Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals Procedures
2.2. Biochemical Analysis
2.3. Histological Analysis, Immunohistochemical Staining, and Immunofluorescent Staining
2.4. Western Blot Analysis
2.5. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.6. TdT-Mediated dUTP Nick End Labeling (TUNEL) Assay
2.7. Statistical Analysis
3. Results
3.1. Kahweol Attenuated Cisplatin-Induced Kidney Injury
3.2. Kahweol Inhibited Cisplatin-Induced Oxidative Stress
3.3. Kahweol Suppressed Cisplatin-Induced Tubular Cell Death
3.4. Kahweol Alleviated Cisplatin-Induced Inflammatory Responses
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Holditch, S.J.; Brown, C.N.; Lombardi, A.M.; Nguyen, K.N.; Edelstein, C.L. Recent Advances in Models, Mechanisms, Biomarkers, and Interventions in Cisplatin-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2019, 20, 3011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pabla, N.; Dong, Z. Cisplatin nephrotoxicity: Mechanisms and renoprotective strategies. Kidney Int. 2008, 73, 994–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sánchez-González, P.D.; López-Hernández, F.J.; López-Novoa, J.M.; Morales, A.I. An integrative view of the pathophysiological events leading to cisplatin nephrotoxicity. Crit. Rev. Toxicol. 2011, 41, 803–821. [Google Scholar] [CrossRef] [PubMed]
- Trujillo, J.; Molina-Jijón, E.; Medina-Campos, O.N.; Rodríguez-Muñoz, R.; Reyes, J.L.; Barrera, D.; Pedraza-Chaverri, J. Superoxide anion production and expression of gp91(phox) and p47(phox) are increased in glomeruli and proximal tubules of cisplatin-treated rats. J. Biochem. Mol. Toxicol. 2015, 29, 149–156. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Park, J.-H.; Kim, K.; Jo, J.; Leem, J.; Park, K.-K. Pharmacological inhibition of caspase-1 ameliorates cisplatin-induced nephrotoxicity through suppression of apoptosis, oxidative stress, and inflammation in mice. Mediat. Inflamm. 2018, 2018, 6571676. [Google Scholar] [CrossRef]
- Jiang, M.; Wei, Q.; Pabla, N.; Dong, G.; Wang, C.Y.; Wang, T.; Smith, S.B.; Dong, Z. Effects of hydroxyl radical scavenging on cisplatin-induced p53 activation, tubular cell apoptosis and nephrotoxicity. Biochem. Pharmacol. 2007, 73, 1499–1510. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Ma, H.; Shao, J.; Wu, J.; Zhou, L.; Zhang, Z.; Wang, Y.; Huang, Z.; Ren, J.; Liu, S.; et al. A Role for Tubular Necroptosis in Cisplatin-Induced AKI. J. Am. Soc. Nephrol. 2015, 26, 2647–2658. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.W.; Jo, J.; Kim, J.-Y.; Choe, M.; Leem, J.; Park, J.-H. Melatonin Attenuates Cisplatin-Induced Acute Kidney Injury through Dual Suppression of Apoptosis and Necroptosis. Biology 2019, 8, 64. [Google Scholar] [CrossRef] [Green Version]
- Tristão, V.R.; Pessoa, E.A.; Nakamichi, R.; Reis, L.A.; Batista, M.C.; Durão Junior Mde, S.; Monte, J.C. Synergistic effect of apoptosis and necroptosis inhibitors in cisplatin-induced nephrotoxicity. Apoptosis 2016, 21, 51–59. [Google Scholar] [CrossRef]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Invest. 2002, 110, 835–842. [Google Scholar] [CrossRef]
- Miao, N.; Yin, F.; Xie, H.; Wang, Y.; Xu, Y.; Shen, Y.; Xu, D.; Yin, J.; Wang, B.; Zhou, Z.; et al. The cleavage of gasdermin D by caspase-11 promotes tubular epithelial cell pyroptosis and urinary IL-18 excretion in acute kidney injury. Kidney Int. 2019, 96, 1105–1120. [Google Scholar] [CrossRef] [PubMed]
