Next Article in Journal
Extracts and Scirpusin B from Recycled Seeds and Rinds of Passion Fruits (Passiflora edulis var. Tainung No. 1) Exhibit Improved Functions in Scopolamine-Induced Impaired-Memory ICR Mice
Next Article in Special Issue
Camphene as a Protective Agent in Myocardial Ischemia/Reperfusion Injury
Previous Article in Journal
Chemically Modified Nanoparticles for Enhanced Antioxidant and Antimicrobial Properties with Cinnamon Essential Oil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 12
10.3390/antiox12122059
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease

by
You-Lin Tain
1,2,3,
Chih-Yao Hou
4,
Guo-Ping Chang-Chien
5,6,7,
Sufan Lin
5,6,7 and
Chien-Ning Hsu
8,9,*
1
Division of Pediatric Nephrology, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
2
Institute for Translational Research in Biomedicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
3
College of Medicine, Chang Gung University, Taoyuan 330, Taiwan
4
Department of Seafood Science, National Kaohsiung University of Science and Technology, Kaohsiung 811, Taiwan
5
Institute of Environmental Toxin and Emerging-Contaminant, Cheng Shiu University, Kaohsiung 833, Taiwan
6
Center for Environmental Toxin and Emerging-Contaminant Research, Cheng Shiu University, Kaohsiung 833, Taiwan
7
Super Micro Mass Research and Technology Center, Cheng Shiu University, Kaohsiung 833, Taiwan
8
Department of Pharmacy, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
9
School of Pharmacy, Kaohsiung Medical University, Kaohsiung 807, Taiwan
*
Author to whom correspondence should be addressed.
Antioxidants 2023, 12(12), 2059; https://0-doi-org.brum.beds.ac.uk/10.3390/antiox12122059
Submission received: 13 October 2023 / Revised: 16 November 2023 / Accepted: 28 November 2023 / Published: 29 November 2023
(This article belongs to the Special Issue Dietary Antioxidants and Cardiovascular Health, 2nd Edition)
Browse Figures
Versions Notes

Abstract

:
Taurine is a natural antioxidant with antihypertensive properties. Maternal chronic kidney disease (CKD) has an impact on renal programming and increases the risk of offspring hypertension in later life. The underlying mechanisms cover oxidative stress, a dysregulated hydrogen sulfide (H2S) system, dysbiotic gut microbiota, and inappropriate activation of the renin–angiotensin–aldosterone system (RAAS). We investigated whether perinatal taurine administration enables us to prevent high blood pressure (BP) in offspring complicated by maternal CKD. Before mating, CKD was induced through feeding chow containing 0.5% adenine for 3 weeks. Taurine was administered (3% in drinking water) during gestation and lactation. Four groups of male offspring were used (n = 8/group): controls, CKD, taurine-treated control rats, and taurine-treated rats with CKD. Taurine treatment significantly reduced BP in male offspring born to mothers with CKD. The beneficial effects of perinatal taurine treatment were attributed to an augmented H2S pathway, rebalance of aberrant RAAS activation, and gut microbiota alterations. In summary, our results not only deepen our knowledge of the mechanisms underlying maternal CKD-induced offspring hypertension but also afford us the impetus to consider taurine-based intervention as a promising preventive approach for future clinical translation.

1. Introduction

An estimated one in three adults across the earth live with hypertension [1]. Considering reducing hypertension remains a global public health problem, the WHO released guidelines on the treatment of hypertension in 2021 [2]. Most efforts, however, have gone into treating hypertension rather than keeping it from happening [3]. Noteworthy is that hypertension can originate in early life [4,5]. Hypertension is being included in the research of developmental origins of health and disease (DOHaDs) [6]. Various environmental factors occurring during the early stages of life can permanently alter organ structure and function, which leads to the developmental programming of hypertension when individuals reach adulthood [4,5,6,7]. Since early intervention may reverse adverse programming processes via reprogramming [4], the underlying mechanisms of developmental programming could be a therapeutic target for the prevention of hypertension.
The developing kidney is intrinsically susceptible to adverse early life environments, leading to long-lasting changes in morphology and function, known as so-called renal programming [7]. Renal programming has a decisive role in hypertension of developmental origins [6,7]. Oxidative stress is implicated in the pathogenesis of renal programming, which has a key role in the development of hypertension [8]. Increasing evidence suggests that effectively using perinatal natural antioxidants enables one to avert hypertension of developmental origins in several animal models [9]. Among various nutrients for the human body, natural antioxidants have received great attention over the past decades.
Taurine is a sulfur-containing amino acid with antioxidant properties [10]. The antioxidant actions of taurine cover reducing superoxide generation, enhancing antioxidant enzyme activity, stabilizing respiratory chain complexes, and inhibiting mitochondria-mediated apoptosis [11]. Additionally, taurine has some possibly advantageous effects that implicate regulation of the hydrogen sulfide (H2S) signaling pathway, the nitric oxide (NO) system, the renin–angiotensin–aldosterone system (RAAS), and gut microbiome homeostasis [11,12,13,14]. Although the antihypertensive effects of taurine have been studied in several human and animal studies [12], relatively little is known about its reprogramming effect against offspring hypertension [15,16].
In chronic kidney disease (CKD), taurine concentrations are decreased [17]. Previously, our study revealed that maternal CKD caused offspring hypertension accompanied by oxidative stress and gut microbiota dysbiosis [18], but it is unclear whether perinatal taurine administration can avert hypertension in adult offspring complicated by maternal CKD. Considering the link between H2S, NO, RAS, and gut microbiota behind hypertension of developmental origins [6,19,20], it will be of interest to determine whether they play roles in the protective mechanisms underlying taurine. In this study, we examined the effects of perinatal taurine administration on offspring’s BP and elucidated the underlying protective mechanisms using a rat model of adenine-induced maternal CKD.

