, E.; Visscher, P.M. Parental Assignment in Fish Using Microsatellite Genetic Markers with Finite Numbers of Parents and Offspring. Anim. Genet. 2002, 33, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Elalfy, I.; Shin, H.S.; Negrín-Báez, D.; Navarro, A.; Zamorano, M.J.; Manchado, M.; Afonso, J.M. Genetic Parameters for Quality Traits by Non-Invasive Methods and Their G x E Interactions in Ocean Cages and Estuaries on Gilthead Seabream (Sparus aurata). Aquaculture 2021, 537, 736462. [Google Scholar] [CrossRef]
- Giogios, I.; Grigorakis, K.; Kalogeropoulos, N. Organoleptic and Chemical Quality of Farmed Meagre (Argyrosomus regius) as Affected by Size. Food Chem. 2013, 141, 3153–3159. [Google Scholar] [CrossRef] [PubMed]
- Ballester-Lozano, G.F.; Benedito-Palos, L.; Navarro, J.C.; Kaushik, S.; Pérez-Sánchez, J. Prediction of Fillet Fatty Acid Composition of Market-Size Gilthead Sea Bream (Sparus aurata) Using a Regression Modelling Approach. Aquaculture 2011, 319, 81–88. [Google Scholar] [CrossRef] [Green Version]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Carballo, C.; Shin, H.S.; Berbel, C.; Zamorano, M.J.; Borrego, J.J.; Armero, E.; Afonso, J.M.; Manchado, M. Heritability Estimates and Genetic Correlation for Growth Traits and LCDV Susceptibility in Gilthead Sea Bream (Sparus aurata). Fishes 2020, 5, 2. [Google Scholar] [CrossRef] [Green Version]
- Pattarapanyawong, N.; Sukhavachana, S.; Senanan, W.; Srithong, C.; Joerakate, W.; Tunkijjanukij, S.; Poompuang, S. Genetic Parameters for Growth and Fillet Traits in Asian Seabass (Lates Calcarifer, Bloch 1790) Population from Thailand. Aquaculture 2021, 539, 736629. [Google Scholar] [CrossRef]
- Freitas, M.v.; Lira, L.V.G.; Ariede, R.B.; Agudelo, J.F.G.; de Oliveira Neto, R.R.; Borges, C.H.S.; Mastrochirico-Filho, V.A.; Garcia Neto, B.F.; Carvalheiro, R.; Hashimoto, D.T. Genotype by Environment Interaction and Genetic Parameters for Growth Traits in the Neotropical Fish Pacu (Piaractus mesopotamicus). Aquaculture 2021, 530, 735933. [Google Scholar] [CrossRef]
- Noble, T.H.; Coman, G.J.; Wade, N.M.; Thomson, P.C.; Raadsma, H.W.; Khatkar, M.S.; Guppy, J.L.; Jerry, D.R. Genetic Parameters of Gill-Associated Virus Infection and Body Weight under Commercial Conditions in Black Tiger Shrimp, Penaeus Monodon. Aquaculture 2020, 528, 735580. [Google Scholar] [CrossRef]
- van Sang, N.; Luan, N.T.; van Hao, N.; van Nhien, T.; Vu, N.T.; Nguyen, N.H. Genotype by Environment Interaction for Survival and Harvest Body Weight between Recirculating Tank System and Pond Culture in Penaeus Monodon. Aquaculture 2020, 525, 735278. [Google Scholar] [CrossRef]
