Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes

Abstract

Previous research has demonstrated the presence of two closely spaced repetitions of the rapid stress-responsive cis-active element RSRE (G/A/C)CGCG(C/G/T) in the 5′UTR of S. miltiorrhiza2C-methyl-D-erithrytol 2,4-cyclodiphosphate synthase (MECPS) gene. The product of MECPS activity, represented by 2C-methyl-D-erithrytol 2,4-cyclodiphosphate (MECPD), indicates its retrograde regulatory role and activates CAMTA trans-factors. Since the complete activation of CAMTA trans-factors requires the cooperative interaction of CAMTA3 with CAMTA2 or CAMTA4, the closely spaced RSREs recognized by CAMTA trans-factors could be used to promote CAMTA trans-factor dimerization. The present study aims to evaluate if the occurrence of these two closely spaced RSREs in the 5′UTR is specific to S. miltiorrhiza or could be observed in other MECPS genes. An analysis of nineteen MECPS gene sequences from seven selected model plants indicated the closely spaced repetition of RSREs in the 5′UTR region of two maize (Zea mays) MECPS genes, Zm00001d051458 and Zm00001d017608. This observation suggests the potential autoregulatory function of MECPD in relation to the MECPS transcription rate. Moreover, an analysis of eighty-five promoter regions of other plastidial methyl-D-erythritol phosphate (MEP) pathway genes indicated such closely spaced RSREs in the proximal promoter of Zea mays2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (CMS) (Zm00001d012197) and Oryza sativa4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) (Os03t0732000-00).

1. Introduction

Salvia miltiorrhiza (S. miltiorrhiza) is a medicinal plant used to treat coronary heart disease in China since ancient times [1]. Its application has recently been broadened to treat hyperlipidemia, alcoholism, hepatic injury, neuropathic pain, Parkinson’s disease, and Alzheimer’s disease [2,3,4,5]. The medical properties of S. miltiorrhiza are conditioned mainly by diterpene derivatives known as tanshinones [1,4,5]. Their biosynthesis uses isopentenyl pyrophosphate (IPP) and dimethylallylpyrophosphate (DMAPP) as substrates, which are produced by the cytosolic mevalonate (MVA) as well as the plastidial methyl-D-erythritol phosphate (MEP) pathways [6,7]. Although both routes produce the same components, i.e., IPP and DMAPP, their roles in plant metabolism could be different. Analyses performed on S. miltiorrhiza hairy roots suggest that IPP and DMAPP produced by MVA support biomass growth, while the same components produced by MEP increase the biosynthesis of tanshinones [8].

The important role of the MEP pathway in the biosynthesis of tanshinones opens questions related to the regulation of the pathway’s activity [9,10]. Results of previous studies suggest concerted regulation of MEP pathway genes by light and sugar (sucrose) [11,12,13,14,15,16]. The initial stage of such a regulation is controlled by the transcription rate of genes encoding MEP pathway enzymes [10,13]. A pivotal role in this process is played by cis-active elements localized in the gene promoter region, which are bound by particular transcription factors [17]. The activation of trans-factors, being a prerequisite to DNA-binding and gene expression regulation, is facilitated by numerous signaling routes, which adjust the gene expression level to the particular needs of cells [18,19]. External signals are delivered by activated gene-specific trans-factors to the multisubunit Mediator complex, interacting with general trans-factors complexed with RNA polymerase II [20]. Although transcription plays an important role in regulating pathway activity, it is generally used to roughly adjust the pre-mRNA level to the needs of plant cells [10]. The much more complex mechanisms control the enzyme level and its activity [21]. These regulations are particularly apparent in relation to enzymes, indicating a control function in the metabolite flux of the pathway. Such a role in the MEP route is played by 1-deoxy-D-xylulose-5-phosphate synthase (DXS),which has the highest flux control coefficient in the entire pathway [22].

The activity of DXS is allosterically inhibited by DMAPP and IPP that are produced by the MEP trail. However, when the concentration of IPP and DMAPP decreases, the abundance of DXS protein increases [23,24]. The putative mechanism linking the inhibition of DXS in the presence of IPP and DMAPP is the increased proteolytic sensitivity of enzyme inactive forms [25].

Another MEP pathway enzyme with a critical role is 2C methyl-D-erithrytol 2,4-cyclodiphosphate synthase (MECPS) (EC: 4.6.1.12), which catalyzes the conversion of 4-(cytidine 5′diphospho)-2C-methyl-D-erithrytol 2-phosphate into 2C-methyl-D-erithrytol 2,4-cyclodiphosphate (MECPD) [9]. The product of MECPS activity represents the retrograde signaling molecule that regulates the expression of nuclear genes [26,27,28,29]. A common property of genes controlled by MECPD is the overrepresentation of cis-active motifs (G/A/C)CGCG(C/G/T), which are known as rapid stress response elements (RSREs) [30,31,32]. The gene expression regulation by RSREs requires binding to calmodulin-binding transcription activator 3 (CAMTA3). Moreover, CAMTA3 cooperatively interacts with CAMTA2 or CAMTA4 [32].