2. Materials and Methods

2.1. Animal Model

Sprague–Dawley (SD) rats were purchased from BioLASCO Taiwan Co., Ltd. (Taipei, Taiwan). The animal housing facility was maintained on a 12:12 h light–dark cycle with free access to food and water. All procedures followed Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines and were reviewed by the IACUC of Chang Gung Memorial Hospital (protocol no. 2022061301).
As outlined in Figure 1, to conduct a CKD model, female rats were provided a standard chow (control group) or a chow containing 0.5% adenine (Merck KGaA, Darmstadt, Germany) during 8–11 weeks of age [18]. At 11 weeks of age, female rats were bred with the males. The presence of the plug confirmed mating. A total of 12 dams were randomly allocated to one of four groups (n = 3 per group): the C group (sham control), the CKD group (adenine-fed rats), the T group (control rats which received 3% taurine in drinking water during pregnancy and lactation), and the CKDT group (adenine-fed rats which received taurine treatment). The dose of taurine utilized here was based on previous rat research [15]. The litter size was restricted to eight pups. Because females were protected from developing hypertension [21], we only enrolled 8 male offspring from each group for use in subsequent experiments.
BPs were measured using a CODA non-invasive BP system (a tail-cuff method, Kent Scientific Corporation, Torrington, CT, USA). At 12 weeks of age, offspring rats were killed. Stool samples were collected and stored at −80 °C until analysis. Plasma samples were collected in tubes containing heparin. We collected kidney samples via dividing the cortex and medulla, snap-freezing, and storing at −80 °C in a freezer.

2.2. Analysis of H2S-Generating Enzymes and RAAS Components using qPCR

RNAs isolated from renal cortical tissues were processed for quantitative real-time polymerase chain reaction (qPCR) using a Bio-Rad iCycler iQ real-time PCR detection system (Bio-Rad, Hercules, CA, USA) in duplicate. Four H2S-generating enzymes were analyzed, including cystathionine γ-lyase (CSE), cystathionine β-synthase (CBS), d-amino acid oxidase (DAO), and 3-mercaptopyruvate sulphurtransferase (3MST).
We measured numerous RAAS components, including renin, (pro)renin receptor (PRR), angiotensin converting enzyme (ACE), angiotensinogen (AGT), and angiotensin II type 1 receptor (AT1R). We used the 18S ribosomal RNA (R18S) as the reference gene. The primers are provided in Table 1. The relative gene expression was calculated based on the comparative CT method. Fold-differences were calculated using the formula 2−ΔΔCT.

2.3. Tissue H2S-Producing Capacity

Renal H2S-producing capacity was analyzed as described previously [22]. Briefly, kidney cortex tissues (w/v, 1:10) were homogenized in 100 mM ice-cold potassium phosphate buffer (pH 7.4). Tissue homogenates were then incubated with 10 mM L-cysteine, 2 mM pyridoxal 5′-phosphate, and saline in sealed Eppendorf vials for half an hour. Later, zinc acetate (1% w/v, 250 μL) was injected, followed by trichloroacetic acid (10% w/v, 250 μL) to precipitate proteins and stop the reaction. Then, N,N-dimethyl-p-phenylenediamine sulfate in 7.2 M HCl and FeCl3 in 1.2 M HCl were added. After 15 min, the absorbance (670 nm) of the resulting solution was measured. The calibration curve of sodium hydrosulfide (3.125–250 μM) was utilized to determine the H2S concentration in each sample. All of the buffers and chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Scientific (Waltham, MA, USA).

2.4. Analysis of NO Parameters Using HPLC

NO-related parameters include L-citrulline (the precursor of L-arginine), L-arginine (the substrate for NO synthase), and asymmetric and symmetric dimethylarginine (ADMA and SDMA, inhibitors of NO synthase). Their concentrations were analyzed with an Agilent Technologies Series 1100 HPLC (Santa Clara, CA, USA) with an o-phthaldialdehyde/3-mercaptopropionic acid (OPA-3MPA; Sigma-Aldrich, St. Louis, MO, USA) derivatization reagent according to our formerly validated protocol [22].

2.5. 16S rRNA Sequencing

Genomic DNA of the stool samples from rat offspring was subjected to 16S rRNA sequencing at Biotools Co., Ltd. (New Taipei City, Taiwan) [23]. The full-length 16S genes covering the V1–V9 region were amplified with barcoded primers for multiplexed SMRTbell library (PacBio, Menlo Park, CA, USA) preparation and sequencing procedure. A QIIME2 phylogeny fast tree was applied to create a phylogenetic tree with a set of sequences representative of the amplicon sequence variants (ASVs) [24]. We analyzed the alpha and beta diversity for bacterial communities. The alpha diversity was determined using the Pielou’s evenness and Shannon index. We assessed the β-diversity using the partial least squares discriminant analysis (PLS-DA) and the Analysis of similarities (ANOSIM). Furthermore, linear discriminant analysis effect size (LEfSe) was utilized to identify the differentially abundant taxa with LDA > 4.

2.6. Statistics

All data are presented as means ± the standard error of the mean (SEM). Statistical analyses were carried out via one-way ANOVA or two-way ANOVA where appropriate. If the ANOVA indicated a significant interaction between factors, statistical differences between groups were explored using the Tukey post hoc test. For all statistical comparisons, p < 0.05 was considered statistically significant. Statistical analysis was performed by (SPSS Inc., Chicago, IL, USA).

3. Results

3.1. Body Weight and BP

As shown in Table 2, at 12 weeks of age, body weight was lower in the CKDT group than in the other groups. The kidney weight and the ratio of kidney-weight-to-body-weight was highest in CKD offspring among the four groups. However, plasma concentrations of creatinine were not different between the four groups.
Longitudinal measurement of BP from weeks 3 to 12 demonstrated that maternal CKD raised offspring’s systolic BP during 8–12 weeks of age, which was restored with maternal taurine treatment (Figure 2). As also shown in Table 2, at 12 weeks of age, diastolic BP and mean arterial pressure were greater in the CKD group than in the other groups. Taken together, these observations revealed that maternal CKD resulted in hypertension and increased kidney weight in adult offspring, which maternal taurine treatment prevented.