- Montero, I.L. Desarrollo de un Programa Piloto a Nivel Nacional de Mejora Genética en Dorada (Sparus aurata L.): Estimación de Parámetros Genéticos de Caracteres de Crecimiento y Calidad e Interacción Genotipo Ambiente. Ph.D. Thesis, University of Las Palmas de Gran, Las Palmas de Gran Canaria, Spain, 2012. [Google Scholar]
Meagre STR Loci | M | F | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) | Reference |
---|---|---|---|---|---|
gCT15 | (GCT)7 | 5′NED | ATCCGGGCGTTACTACAGTC | GTTTCTCCACACAGTGCTTTTCAGA | Porta et al. [38] |
UBA50 | (GT)26 | 5′NED | GCACAACTGCATCCCTTAGAT | GTTTAGAAGTGAAGACTGCGGACTG | Archangi et al. [39] |
CA3 | (CA)12 | 5′NED | AAGTGGAGGCTCTTACATGAAAAC | GTGACAAATTGCCTTCTGTTTCTAC | Porta et al. [38] |
GA17 | (GT)12 | 5′6-FAM | CTAGAGAAATTCATCCAGGGAAGTG | GTTTAGAGCAGAGAGTTAGCGGTTGTT | Porta et al. [38] |
Cac mic 14 | (CT)12 | 5′6-FAM | ATCTTCTCCCCTCCGTCACT | CTGTGTTGTTAAGGCGCATC | Farias et al. [40] |
GA2b | (CA)26 | 5′PET | AAGTGTGGCGTCATTTCCTCT | GTATTGATGGATAGCAAGTGTCAGA | Porta et al. [38] |
SOC405 | (CA)12 | 5′PET | AGCCTTTTGTTTAGTTTCCCTCAT | GGGGTGTAGCAGAACCACAC | O’Malley et al. [41] |
SOC431 | (GT)26 | 5′VIC | GTGGTAGATGAAAACGTATAAAAGGAG | GTTTCATATATATAGTGTACAGCTCCAGCTTC | O’Malley et al. [41] |
UBA53 | (CA)14 | 5′VIC | TACTTCCTTCTACCCCTAAGTCTGG | GACTTTCCAGTGTAGCTGTCGTTT | Archangi et al. [39] |
SOC11 | (GA)11 | 5′VIC | GCCGAGTCACGAAGGAACAGAGAA | TGTCGTCTCATCTATCTCCATCTC | Saillant et al. [42] |
Traits | Abbreviation | Description |
---|---|---|
Standard length (cm) | SL | Distance for X1–X4, within the horizontal axis (Figure 1). |
Caudal peduncle height (cm) | CPH | Axis Y3 (Figure 1). |
Equidistant fish height C (cm) | FHC | TLL is divided into six equal parts, then heights of each one of these five points are measured FHA, FHB, FHC, FHD, and FHE are the axes a, b, c, d, and e, respectively (Figure 1). |
Housing System | Cage | Tank | ||||
---|---|---|---|---|---|---|
n | LSM | S.E. | n | LSM | S.E. | |
BW (g) | 245 | 1233 a | 18.3 | 371 | 839 b | 14.8 |
TL (cm) | 245 | 42.7 a | 0.27 | 371 | 36.8 b | 0.22 |
SL (cm) | 245 | 40.7 a | 0.35 | 371 | 34.7 b | 0.28 |
CPH (cm) | 245 | 3.51 a | 0.03 | 371 | 3.01 b | 0.02 |
FHC (cm) | 245 | 10.3 a | 0.08 | 371 | 8.59 b | 0.07 |
SL/FHC * | 245 | 3.96 | 0.02 | 371 | 4.03 | 0.01 |
Housing System | Cage | Tank | Covariate BW | |||||
---|---|---|---|---|---|---|---|---|
n | LSM | S.E. | n | LSM | S.E. | b | S.E. | |
Moisture (%) | 245 | 74.0 | 0.10 | 371 | 73.9 | 0.08 | −0.003 * | 0.00 |
Protein (%) | 245 | 18.5 a | 0.09 | 371 | 20.2 b | 0.07 | −0.000 | 0.00 |
Fat (%) | 245 | 5.62 a | 0.12 | 371 | 4.02 b | 0.09 | 0.002 * | 0.00 |
Collagen (%) | 245 | 1.00 | 0.03 | 371 | 1.00 | 0.02 | <0.000 | <0.000 |
Traits | BW | TL | SL | CPH | FHC | SL/FHC | Moisture | Protein | Fat | Collagen |