- Miyagi, M.Y.S.; Latancia, M.T.; Testagrossa, L.A.; Andrade-Oliveira, V.; Pereira, W.O.; Hiyane, M.I.; Enjiu, L.M.; Pisciottano, M.; Seelaender, M.C.L.; Camara, N.O.S.; et al. Physical exercise contributes to cisplatin-induced nephrotoxicity protection with decreased CD4+ T cells activation. Mol. Immunol. 2018, 101, 507–513. [Google Scholar] [CrossRef] [PubMed]
- Poole, R.; Kennedy, O.J.; Roderick, P.; Fallowfield, J.A.; Hayes, P.C.; Parkes, J. Coffee consumption and health: Umbrella review of meta-analyses of multiple health outcomes. BMJ 2017, 359, j5024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, Y.; Wang, C.; Xu, J.; Wang, S. Cafestol and Kahweol: A Review on Their Bioactivities and Pharmacological Properties. Int. J. Mol. Sci. 2019, 20, 4238. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.-F.; Lin, J.S.; Chang, C.-F. Acute Kahweol Treatment Attenuates Traumatic Brain Injury Neuroinflammation and Functional Deficits. Nutrients 2019, 11, 2301. [Google Scholar] [CrossRef] [Green Version]
- Seo, H.-Y.; Kim, M.-K.; Lee, S.-H.; Hwang, J.S.; Park, K.-G.; Jang, B.K. Kahweol Ameliorates the Liver Inflammation through the Inhibition of NF-κB and STAT3 Activation in Primary Kupffer Cells and Primary Hepatocytes. Nutrients 2018, 10, 863. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.Y.; Kim, D.H.; Jeong, H.G. Inhibitory effect of the coffee diterpene kahweol on carrageenan-induced inflammation in rats. Biofactors 2006, 26, 17–28. [Google Scholar] [CrossRef]
- Tanimura, S.; Tanabe, K.; Miyake, H.; Masuda, K.; Tsushida, K.; Morioka, T.; Sugiyama, H.; Sato, Y.; Wada, J. Renal tubular injury exacerbated by vasohibin-1 deficiency in a murine cisplatin-induced acute kidney injury model. Am. J. Physiol.-Ren. Physiol. 2019, 317, F264–F274. [Google Scholar] [CrossRef]
- Dunn, S.R.; Qi, Z.; Bottinger, E.P.; Breyer, M.D.; Sharma, K. Utility of endogenous creatinine clearance as a measure of renal function in mice. Kidney Int. 2004, 65, 1959–1967. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.H.; Jung, G.; Kim, S.; Koo, J.W. Novel Peptide Vaccine GV1001 Rescues Hearing in Kanamycin/Furosemide-Treated Mice. Front. Cell. Neurosci. 2018, 12, 3. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Leem, J.; Jeon, E.J. Protective Effects of Melatonin Against Aristolochic Acid-Induced Nephropathy in Mice. Biomolecules 2020, 10, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Protective Effects of SPA0355, a Thiourea Analogue, Against Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Antioxidants 2020, 9, 585. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.J.; Choi, J.H.; Jeong, H.G. Hepatoprotective and antioxidant effects of the coffee diterpenes kahweol and cafestol on carbon tetrachloride-induced liver damage in mice. Food Chem. Toxicol. 2007, 45, 2118–2125. [Google Scholar] [CrossRef] [PubMed]
- Hwang, Y.P.; Jeong, H.G. The coffee diterpene kahweol induces heme oxygenase-1 via the PI3K and p38/Nrf2 pathway to protect human dopaminergic neurons from 6-hydroxydopamine-derived oxidative stress. FEBS Lett. 2008, 582, 2655–2662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Lee, S.-J.; Maeng, Y.-I.; Leem, J.; Park, K.-K. Protective Effects of Bee Venom against Endotoxemia-Related Acute Kidney Injury in Mice. Biology 2020, 9, 154. [Google Scholar]
- Yang, Q.; Wu, F.R.; Wang, J.N.; Gao, L.; Jiang, L.; Li, H.D.; Ma, Q.; Liu, X.Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef]
- Meng, X.M.; Ren, G.L.; Gao, L.; Yang, Q.; Li, H.D.; Wu, W.F.; Huang, C.; Zhang, L.; Lv, X.W.; Li, J. NADPH oxidase 4 promotes cisplatin-induced acute kidney injury via ROS-mediated programmed cell death and inflammation. Lab. Invest. 2018, 98, 63–78. [Google Scholar]