3.2. H2S System in the Kidneys

Since four H2S-producing enzymes were expressed in the kidney, we next studied the gene expression of CBS, CSE, 3MST, and DAO in offspring kidneys (Figure 3A). As shown in Figure 3A, renal expression of four H2S-producing enzymes was comparable between the C and CKD groups. Nevertheless, taurine treatment significantly enhanced renal expression of CBS, CSE, and DAO in the CKDT group. We further analyzed H2S synthesis in the offsprings’ kidneys. As illustrated in Figure 3B, maternal CKD caused a reduction in renal H2S production, which was prevented by perinatal taurine supplementation.

3.3. NO Parameters

We next investigated the plasma concentrations of NO-related parameters. Table 3 illustrates that both maternal CKD and taurine treatment had a negligible effect on plasma concentrations of L-citrulline, L-arginine, ADMA, and SDMA, and the ratio of L-arginine to ADMA as well.

3.4. RAAS

We further assessed the RAAS using qPCR (Figure 4). Maternal CKD augmented the renal gene expression of AGT, renin, PRR, ACE, and AT1R. Renal expression of renin and PRR were higher in the T group compared with that in the C group. Maternal taurine treatment significantly reduced CKD-induced increases in renin, AGT, ACE, and AT1R expression.

3.5. Gut Microbiota Composition

The results on the alpha diversity index of the gut microbiota in rats showed no difference between the four groups (Figure 5A,B). However, changes were observed for beta diversity indices in the microbiota of rats. As shown in Figure 5C, fecal microbiota for the four groups can be clearly separated by PLS-DA. Additionally, there were significant differences between each group for ANOSIM (All p < 0.05). Our data indicated that maternal CKD and taurine treatment both led to distinct offspring enterotypes. Consistent with previous research [18,22,23], we observed that Firmicutes and Bacteroidetes were the predominant phyla.
We used the LEfSe algorithm to determine whether any taxa at different taxonomic levels were enriched associated with CKD and taurine treatment (Figure 6). The genera Bacteroides, Alistipes, and Parabacteroides were over-represented in the CKD group, while the species Ligilactobacillus murinus and the genus and class to which it belongs were enriched in the control group. In addition, taurine treatment resulted in a higher number of genera Muribaculum and Sporofaciens in the T group. Figure 6 also reveals that taurine supplementation caused higher levels of the genera Romboutsia, Ruminococcus, and Turicibacter in the CKDT group.
A genus-based comparison showed that the proportion of Bifidobacterium, Asteroleplasma, and Dehalobacterium were augmented by perinatal taurine treatment in the CKDT group compared with that in the CKD group (Figure 7A–C). On the contrary, the CKDT group had a lower number of genus Erisipelactoclostridium vs. the CKD group (Figure 7D).