The homo- or hetero-dimerization of trans-factors triggers a sequence of regulatory events that lead to a particular cellular fate, increasing the precision and complexity of gene expression regulation [33]. Examples of plant trans-factors undergoing the dimerization process are SEPALLATA3, LBD16 and 18, and auxin-response factors (ARFs) [34,35,36]. The strength of transcription response and the efficient dimerization of ARFs are mediated by closely spaced (5–7 bp) cis-active elements represented by TGTCGG inverted repeats and TGTCTC or TGTCGG direct repeats [34]. The significance of the spacer length between two TGTCNN ARF cis-active motifs was studied in A. thaliana. Distribution of direct (DR), inverted (IR), or everted repeats (ER) of these sequences with spacing ranging from 0 to 10 nt was studied in the 1500 nt long promoter region of each A. thaliana gene. Comparison with RNAseq and microarray studies showed that only IR8 and DR5 were associated with responsiveness to auxin treatment [34]. Usually, clusters of cis-active elements enabling homo-, hetero-, or oligomerization of trans-factors are not distributed statistically within gene promoters. Instead, they are concentrated in promoter sections known as modules [37,38]. The dimerization of fly CAMTA is mediated by the region within the DNA-binding CG-1 domain [39,40,41]. In the case of fly CAMTA, dimerization is required for proper nuclear localization and is not critical for binding with the gene promoter [39]. However, the dimerization of CAMTA trans-factors in mice requires palindromic repeats of the core CAMTA-binding sequence CGCANTGCG [42].

Previous research indicated that two directly repeated RSREs in the 5′UTR of the SmMECPS gene are separated by only 6 bp, suggesting their putative dimerization [43]. Such an observation suggests that the potential retrograde auto-regulation of nuclear SmMECPS gene transcription rate by MECPD is produced by plastidial MECPS enzyme. An increased concentration of MECPD could activate CAMTA3, thereby enabling its dimerization with CAMTA2 or CAMTA4 on repeated RSREs. Established CAMTA3/CAMTA2/4 complexes could stimulate MECPS gene expression [29].

The presented study aims to find out if the presence of two closely spaced, directly repeated RSREs in the 5′UTR of the SmMECPS gene is specific to the medicinal plant S. miltiorrhiza or is a more common property of MECPS genes in other plants. Furthermore, such closely spaced, directly repeated RSREs were searched in the regulatory regions of other MEP pathway genes in model plants to evaluate the potential regulation of different MEP pathway genes by MECPD and CAMTA trans-factors.

2. Materials and Methods

Promoter Analysis

The closely spaced RSREs of up to 8 bp (G/A/C)CGCG(C/G/T) were searched in the promoter regions of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MECPS) genes in the following model plants: Arabidopsis thaliana, Solanum lycopersicum, Oryza sativa, Zea mays, Gossypium hirsutum, Glycine max, and Arabidopsis lyrata [39,42,44]. The 2 kb long sequences of the promoter regions and the entire 5′UTR were retrieved from the PlantPAN3.0 database [44]. Although the promoter region in A. thaliana is approximately 0.5–1.0 kb long, the most biologically reliable cis-active elements are localized within the proximal promoter, approximately up to 300 bp upstream and 200 bp downstream from the transcription start site [45,46,47]. Therefore, the searches were concentrated on the proximal promoter and 5′UTR regions. In the second phase, the same closely spaced RSREs were searched in the proximal promoter and 5′UTR regions of other MEP pathway genes, i.e., 1-deoxy-D-xylulose-5-phosphate synthase (DXS), 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR), 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (CMS),4-(cytidine 5′-diphospho)-2-C-methyl-D-erythritol kinase (CMK), 4-hydroxy-3-methylbut-2-enyl diphosphate synthase (HDS), and 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) [6,7,8,9]. The promoter and 5′UTR sequences of the model plants, Arabidopsis thaliana, Solanum lycopersicum, Oryza sativa, Zea mays, Gossypium hirsutum, Glycine max, and Arabidopsis lyrata, were retrieved from the PlantPAN3.0 database [44].

3. Results

In total, nineteen sequences of MECPS gene promoters from seven selected model plants were analyzed. The details of the analyzed sequences are provided in Supplementary File S1 and Table S1.