- Lien, E.J.; Lien, L.L.; Wang, R.; Wang, J. Phytochemical analysis of medicinal plants with kidney protective activities. Chin. J. Integr. Med. 2012, 18, 790–800. [Google Scholar] [CrossRef]
- Gómez-Sierra, T.; Eugenio-Pérez, D.; Sánchez-Chinchillas, A.; Pedraza-Chaverri, J. Role of food-derived antioxidants against cisplatin induced-nephrotoxicity. Food Chem. Toxicol. 2018, 120, 230–242. [Google Scholar] [CrossRef]
- Oh, S.H.; Hwang, Y.P.; Choi, J.H.; Jin, S.W.; Lee, G.H.; Han, E.H.; Chung, Y.H.; Chung, Y.C.; Jeong, H.G. Kahweol inhibits proliferation and induces apoptosis by suppressing fatty acid synthase in HER2-overexpressing cancer cells. Food Chem. Toxicol. 2018, 121, 326–335. [Google Scholar] [CrossRef] [PubMed]
- Jeon, Y.J.; Bang, W.; Cho, J.H.; Lee, R.H.; Kim, S.H.; Kim, M.S.; Park, S.M.; Shin, J.C.; Chung, H.J.; Oh, K.B.; et al. Kahweol induces apoptosis by suppressing BTF3 expression through the ERK signaling pathway in non-small cell lung cancer cells. Int. J. Oncol. 2016, 49, 2294–2302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rjeibi, I.; Feriani, A.; Ben Saad, A.; Sdayria, J.; Saidi, I.; Ncib, S.; Souid, S.; Allagui, M.S.; Hfaiedh, N. Lycium europaeum Extract: A New Potential Antioxidant Source against Cisplatin-Induced Liver and Kidney Injuries in Mice. Oxid. Med. Cell. Longev. 2018, 2018, 1630751. [Google Scholar] [CrossRef] [Green Version]
- Anders, H.J. Necroptosis in Acute Kidney Injury. Nephron 2018, 139, 342–348. [Google Scholar] [CrossRef] [PubMed]
- Kuang, Q.; Xue, N.; Chen, J.; Shen, Z.; Cui, X.; Fang, Y.; Ding, X. Necrostatin-1 Attenuates Cisplatin-Induced Nephrotoxicity Through Suppression of Apoptosis and Oxidative Stress and Retains Klotho Expression. Front. Pharmacol. 2018, 9, 384. [Google Scholar]
- Wang, J.N.; Liu, M.M.; Wang, F.; Wei, B.; Yang, Q.; Cai, Y.T.; Chen, X.; Liu, X.Q.; Jiang, L.; Li, C.; et al. RIPK1 inhibitor Cpd-71 attenuates renal dysfunction in cisplatin-treated mice via attenuating necroptosis, inflammation and oxidative stress. Clin. Sci. (Lond.) 2019, 133, 1609–1627. [Google Scholar] [CrossRef]
- Salem, N.; Helmi, N.; Assaf, N. Renoprotective effect of platelet-rich plasma on cisplatin-induced nephrotoxicity in rats. Oxid. Med. Cell. Longev. 2018, 2018, 9658230. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
NOX4 1 | Forward: GAACCCAAGTTCCAAGCTCATT Reverse: GGCACAAAGGTCCAGAAATCC | NM_015760 |
Catalase | Forward: CAAGTACAACGCTGAGAAGCCTAAG Reverse: CCCTTCGCAGCCATGTG | NM_009804 |
MnSOD 2 | Forward: AACTCAGGTCGCTCTTCAGC Reverse: CTCCAGCAACTCTCCTTTGG | NM_013671 |
TNF-α 3 | Forward: GACGTGGAACTGGCAGAAGAG Reverse: CCGCCTGGAGTTCTGGAA | NM_013693 |
IL-6 4 | Forward: CCAGAGATACAAAGAAATGATGG Reverse: ACTCCAGAAGACCAGAGGAAAT | NM_031168 |
E-selectin | Forward: AGCTACCCATGGAACACGAC Reverse: ACGCAAGTTCTCCAGCTGTT | NM_011345 |
VCAM-1 5 | Forward: CCCAGGTGGAGGTCTACTCA Reverse: CAGGATTTTGGGAGCTGGTA | NM_011693 |
ICAM-1 6 | Forward: TTCACACTGAATGCCAGCTC Reverse: GTCTGCTGAGACCCCTCTTG | NM_010493 |
GAPDH 7 | Forward: ACTCCACTCACGGCAAATTC Reverse: TCTCCATGGTGGTGAAGACA | NM_001289726 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice. Biomedicines 2020, 8, 572. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines8120572
Kim J-Y, Jo J, Leem J, Park K-K. Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice. Biomedicines. 2020; 8(12):572. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines8120572
Chicago/Turabian StyleKim, Jung-Yeon, Jungmin Jo, Jaechan Leem, and Kwan-Kyu Park. 2020. "Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice" Biomedicines 8, no. 12: 572. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines8120572