4. Discussion

This study shows the protective role of taurine in the developmental origins of hypertension as induced by maternal CKD during early life. Previously, we showed that at 12 weeks of age, adult offspring born to mothers with CKD had elevated BP along with increased kidney weight [18]. Although taurine has shown BP-lowering effects in prior research [12], our study is the first to demonstrate that maternal taurine administration protects adult offspring against the elevation of BP programmed by maternal CKD.
The key findings of the current study are as follows: (1) perinatal taurine treatment targets renal programming to halt its adverse programming processes, helping to protect adult offspring against hypertension; (2) perinatal taurine supplementation increases the gene expression of H2S-producing enzymes and H2S production in offsprings’ kidneys; (3) taurine protection against offspring hypertension coincides with the restoration of CKD-induced aberrant RAAS activation, characterized by decreases in renin, AGT, ACE, and AT1R expression; (4) maternal CKD and taurine treatment, either individually or in combination, differentially alter offsprings’ gut microbiota profile, resulting in distinct enterotypes; (5) the beneficial effect of taurine is connected with an enhanced amount of the genera Bifidobacterium, Asteroleplasma, and Dehalobacterium and a decrease in Erisipelactoclostridium. A schematic summarizing the main findings is presented in Figure 8.
In support of pregnant women with CKD who are at risk of adverse maternal and offspring outcomes [25,26], our results indicate that adult male offspring born to adenine-fed dams display hypertension and increased kidney weight, an early feature of CKD. Although plasma creatinine concentrations remain not yet elevated, the kidney weight and the kidney-weight-to-body-weight ratio are increased in the CKD offspring. Increased kidney weight could be due to renal hyperplasia or hypertrophy. The increased kidney-weight-to-body-weight ratio was used as an indicator of renal hypertrophy [27]. As renal hypertrophy can cause glomerular sclerosis, the long-term kidney outcomes of CKD offspring are worthy of additional investigation.
While taurine can have direct effects on BP [12], results from this study indicate that it also displays reprogramming effects against offsprings’ BP. One protective mechanism by which perinatal taurine protects adult offspring against hypertension is attributed to augmentation of the H2S pathway. Previously, our work revealed that the use of precursors of H2S, such as N-acetylcysteine or L-cysteine, can augment endogenous H2S production and afford protection against hypertension [22,28]. As a sulfur-containing amino acid, taurine can be used for H2S synthesis. A previous study reported that its vasodilatory effect might be due to taurine being a substrate for the synthesis of H2S to increase CBS and CSE expression [29]. In line with these findings, our data revealed that perinatal taurine treatment enhanced the expression of CBS, CSE, and DAO, as well as H2S synthesis, in offspring kidneys. Prior research supported the ability of taurine to enhance the expression of H2S-producing enzymes CBS and CSE [30], while little is known about DAO and 3MST. Our results showed that only 3MST expression was not boosted by taurine supplementation. Unlike other H2S-producing enzymes, 3MST is located in the mitochondria and catalyzes the production of H2S with 3-mercaptopyruvate as the donor of sulfur [31]. Further studies are required to investigate whether taurine differentially regulates H2S-producing enzyme expression for such reasons.
Although the H2S signaling pathway was enhanced in the CKD + T group, the expressions of H2S-generating enzymes and H2S production were not obviously altered in control offspring with taurine exposure. Exogenous H2S treatment was shown to reduce BP in spontaneously hypertensive rats (SHRs) but had no effect on normotensive Wistar–Kyoto rats [32]. Thus, H2S might counterbalance the vasoconstriction observed during hypertension only in diseased subjects (i.e., SHRs) but not in normotensive controls. As BPs are normal in the T group, this requires no compensatory augmentation of the H2S signaling pathway in response to perinatal taurine treatment.
Another beneficial action of taurine against maternal CKD-induced hypertension could be attributed to a rebalanced RAAS. We observed that maternal CKD-primed offspring hypertension coincided with aberrant activation of the RAAS. This was in line with previous studies showing that renal programming-induced hypertension and kidney disease are related to aberrant RAAS activation [20]. Taurine has shown benefits to not only established but also developed hypertension via inhibition of the RAAS [33,34]. Our study went one step further to show that perinatal use of taurine can protect offspring from hypertension along with restoring the expression of renin, AGT, ACE, and AT1R induced by maternal CKD.
Notably, perinatal taurine exposure likely programs the RAAS in control offspring, too. Prior research reported that perinatal taurine supplementation did not affect most cardiovascular and metabolic parameters in control offspring [35], while taurine exposure was shown to increase BP in adult male rat offspring; this effect is gender specific [36]. Nevertheless, our data revealed that BP did not differ between the control and taurine-exposed offspring. Such a discrepancy may be due to sex, age, strain, and method of measuring BP. Nevertheless, perinatal taurine supplementation activated the RAAS in control offspring before the appearance of hypertension, suggesting that the perinatal taurine status may enhance the pressor effect and predispose control offspring to develop hypertension in later life. As taurine intake during gestation may program hypertension in the offspring of mothers with normal pregnancies, perinatal taurine supplementation should only be used for indicated cases, but not as a usual dietary supplement in healthy pregnancy.
Since oxidative stress is implicated in the pathogenesis of CKD and taurine has antioxidant properties, it is plausible that the antihypertensive effect of taurine is related to blunting oxidative stress, known to directly quench NO [37]. Nevertheless, conflicting with prior work reporting that the beneficial effects of taurine involve regulation of the NO system [11,12], we found that perinatal taurine supplementation had neglectable effects on plasma NO-related parameters in adult offspring.
The protective mechanisms by which perinatal taurine treatment protects offspring hypertension complicated by maternal CKD are also connected with alterations in gut microbiota from the present study. Regarding gut microbiota, taurine has a protective impact on the host, serves as an energy source for microbes, defends against pathogens, and controls bacterial colonization [38].
Bifidobacterium spp. have been regarded as probiotic microorganisms because of their beneficial effects on gut health [39]. Based on our data, taurine administration which restores maternal CKD-induced reduction of Bifidobacterium levels may be attributed to its probiotic ability to avert hypertension. Probiotics have a beneficial effect on human health and they are attributed to the production of short-chain fatty acids (SCFAs) [40]. Microbial-derived SCFAs are known to play a key role in BP regulation [41]. Propionate is one of the dominant SCFAs. Previously, we reported that perinatal propionate supplementation protected rat offspring against hypertension programmed by maternal CKD [42]. As the dietary addition of taurine was reported to increase the production of SCFAs [43], additional studies are needed to assess whether SCFAs contribute to the protective action of taurine.
Consistent with research in hypertensive people and animals [44,45,46], we observed that BP was negatively correlated with a high abundance of the genera Romboutsia, Ruminococcus, Asteroleplasma, and Dehalobacterium, while it was positively associated with the augmented abundance of Erisipelactoclostridium. Also, we found that the species Ligilactobacillus murinus and the genus and class to which it belongs were depleted in the CKD group. Our finding ties well with prior research showing that a low abundance of the species Ligilactobacillus murinus correlates with hypertension [47]. Our results raise the possibility that the beneficial action of taurine on the developmental origins of hypertension may be related to its capability to alter hypertension-related taxa. In addition, perinatally taurine-exposed offspring exhibited higher proportions of the genera Alistipes, Muribaculum, and Turicibacter. These bacteria are known to process the abundant taurine-conjugated bile acids [38,48]. As disrupted bile acid signaling as a putative mechanism underlying the dysbiotic gut microbiota contributes to hypertension [49], how taurine regulates these microbes and microbial-derived bile acids upon its protective effects is worthy of further evaluation.
Limitations of the current study include a lack of analysis of gut microbiota-derived metabolites in dams and offspring. Given the complex crosstalk between taurine and gut microbiota metabolism [14], the protective role of perinatal taurine supplementation comes from which microbial metabolites (e.g., SCFAs) deserve further clarification. Second, in the current study, only male offspring were enrolled. Whether sex differences occur in the reprogramming effects of taurine needs further clarification. Third, we mainly focused on the kidney in the current study. We cannot exclude the possibility that the protective action of taurine may be specific to other organ systems involved in controlling BP. Fourth, all offspring were sacrificed at 12 weeks of age in the current study. Extended follow-up may provide information on long-term effects, such as the development of hypertension in taurine-exposed control offspring or the life prognosis of four groups. Last, prior work indicated that taurine exerts multiple roles to confer protection against oxidant stress [10,11]. Despite perturbations of H2S and NO as contributors to oxidative stress, whether the protective actions of taurine are attributed to other components of oxidative stress deserves further clarification.