---|---|---|---|---|---|---|---|---|---|---|
BW | 0.42 ± 0.24 | 0.96 ± 0.06 | 0.89 ± 0.19 | 0.90 ± 0.16 | 0.89 ± 0.18 | −0.13 ± 0.64 | 0.14 ± 0.53 | −0.43 ± 0.53 | −0.09 ± 0.50 | 0.05 ± 0.58 |
TL | 0.91 ± 0.01 | 0.38 ± 0.22 | 0.90 ± 0.16 | 0.88 ± 0.18 | 0.86 ± 0.20 | −0.00 ± 0.62 | 0.09 ± 0.50 | −0.43 ± 0.49 | −0.01 ± 0.45 | −0.04 ± 0.52 |
SL | 0.68 ± 0.04 | 0.75 ± 0.04 | 0.32 ± 0.23 | 0.90 ± 0.21 | 0.95 ± 0.11 | 0.07 ± 0.71 | 0.29 ± 0.60 | −0.22 ± 0.66 | −0.37 ± 0.57 | −0.34 ± 0.60 |
CPH | 0.66 ± 0.04 | 0.65 ± 0.05 | 0.81 ± 0.03 | 0.19 ± 0.16 | 0.79 ± 0.03 | 0.08 ± 0.69 | 0.31 ± 0.57 | −0.20 ± 0.65 | −0.40 ± 0.53 | 0.32 ± 0.60 |
FHC | 0.74 ± 0.03 | 0.74 ± 0.04 | 0.94 ± 0.01 | 0.83 ± 0.02 | 0.39 ± 0.20 | −0.33 ± 0.65 | −0.03 ± 0.66 | −0.10 ± 0.68 | −0.08 ± 0.63 | −0.44 ± 0.57 |
SL/FHC | −0.30 ± 0.10 | −0.08 ± 0.11 | 0.03 ± 0.11 | −0.17 ± 0.10 | −0.31 ± 0.10 | 0.16 ± 0.15 | 0.76 ± 0.37 | −0.36 ± 0.64 | −0.72 ± 0.39 | 0.26 ± 0.65 |
Moisture | −0.46 ± 0.10 | −0.41 ± 0.10 | −0.28 ± 0.10 | −0.31 ± 0.09 | −0.36 ± 0.10 | 0.25 ± 0.07 | 0.32 ± 0.21 | −0.27 ± 0.62 | −0.95 ± 0.07 | 0.08 ± 0.61 |
Protein | −0.02 ± 0.12 | 0.02 ± 0.12 | 0.06 ± 0.12 | 0.09 ± 0.12 | 0.03 ± 0.12 | 0.01 ± 0.11 | −0.11 ± 0.11 | 0.15 ± 0.14 | −0.17 ± 0.60 | −0.15 ± 0.65 |
Fat | 0.37 ± 0.10 | 0.25 ± 0.12 | 0.17 ± 0.11 | 0.12 ± 0.10 | 0.19 ± 0.12 | −0.21 ± 0.09 | −0.82 ± 0.03 | −0.38 ± 0.09 | 0.30 ± 0.20 | −0.01 ± 0.59 |
Collagen | −0.01 ± 0.12 | −0.02 ± 0.12 | −0.04 ± 0.12 | −0.04 ± 0.11 | −0.04 ± 0.12 | 0.03 ± 0.10 | 0.17 ± 0.08 | −0.24 ± 0.08 | −0.06 ± 0.10 | 0.15 ± 0.16 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vallecillos, A.; María-Dolores, E.; Villa, J.; Rueda, F.M.; Carrillo, J.; Ramis, G.; Soula, M.; Afonso, J.M.; Armero, E. Phenotypic and Genetic Components for Growth, Morphology, and Flesh-Quality Traits of Meagre (Argyrosomus regius) Reared in Tank and Sea Cage. Animals 2021, 11, 3285. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11113285
Vallecillos A, María-Dolores E, Villa J, Rueda FM, Carrillo J, Ramis G, Soula M, Afonso JM, Armero E. Phenotypic and Genetic Components for Growth, Morphology, and Flesh-Quality Traits of Meagre (Argyrosomus regius) Reared in Tank and Sea Cage. Animals. 2021; 11(11):3285. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11113285
Chicago/Turabian StyleVallecillos, Antonio, Emilio María-Dolores, Javier Villa, Francisco Miguel Rueda, José Carrillo, Guillermo Ramis, Mohamed Soula, Juan Manuel Afonso, and Eva Armero. 2021. "Phenotypic and Genetic Components for Growth, Morphology, and Flesh-Quality Traits of Meagre (Argyrosomus regius) Reared in Tank and Sea Cage" Animals 11, no. 11: 3285. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11113285