Analyses of Zm00001d051458 (MECPS1) were performed on the promoters and defined using the PlantPAN3.0 database in relation to different transcripts of Zm00001d051458, described as Zm00001d051458T002-T008. Among the observed sequences of RSREs (G/A/C)CGCG(C/G/T) and spacers, the sequence ACGCGGACCGCAGCCGCGC_ was most often noted (Zm00001d051458/MECPS1_T002, T005, T006, T007,and T008). The sequence CCGCGCTACCGTTCCGCGT_was observed only in Zm00001d051458_T003 (Supplementary File S1, Table S1). A different sequence CCGCGCCACGAATCCGCGC was found in the gene Zm00001d017608/MECPS2_T001 (Table S1). Although spacer sequences are different in the two ZmMECPS1 and ZmMECPS2 genes, they are both 7 nt long. Moreover, they are localized in the 5′UTR region of the ZmMECPS1 and 2 genes (File S1, Table S1). Sequences of closely spaced RSRE repetitions within Zea maysMECPS genes are presented in

Table 1. Sequences of closely spaced RSRE repetitions found in Zea maysMECPS1 and MECPS2 genes. Sequences of RSREs are written in bold.

Nr	Sequence of Closely Spaced RSRE Repetitions	Gene ID/Name
1	ACGCGGACCGCAGCCGCGC	Zm00001d051458_T002/MECPS1
2	CCGCGCTACCGTTCCGCGT	Zm00001d051458_T003/MECPS1
3	ACGCGGACCGCAGCCGCGC	Zm00001d051458_T005/MECPS1
4	ACGCGGACCGCAGCCGCGC	Zm00001d051458_T006/MECPS1
5	ACGCGGACCGCAGCCGCGC	Zm00001d051458_T007/MECPS1
6	ACGCGGACCGCAGCCGCGC	Zm00001d051458_T008/MECPS1
7	CCGCGCCACGAATCCGCGC	Zm00001d017608_T001/MECPS2

.

The closely spaced RSRE sequences of MEP pathway genes other than ZmMECPS1 and ZmMECPS2 were observed in Zm00001d012197/CMS (Supplementary File S2, Table S2). The same sequence GCGCGCTGGTGCGCGC_was noted in Zm00001d012197/CMS_T001, T005, T006, and T007. The spacing is 4 nt (TGGT), which is much less when compared to the ZmMECPS1 and 2 genes (Supplementary File S2, Table S2). These repetitions are localized in the proximal promoter, within 317 nt from the putative transcription start site. Moreover, the Os03t0732000-00/HDR gene contains CCGCGCGCCAGAGCTCGCGCGC. However, the 10 nt long spacing between two RSREs in Os03t0732000-00/HDR is relatively long, exceeding the limit of 8 nt value [34]. Therefore, the potential to induce CAMTA dimerization should be interpreted carefully. The sequences of closely spaced RSRE repetitions found in Zea maysCMS gene are presented in

Table 2. Sequences of closely spaced RSRE repetitions found in Zea maysCMS gene. Sequences of RSREs are written in bold. A repeated RSRE sequence was found also in the Oryza sativaHDR gene. The distance between both RSREs in OsHDR is higher than the threshold of 8 nt [34]. Therefore, the putative induction of CAMTA dimerization should be interpreted cautiously.

Nr	Sequence of Closely Spaced RSRE Repetitions	Gene ID/Name
1	GCGCGCTGGTGCGCGC	Zm00001d012197_T001/CMS
2	GCGCGCTGGTGCGCGC	Zm00001d012197_T005/CMS
3	GCGCGCTGGTGCGCGC	Zm00001d012197_T006/CMS
4	GCGCGCTGGTGCGCGC	Zm00001d012197_T007/CMS
5	CCGCGCGCCAGAGCTCGCGCGC	Os03t0732000-00/HDR

.

4. Discussion

The analysis performed on the promoter regions of MECPS genes from several model plants indicated repetitions of the RSRE consensus sequence in the 5′UTR regions of two Zea maysMECPS genes, Zm00001d051458 and Zm00001d017608. The obtained results suggest that the putative dimerization site of CAMTA trans-factors, mediated by closely spaced repeated RSREs, is not specific to S. miltiorrhiza but is also observed in other plants. It is interesting that in both plants, the repeated RSREs are localized within the 5’ UTR. Putatively, the stable localization of repeated RSREs within this particular gene regulatory region may depend on potential interactions of CAMTA trans-factors with other regulatory proteins present in the Mediator complex [20]. The putative deciding circuit includes the auto-regulation of MECPS gene expression by the product of MECPS enzyme activity, MECPD, which controls the function of CAMTA3 trans-factor [29,32]. The final activation of CAMTA3 trans-factor requires its interaction with CAMTA 2 or CAMTA 4, which could be supported by the closely spaced, repeated RSREs within the 5′UTR of the MECPS gene.