5. Conclusions

In conclusion, perinatal taurine administration has several protective effects on maternal CKD-induced offspring hypertension, covering the augmentation of the H2S system, the rebalancing of the RAAS, and alterations in the gut microbiota. Our findings not only deepen our understanding of the mechanisms behind hypertension of developmental origins but also provide potential therapeutic targets for renal programming-related diseases. Hereafter, taurine-based foods or drugs will be expected to be valuable for the purposes of optimizing global kidney health.

Author Contributions

Conceptualization, Y.-L.T. and C.-N.H.; Methodology, C.-Y.H., G.-P.C.-C. and S.L.; Formal analysis, Y.-L.T., S.L. and C.-N.H.; Investigation, C.-Y.H., G.-P.C.-C. and S.L.; Data curation, Y.-L.T.; Writing—original draft, Y.-L.T. and C.-N.H.; Writing—review and editing, Y.-L.T. and C.-N.H.; Funding acquisition, Y.-L.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by CMRPG8M1371 from the Kaohsiung Chang Gung Memorial Hospital, Taiwan.

Institutional Review Board Statement

All animal studies were approved by the Institutional Animal Ethics Committee (IACUC) of Chang Gung Memorial Hospital (Permit # 2022061301).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We would like to thank the Institute of Environmental Toxin and Emerging-Contaminant, the Super Micro Mass Research and Technology Center, and the Center for Environmental Toxin and Emerging Contaminant Research, Cheng Shiu University, Kaohsiung, for technical support. We also appreciate the support by the Center for Laboratory Animals, Kaohsiung Chang Gung Memorial Hospital.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. World Health Organization. Hypertension. 2023. Available online: https://www.who.int/news-room/fact-sheets/detail/hypertension (accessed on 6 October 2023).
  2. WHO. Guideline for the Pharmacological Treatment of Hypertension in Adults; Licence: CC BY-NC-SA 3.0 IGO; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
  3. Bromfield, S.; Muntner, P. High blood pressure: The leading global burden of disease risk factor and the need for worldwide prevention programs. Curr. Hypertens. Rep. 2013, 15, 134–136. [Google Scholar] [CrossRef] [PubMed]
  4. Paauw, N.D.; van Rijn, B.B.; Lely, A.T.; Joles, J.A. Pregnancy as a critical window for blood pressure regulation in mother and child: Programming and reprogramming. Acta Physiol. 2017, 219, 241–259. [Google Scholar] [CrossRef] [PubMed]
  5. Luyckx, V.A.; Bertram, J.F.; Brenner, B.M.; Fall, C.; Hoy, W.E.; Ozanne, S.E.; Vikse, B.E. Effect of fetal and child health on kidney development and long-term risk of hypertension and kidney disease. Lancet 2013, 382, 273–283. [Google Scholar] [CrossRef] [PubMed]
  6. Hsu, C.N.; Tain, Y.L. Animal Models for DOHaD Research: Focus on Hypertension of Developmental Origins. Biomedicines 2021, 9, 623. [Google Scholar] [CrossRef] [PubMed]
  7. Kett, M.M.; Denton, K.M. Renal programming: Cause for concern? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R791–R803. [Google Scholar] [CrossRef] [PubMed]
  8. Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 289, R913–R935. [Google Scholar] [CrossRef] [PubMed]
  9. Tain, Y.L.; Hsu, C.N. Oxidative Stress-Induced Hypertension of Developmental Origins: Preventive Aspects of Antioxidant Therapy. Antioxidants 2022, 11, 511. [Google Scholar] [CrossRef]
  10. Surai, P.F.; Earle-Payne, K.; Kidd, M.T. Taurine as a Natural Antioxidant: From Direct Antioxidant Effects to Protective Action in Various Toxicological Models. Antioxidants 2021, 10, 1876. [Google Scholar] [CrossRef]
  11. Baliou, S.; Adamaki, M.; Ioannou, P.; Pappa, A.; Panayiotidis, M.I.; Spandidos, D.A.; Christodoulou, I.; Kyriakopoulos, A.M.; Zoumpourlis, V. Protective role of taurine against oxidative stress (Review). Mol. Med. Rep. 2021, 24, 605. [Google Scholar] [CrossRef]
  12. Militante, J.D.; Lombardini, J.B. Treatment of hypertension with oral taurine: Experimental and clinical studies. Amino Acids 2002, 23, 381–393. [Google Scholar] [CrossRef]
  13. Guizoni, D.M.; Freitas, I.N.; Victorio, J.A.; Possebom, I.R.; Araujo, T.R.; Carneiro, E.M.; Davel, A.P. Taurine treatment reverses protein malnutrition-induced endothelial dysfunction of the pancreatic vasculature: The role of hydrogen sulfide. Metabolism 2021, 116, 154701. [Google Scholar] [CrossRef] [PubMed]
  14. Qian, W.; Li, M.; Yu, L.; Tian, F.; Zhao, J.; Zhai, Q. Effects of Taurine on Gut Microbiota Homeostasis: An Evaluation Based on Two Models of Gut Dysbiosis. Biomedicines 2023, 11, 1048. [Google Scholar] [CrossRef] [PubMed]
  15. Roysommuti, S.; Lerdweeraphon, W.; Malila, P.; Jirakulsomchok, D.; Wyss, J.M. Perinatal taurine alters arterial pressure control and renal function in adult offspring. Adv. Exp. Med. Biol. 2009, 643, 145–156. [Google Scholar] [PubMed]
  16. Roysommuti, S.; Wyss, J.M. Perinatal taurine exposure affects adult arterial pressure control. Amino Acids 2014, 46, 57–72. [Google Scholar] [CrossRef] [PubMed]
  17. Suliman, M.E.; Anderstam, B.; Bergström, J. Evidence of taurine depletion and accumulation of cysteinesulfinic acid in chronic dialysis patients. Kidney Int. 1996, 50, 1713–1717. [Google Scholar] [CrossRef] [PubMed]
  18. Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Adenine-Induced Chronic Kidney Disease Programs Hypertension in Adult Male Rat Offspring: Implications of Nitric Oxide and Gut Microbiome Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [PubMed]
  19. Carlström, M. Nitric oxide signalling in kidney regulation and cardiometabolic health. Nat. Rev. Nephrol. 2021, 17, 575–590. [Google Scholar] [CrossRef]
  20. Yosypiv, I.V. Renin-angiotensin system in mammalian kidney development. Pediatr. Nephrol. 2020, 36, 479–489. [Google Scholar] [CrossRef]
  21. Colafella, K.M.M.; Denton, K.M. Sex-specific differences in hypertension and associated cardiovascular disease. Nat. Rev. Nephrol. 2018, 14, 185–201. [Google Scholar] [CrossRef]
  22. Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal N-Acetylcysteine Therapy Prevents Hypertension in Spontaneously Hypertensive Rat Offspring: Implications of Hydrogen Sulfide-Generating Pathway and Gut Microbiota. Antioxidants 2020, 9, 856. [Google Scholar] [CrossRef]
  23. Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Hsu, C.N. Protection by Means of Perinatal Oral Sodium Thiosulfate Administration against Offspring Hypertension in a Rat Model of Maternal Chronic Kidney Disease. Antioxidants 2023, 12, 1344. [Google Scholar] [CrossRef] [PubMed]
  24. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
  25. Hladunewich, M.A. Chronic Kidney Disease and Pregnancy. Semin. Nephrol. 2017, 37, 337–346. [Google Scholar] [CrossRef] [PubMed]
  26. Nevis, I.F.; Reitsma, A.; Dominic, A.; McDonald, S.; Thabane, L.; Akl, E.A.; Hladunewich, M.; Akbari, A.; Joseph, G.; Sia, W.; et al. Pregnancy outcomes in women with chronic kidney disease: A systematic review. Clin. J. Am. Soc. Nephrol. 2011, 6, 2587–2598. [Google Scholar] [CrossRef] [PubMed]
  27. Reyes, A.A.; Klahr, S. Dietary supplementation of L-arginine ameliorates renal hypertrophy in rats fed a high-protein diet. Proc. Soc. Exp. Biol. Med. 1994, 206, 157–161. [Google Scholar] [CrossRef] [PubMed]
  28. Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Dietary Supplementation with Cysteine during Pregnancy Rescues Maternal Chronic Kidney Disease-Induced Hypertension in Male Rat Offspring: The Impact of Hydrogen Sulfide and Microbiota-Derived Tryptophan Metabolites. Antioxidants 2022, 11, 483. [Google Scholar] [CrossRef] [PubMed]
  29. Sun, Q.; Wang, B.; Li, Y.; Sun, F.; Li, P.; Xia, W.; Zhou, X.; Li, Q.; Wang, X.; Chen, J.; et al. Taurine Supplementation Lowers Blood Pressure and Improves Vascular Function in Prehypertension: Randomized, Double-Blind, Placebo-Controlled Study. Hypertension 2016, 67, 541–549. [Google Scholar] [CrossRef]
  30. DiNicolantonio, J.J.; Okeefe, J.H.; McCarty, M.F. Boosting endogenous production of vasoprotective hydrogen sulfide via supplementation with taurine and N-acetylcysteine: A novel way to promote cardiovascular health. Open Heart 2017, 4, e000600. [Google Scholar] [CrossRef]
  31. Rao, S.P.; Dobariya, P.; Bellamkonda, H.; More, S.S. Role of 3-Mercaptopyruvate Sulfurtransferase (3-MST) in Physiology and Disease. Antioxidants 2023, 12, 603. [Google Scholar] [CrossRef]
  32. Sun, L.; Jin, H.; Sun, L.; Chen, S.; Huang, Y.; Liu, J.; Li, Z.; Zhao, M.; Sun, Y.; Tang, C.; et al. Hydrogen sulfide alleviates myocardial collagen remodeling in association with inhibition of TGF-β/Smad signaling pathway in spontaneously hypertensive rats. Mol. Med. 2015, 20, 503–515. [Google Scholar] [CrossRef]
  33. Qaradakhi, T.; Gadanec, L.K.; McSweeney, K.R.; Abraham, J.R.; Apostolopoulos, V.; Zulli, A. The Anti-Inflammatory Effect of Taurine on Cardiovascular Disease. Nutrients 2020, 12, 2847. [Google Scholar] [CrossRef] [PubMed]
  34. Scabora, J.E.; de Lima, M.C.; Lopes, A.; de Lima, I.P.; Mesquita, F.F.; Torres, D.B.; Boer, P.A.; Gontijo, J.A. Impact of taurine supplementation on blood pressure in gestational protein-restricted offspring: Effect on the medial solitary tract nucleus cell numbers, angiotensin receptors, and renal sodium handling. J. Renin-Angiotensin-Aldosterone Syst. 2015, 16, 47–58. [Google Scholar] [CrossRef] [PubMed]
  35. Thaeomor, A.; Teangphuck, P.; Chaisakul, J.; Seanthaweesuk, S.; Somparn, N.; Roysommuti, S. Perinatal Taurine Supplementation Prevents Metabolic and Cardiovascular Effects of Maternal Diabetes in Adult Rat Offspring. Adv. Exp. Med. Biol. 2017, 975, 295–305. [Google Scholar] [PubMed]
  36. Roysommuti, S.; Suwanich, A.; Lerdweeraphon, W.; Thaeomor, A.; Jirakulsomchok, D.; Wyss, J.M. Sex dependent effects of perinatal taurine exposure on the arterial pressure control in adult offspring. Adv. Exp. Med. Biol. 2009, 643, 135–144. [Google Scholar] [PubMed]