The occurrence of such putative auto-regulation in two plant species, Z. mays and S. miltiorrhiza, could be related to the particular metabolic conditions of both plants. S. miltiorrhiza has significantly developed secondary metabolic routes for the production of diterpene derivatives known as tanshinones [1,4,5]. These components play an important role in adapting plants to biotic and abiotic stress conditions, and their biosynthesis mainly requires intermediates provided by the MEP pathway [8]. Such specialized metabolic requirements could involve additional regulatory events controlling the expression of the MECPS gene. Though the control of gene transcription is recognized as an approximate adjustment to the metabolic requirements of plant cells, it adds an important regulatory layer to metabolic regulation. The putative positive regulatory feedback between MECPD concentration and MECPS gene expression could help extend the relatively high transcript level of MECPS during long and sunny days [12,13,14,15,16]. Previous studies suggest that MECPD regulates plant responses to stress that are mediated by oxidative stress induced by UV, elevated temperature, and incorrect protein folding [27,48].

Zea mays belongs to plants performing C4 photosynthesis, which is more efficient than the common C3 carbon fixation route [49]. Assuming that the two precursor molecules of the MEP pathway (D-glyceraldehyde 3-phosphate and pyruvate) are derived directly from photosynthesis or glycolysis, it could be suggested that an additional regulatory circuit controlling MECPS gene expression is capable of more precise adjustment of sugar metabolism in plants [13]. It is known that sugar (sucrose) concentration regulates the transcription rate of several MEP pathway genes in the dark (DXS, DXR, CMK, CMS, and HDR) [13,14].

Results of pull-down assays performed on the CGCANTGCG palindromic core repeat showed that the interaction between 35S-myc CAMTA and FLAG-CAMTA in mice decreased in the absence of DNA sequence. Therefore, the presented CGCANTGCG core palindromic motif greatly stimulates CAMTA dimerization in mice [42]. Moreover, the strong similarities in the domain architecture between CAMTA and NFκB trans-factors acting as homo- or heterodimers suggest CAMTA inclination to dimerize [50]. Assuming that CAMTA dimerization is mediated by the CG-1 domain, which also participates in DNA binding, the spacing between cis-active RSRE consensus sequences provides the free volume between two CAMTAs, which could be necessary for proper folding and orientation of interacting CG-1 domains [42].

The obtained results suggest that the 7 nt long spacer sequences found between two CAMTA cis-active sites in Z. maysMECPS1 and MECPS2 are different. Moreover, the 7 nt spacer length in both genes is the same. Furthermore, they are within the scope of the spacer length found in ARF cis-active motifs, enabling the interaction of ARFs [34]. The TGGT linker between the two CAMTA cis-active sites found within Zm00001d012197/CMS could also play the same role. However, the putative interaction mediated by the 10nt long linker in Os03t0732000-00/HDR could be too weak to support CAMTA dimerization. The significance of all linkers and their mutants for CAMTA interaction with DNA and dimerization should be experimentally verified using yeast one-hybrid, pull-down, and electrophoretic mobility shift assays. Moreover, their DNA–protein complexes should be analyzed using NMR or X-ray crystallography in future studies to verify the putative functional significance of spacing within CAMTA cis-active elements repetitions. It could be hypothesized that the putative positive regulation of these genes by MECPD results in a pulling or pushing effect on downstream or upstream localized MEP pathway enzymes, respectively [51,52,53,54,55]. According to the maize genome database, Zm00001d051458/MECPS1 and Zm00001d017608 MECPS2 are different MECPS genes localized on chromosomes nr 4 and 5. [55]. Results obtained for other plants suggest that only one copy of the MECPS gene in the genome of Catharanthus roseus was found, while rubber tree (Hevea brasiliensis) has at least two copies [56,57].

5. Conclusions

The obtained results suggest that the presence of closely spaced, repeated RSREs in the 5′UTR is not specific to the S. miltiorrhiza MECPS gene but was also observed in their maize homolog. The presence of these cis-active elements suggests the putative auto-regulation of MECPS transcription rate by MECPD produced by MECPS enzyme. Two other MEP pathway enzymes, i.e., Zea mays CMS and Oryza sativa HDR, also contain repeated RSREs in the proximal promoter regions. Therefore, the expression of both genes could also be regulated by MECPD, enabling a putative pulling or pushing effect in relation to downstream or upstream localized MEP pathway enzymes. However, the spacing of RSREs in Oryza sativa HDR is longer than the limit of 8 nt, and the potential to induce putative CAMTA dimerization should be interpreted carefully.