  37. Paolocci, N.; Biondi, R.; Bettini, M.; Lee, C.I.; Berlowitz, C.O.; Rossi, R.; Xia, Y.; Ambrosio, G.; L’Abbate, A.; Kass, D.A.; et al. Oxygen radical-mediated reduction basal and agonist-evoked NO release in isolated rat heart. J. Mol. Cell Cardiol. 2001, 33, 671–679. [Google Scholar] [CrossRef] [PubMed]
  38. Duszka, K. Versatile Triad Alliance: Bile Acid, Taurine and Microbiota. Cells 2022, 11, 2337. [Google Scholar] [CrossRef] [PubMed]
  39. Hidalgo-Cantabrana, C.; Delgado, S.; Ruiz, L.; Ruas-Madiedo, P.; Sánchez, B.; Margolles, A. Bifidobacteria and Their Health-Promoting Effects. Microbiol. Spectr. 2017, 5. [Google Scholar] [CrossRef]
  40. Markowiak-Kopeć, P.; Śliżewska, K. The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 2020, 12, 1107. [Google Scholar] [CrossRef]
  41. Poll, B.G.; Xu, J.; Jun, S.; Sanchez, J.; Zaidman, N.A.; He, X.; Lester, L.; Berkowitz, D.E.; Paolocci, N.; Gao, W.D.; et al. Acetate, a Short-Chain Fatty Acid, Acutely Lowers Heart Rate and Cardiac Contractility Along with Blood Pressure. J. Pharmacol. Exp. Ther. 2021, 377, 39–50. [Google Scholar] [CrossRef]
  42. Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.F.; Hsu, C.N. Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension. Nutrients 2022, 14, 3435. [Google Scholar] [CrossRef]
  43. Yu, H.; Guo, Z.; Shen, S.; Shan, W. Effects of taurine on gut microbiota and metabolism in mice. Amino Acids 2016, 48, 1601–1617. [Google Scholar] [CrossRef] [PubMed]
  44. Xie, D.; Zhang, M.; Wang, B.; Lin, H.; Wu, E.; Zhao, H.; Li, S. Differential Analysis of Hypertension-Associated Intestinal Microbiota. Int. J. Med. Sci. 2019, 16, 872–881. [Google Scholar]
  45. Smiljanec, K.; Lennon, S.L. Sodium, hypertension, and the gut: Does the gut microbiota go salty? Am. J. Physiol. Heart Circ. Physiol. 2019, 317, H1173–H1182. [Google Scholar] [CrossRef] [PubMed]
  46. Palmu, J.; Lahti, L.; Niiranen, T. Targeting Gut Microbiota to Treat Hypertension: A Systematic Review. Int. J. Environ. Res. Public Health 2021, 18, 1248. [Google Scholar] [CrossRef] [PubMed]
  47. Mukohda, M.; Yano, T.; Matsui, T.; Nakamura, S.; Miyamae, J.; Toyama, K.; Mitsui, R.; Mizuno, R.; Ozaki, H. Treatment with Ligilactobacillus murinus lowers blood pressure and intestinal permeability in spontaneously hypertensive rats. Sci. Rep. 2023, 13, 15197. [Google Scholar] [CrossRef] [PubMed]
  48. Just, S.; Mondot, S.; Ecker, J.; Wegner, K.; Rath, E.; Gau, L.; Streidl, T.; Hery-Arnaud, G.; Schmidt, S.; Lesker, T.R.; et al. The gut microbiota drives the impact of bile acids and fat source in diet on mouse metabolism. Microbiome 2018, 6, 134. [Google Scholar] [CrossRef] [PubMed]
  49. Ishimwe, J.A.; Dola, T.; Ertuglu, L.A.; Kirabo, A. Bile acids and salt-sensitive hypertension: A role of the gut-liver axis. Am. J. Physiol. Heart Circ. Physiol. 2022, 322, H636–H646. [Google Scholar] [CrossRef]
Antioxidants 12 02059 g001
Figure 1. Experimental design and animal grouping.
Figure 1. Experimental design and animal grouping.
Antioxidants 12 02059 g001
Antioxidants 12 02059 g002
Figure 2. Systolic blood pressure in offspring from 3 to 12 weeks of age (n = 8/group). * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 2. Systolic blood pressure in offspring from 3 to 12 weeks of age (n = 8/group). * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g002
Antioxidants 12 02059 g003
Figure 3. (A) Renal gene expression of H2S-generating enzymes cystathionine β-synthase (CBS), cystathionine γ-lyase (CSE), 3-mercaptopyruvate sulphurtransferase (3MST), and d-amino acid oxidase (DAO). (B) Renal H2S synthesis. * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 3. (A) Renal gene expression of H2S-generating enzymes cystathionine β-synthase (CBS), cystathionine γ-lyase (CSE), 3-mercaptopyruvate sulphurtransferase (3MST), and d-amino acid oxidase (DAO). (B) Renal H2S synthesis. * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g003
Antioxidants 12 02059 g004
Figure 4. Renal gene expression of renin-angiotensin-aldosterone system components, including renin, (pro)renin receptor (PRR), angiotensinogen (AGT), angiotensin converting enzyme (ACE), and angiotensin II type 1 receptor (AT1R). * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 4. Renal gene expression of renin-angiotensin-aldosterone system components, including renin, (pro)renin receptor (PRR), angiotensinogen (AGT), angiotensin converting enzyme (ACE), and angiotensin II type 1 receptor (AT1R). * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g004
Antioxidants 12 02059 g005
Figure 5. Alpha and beta diversities among groups. Alpha diversity was significant for (A) Pielou’s evenness and (B) Shannon index. p < 0.05 vs. C. (C) Partial least squares discriminant analysis (PLS-DA) plots of beta diversity. Each dot represents the microbiota of a single sample, and dots of the same color belong to the same group. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 5. Alpha and beta diversities among groups. Alpha diversity was significant for (A) Pielou’s evenness and (B) Shannon index. p < 0.05 vs. C. (C) Partial least squares discriminant analysis (PLS-DA) plots of beta diversity. Each dot represents the microbiota of a single sample, and dots of the same color belong to the same group. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g005
Antioxidants 12 02059 g006
Figure 6. Linear discriminant analysis effect size (LEfSe) identified most differential taxa where LDA score thresholds > 4 were listed. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 6. Linear discriminant analysis effect size (LEfSe) identified most differential taxa where LDA score thresholds > 4 were listed. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g006
Antioxidants 12 02059 g007
Figure 7. Genus-based comparison between the CKD and CKDT groups. Relative abundance of (A) Bifidobacterium, (B) Asteroleplasma, (C) Dehalobacterium, and (D) Erisipelactoclostridium. The outliers are shown as dots. * p < 0.05; *** p < 0.005; **** p < 0.001. CKD = adenine-exposed offspring rats; CKDT = offspring rats born to adenine-treated dams which received taurine.
Figure 7. Genus-based comparison between the CKD and CKDT groups. Relative abundance of (A) Bifidobacterium, (B) Asteroleplasma, (C) Dehalobacterium, and (D) Erisipelactoclostridium. The outliers are shown as dots. * p < 0.05; *** p < 0.005; **** p < 0.001. CKD = adenine-exposed offspring rats; CKDT = offspring rats born to adenine-treated dams which received taurine.
Antioxidants 12 02059 g007
Antioxidants 12 02059 g008
Figure 8. Schematic diagram summarizing the protective effects of perinatal taurine supplementation in male offspring born to dams with CKD and putative mechanisms. CKD = chronic kidney disease; H2S = hydrogen sulfide; RAAS = renin–angiotensin–aldosterone system; BP = blood pressure.
Figure 8. Schematic diagram summarizing the protective effects of perinatal taurine supplementation in male offspring born to dams with CKD and putative mechanisms. CKD = chronic kidney disease; H2S = hydrogen sulfide; RAAS = renin–angiotensin–aldosterone system; BP = blood pressure.
Antioxidants 12 02059 g008
Table 1. PCR primers.
Table 1. PCR primers.
GeneGene Accession NoForwardReverse
ReninJ02941.15 aacattaccagggcaactttcact 35 acccccttcatggtgatctg 3
PRRAB188298.15 gaggcagtgaccctcaacat 35 ccctcctcacacaacaaggt 3
AGTXM_032887807.15 gcccaggtcgcgatgat 35 tgtacaagatgctgagtgaggcaa 3
ACEU03734.15 caccggcaaggtctgctt 35 cttggcatagtttcgtgaggaa 3
AT1RNM_030985.45 gctgggcaacgagtttgtct 35 cagtccttcagctggatcttca 3
CSENM_017074.25 cgcacaaattgtccacaaac 35 gctctgtccttctcaggcac 3
CBSNM_012522.25 atgctgcagaaaggcttcat 35 gtggaaaccagtcggtgtct 3
DAONM_053626.15 ccctttctggaaaagcacag 35 ctcctctcaccacctcttcg 3
3MSTNM_138843.25 ggctcagtaaacatcccattc 35 tgtccttcacagggtcttcc 3
R18SX011175 gccgcggtaattccagctcca 35 cccgcccgctcccaagatc 3
Table 2. Weight, BP, and kidney function in 12-week-old offspring.
Table 2. Weight, BP, and kidney function in 12-week-old offspring.
GroupsCCKDTCKDT
Body weight, g280 ± 5281 ± 9308 ± 9269 ± 9 *,#
Left kidney weight, g1.27 ± 0.0291.49 ± 0.057 *1.30 ± 0.032 #1.19 ± 0.034 *,#
Left kidney weight/body weight0.046 ± 0.0010.053 ± 0.001 *0.042 ± 0.001 #0.044 ± 0.002 #
Creatinine, μM1.38 ± 0.511.29 ± 0.291.45 ± 0.521.37 ± 0.61
Systolic blood pressure, mmHg131 ± 1148 ± 2 *131 ± 1 #132 ± 1 #
Diastolic blood pressure, mmHg88 ± 1101 ± 2 *86 ± 2 #91 ± 2 #
Mean arterial pressure, mmHg102 ± 1117 ± 2 *101 ± 2 #104 ± 2 #
n = 8/group; * p < 0.05 vs. C; # p < 0.05 vs. CKD. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Table 3. Plasma concentrations of NO-related parameters in offspring at 12 weeks of age.
Table 3. Plasma concentrations of NO-related parameters in offspring at 12 weeks of age.
GroupsCCKDTCKDT
L-citrulline, μM56.6 ± 4.150.9 ± 1.359.8 ± 2.458.5 ± 2.6
L-arginine, μM179.0 ± 6.3161.6 ± 3.4164.5 ± 9.1166.3 ± 3.4
ADMA, μM1.71 ± 0.072.02 ± 0.091.85 ± 0.082.18 ± 0.06
SDMA, μM1.77 ± 0.071.62 ± 0.101.87 ± 0.042.03 ± 0.1
L-arginine to ADMA ratio, μM/μM113.7 ± 6.075.2 ± 4.195.6 ± 7.672.4 ± 1.8
n = 8/group. C = control offspring rats; CKD = adenine-exposed offspring rats; T = offspring rats born to dams which received taurine; CKDT = offspring rats born to adenine-treated dams which received taurine.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tain, Y.-L.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Hsu, C.-N. Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease. Antioxidants 2023, 12, 2059. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox12122059

AMA Style

Tain Y-L, Hou C-Y, Chang-Chien G-P, Lin S, Hsu C-N. Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease. Antioxidants. 2023; 12(12):2059. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox12122059

Chicago/Turabian Style

Tain, You-Lin, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, and Chien-Ning Hsu. 2023. "Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease" Antioxidants 12, no. 12: 2059. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox12122059

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop