Next Article in Journal
Impact of Plasma Xanthine Oxidoreductase Activity on the Mechanisms of Distal Symmetric Polyneuropathy Development in Patients with Type 2 Diabetes
Next Article in Special Issue
Oral Cavity as a Source of Mesenchymal Stem Cells Useful for Regenerative Medicine in Dentistry
Previous Article in Journal
Soluble Guanylate Cyclase Stimulator Vericiguat Enhances Long-Term Memory in Rats without Altering Cerebral Blood Volume
Previous Article in Special Issue
Bidirectional Differentiation of Human-Derived Stem Cells Induced by Biomimetic Calcium Silicate-Reinforced Gelatin Methacrylate Bioink for Odontogenic Regeneration
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 9
Issue 8
10.3390/biomedicines9081049
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Increasing Odontoblast-like Differentiation from Dental Pulp Stem Cells through Increase of β-Catenin/p-GSK-3β Expression by Low-Frequency Electromagnetic Field

by
Han-Moi Lim
,
Myeong-Hyun Nam
,
Yu-Mi Kim
and
Young-Kwon Seo
*
Department of Medical Biotechnology, Dongguk University, Goyang-si 10326, Korea
*
Author to whom correspondence should be addressed.
Biomedicines 2021, 9(8), 1049; https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9081049
Submission received: 7 July 2021 / Revised: 8 August 2021 / Accepted: 17 August 2021 / Published: 19 August 2021
(This article belongs to the Special Issue Tissue Engineering Updates and Perspective in Dentistry)
Browse Figures
Review Reports Versions Notes

Abstract

:
Odontoblasts produce proteins that form the dentinal extracellular matrix, which can protect the dental pulp from external stimuli and is required for tooth regeneration. This study showed that a pulsed electromagnetic field (PEMF) can regulate cell metabolism and induce cell differentiation. This study determined the frequency of PEMF that is effective for odontoblast differentiation. Human dental pulp stem cells (hDPSCs) were cultured in odontoblast differentiation medium containing dexamethasone, BMP2, TGF-β1, and FGF-2, and then exposed to 10 mT intensity of PEMF at 40, 60, 70, and 150 Hz for 15 min/day. The MTT assay, LDH assay, flow cytometry, protein and gene expression, and immunofluorescence were performed to check if hDPSCs differentiated into odontoblast-like cells. The hDPSCs showed frequency-dependent differences in protein and gene expression. The mesenchymal stem cell markers were reduced to a greater extent at 60 and 70 Hz than at other frequencies, and odontoblast-related markers, particularly β-catenin, p-GSK-3β, and p-p38, were increased at 60 and 70 Hz. Exposure to 10 mT intensity of PEMF at 70 Hz influenced the differentiation of hDPSCs considerably. Taken together, PEMF treatment can promote differentiation of hDPSCs into odontoblast-like cells by increasing p-GSK-3β and β-catenin expression.

1. Introduction

Human dental pulp stem cells (hDPSCs) are located in teeth [1,2], where they can differentiate into specific cell types, similar to other mesenchymal stem cells (MSCs) [3,4,5,6]. hDPSCs can also differentiate into cells called odontoblasts that form a single-cell layer along the dental pulp–dentin border [7]. Odontoblasts secrete the extracellular matrix components of dentin which act as barriers to dental pulp protection from external stimuli. These specialized cells produce proteins that form the dental pulp extracellular matrix, which is comprised of dentin matrix acidic phosphoprotein 1 (DMP-1) and dentin sialophosphoprotein (DSPP) [8,9,10,11]. DMP-1 and DSPP are considered typical markers of odontogenesis [12,13] and reportedly play a role in mineralization [14,15]. Additionally, DMP-1 plays a key role in odontogenesis, and its expression is essential for late dentinogenesis development [8].
Substantial research has been conducted on odontoblast differentiation. A comparative study revealed the differentiation of DPSCs, bone marrow-derived mesenchymal stem cells (BM-MSCs), and adipose-derived MSCs into odontoblast-like cells using a differentiation medium [16]. Most researchers performed studies using growth factors and cytokines. Kidwai et al. [17] and Ozeki et al. [18] differentiated embryonic stem cells into odontoblast-like cells using bone morphogenetic protein-4. Jiang et al. induced the differentiation of cranial neural crest cells into odontoblast-like cells by fibroblast growth factor 8 and adult extracellular matrix proteins [17]. In another study, BM-MSCs and amniotic MSCs were differentiated into odontoblast-like cells using a porous scaffold and mechanical stimulation [19]. Those authors applied 19.6 kPa of mechanical compression onto the microporous scaffold for nine hours, which increased the expression of odontoblast-related markers [18]. Likewise, in a study by Liao et al., mechanical tension induced odontogenic-like differentiation of hDPSCs through the STAT3 signaling pathway by downregulating sclerostin expression and accelerated senescence of dental pulp cells [20]. Another study promoted odontogenic-like differentiation of BM-MSCs by co-culturing with oral epithelial cells [21]. The differentiation-induced cells showed increased expression of DMP-1 and DSPP, and when transplanted in a model rat with dentin defect, a dentin-like structure was regenerated [19].
Electromagnetic fields (EMFs) affect cell activity, proliferation, and differentiation by affecting cell membranes or intracellular proteins, such as ion channels [21,22]. The cell differentiation effects of EMFs have been widely reported, including the differentiation of MSCs into nerve-, bone-, and joint-related specialized cells [23,24,25]. Since Basset et al. first introduced EMFs for bone fracture therapy in 1974 [26], other investigators have used EMFs to increase osteogenic activity and differentiation of bone cells [27,28,29].
Martino et al. revealed a dramatic increase in mineral nodule formation and alkaline phosphatase (ALP) activity of SaOS-2 cells exposed to 0.9 mT and 15 Hz of EMF for four hours per day [29]. Jazayeri et al. showed that 15 Hz and 0.2 mT of EMF exposure for six hours per day induced differentiation of rat MSCs to osteoblast-like cells [30]. Another researcher exposed (24 h/day) alveolar bone-derived MSCs to various frequencies (10–100 Hz) of EMF (0.6 mT) and noticed a high increase in the proliferation, mineralization, ALP, vinculin, vimentin, and calmodulin expression at 50 Hz [31]. By contrast, 15 Hz and low intensity (0.1 mT) of EMF exposure for eight hours per day did not affect the extracellular matrix synthesis of mouse osteoblasts, decreased ALP activity and the receptor activator of nuclear factor-kappa B ligand (RANKL) expression, but increased osteoblastic proliferation [32].
Analysis of the related research suggests that the effect of EMF can be regulated by controlling the intensity, frequency, and exposure time, affecting the proliferation and differentiation of various cells. Thus, we hypothesized that odontoblastic differentiation would be affected by exposure to high-intensity (10 mT) short-time (15 min/day) PEMF. We verified the effects of PEMF by analyzing the gene and protein expression levels of hDPSCs exposed to PEMF at different frequencies to find changes indicative of abilities of DPSC to differentiate into odontoblast-like cells.

2. Materials and Methods

2.1. Preparation and Culture of hDPSCs

hDPSCs were purchased from Lonza (PT-5025; Basel, Switzerland). The cells were cultured in a growth medium; a Dulbecco’s modified Eagle’s medium (DMEM) with low glucose (Welgene, Daejeon, Korea) supplemented with 10% D-glucose (Welgene), fetal bovine serum (FBS; BioWhittakerTM, Cambrex Biosciences, Walkerville, MD, USA), and penicillin–streptomycin (Welgene). The final concentration of medium constituents was 0.09% D-glucose, 10% FBS, and 1% penicillin–streptomycin. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO2.

2.2. Odontoblast-Like Differentiation of hDPSCs

To induce odontoblast-like differentiation, hDPSCs were treated with odontoblastic differentiation medium; growth medium with 10 nM dexamethasone, 50 ng/mL BMP2, 20 ng/mL transforming growth factor-β1, and 5 ng/mL fibroblast growth factor-2 (all from Sigma-Aldrich, St. Louis, MO, USA), for 3–10 days with or without PEMF [33]. Control cultures were placed elsewhere to avoid exposure to PEMF and were incubated with the same medium as described for the experimental cultures.

2.3. PEMF

We used Helmholtz coils to generate PEMF (Figure 1). The stimulus form was a pulse, and the stimulation intensity was 10 mT. The PEMF frequencies were 40, 60, 70, and 150 Hz. The PEMF device was placed in an incubator at 37 °C with 5% CO2. The cells were exposed to PEMF for 15 min/day for 3 days.

2.4. Cell Viability

To evaluate cell viability, MTT analysis was performed after 3 days of culturing. Cell activity was assessed using the 3-(3,4-dimethylthiazol-2-yl)-2,5-diphenyltetrazolum bromide assay (MTT assay). Three days after the cells (5 × 104) were seeded in 35-mm dishes, each dish was treated with an MTT solution (5 mg/mL), followed by incubation at 37 °C for 90 min. After incubation, the solution was replaced with dimethyl sulfoxide (Sigma–Aldrich) to dissolve the formazan. The absorbance of the resulting solution was measured at 570 nm.

2.5. Cytotoxicity Assay

Cell cytotoxicity was measured by LDH assay (LDH assay kit, Takara Bio, Inc., Shiga, Japan) in preservation media, according to the manufacturer’s protocol. MTT analysis was performed after 3 days of culturing.

2.6. Cell Surface Antigen Analysis by FACS

To analyze differentiation, hDPSCs were cultured in the same condition as described above (Section 2.2 and Section 2.3) for 10 days. The cell surface markers present on hDPSCs were analyzed by flow cytometry. Briefly, hDPSCs were incubated with MSC-positive antibodies (CD73, CD105, and CD146, BioLegend, San Diego, CA, USA) for confirming differentiation. Cell suspensions in 5% FBS without antibodies served as controls. The cells were washed three times with 5% FBS to remove unbound antibodies and then resuspended with 200 μL of 5% FBS. The cells were sorted using a flow cytometer (CytoFLEX, Beckman Coulter, Brea, CA, USA) and analyzed using CytExpert software (Beckman Coulter).

2.7. Western Blotting

To evaluate protein expression, Western blotting was performed after 3 days of culturing. Whole-cell proteins were extracted as previously described [34]. Protein concentrations were determined by a bicinchoninic acid assay. Herein, 10 μg of protein was separated at 90 V on 10% SDS–PAGE for 120 min. The separated proteins were transferred onto a nitrocellulose membrane at 120 V for 90 min and then incubated with primary antibodies against ALP, Runx2, DMP-1, DSPP, β-catenin, GSK-3β, p-GSK-3β, p38, and p-p38 (all from Abcam). The membranes were incubated with 2 μg of anti-mouse and anti-rabbit secondary antibodies in 5% skimmed milk in TBS buffer for 1 h and applied to an enhanced chemiluminescence (ECL) solution for 1 min. Then, autoradiography was performed using a ChemiDoc XRS+ Imaging System (Bio-Rad, Hercules, CA, USA). β-Actin served as an internal protein control.

2.8. RT-PCR and Real-Time PCR Analysis

To evaluate mRNA expression, RT-PCR analysis was performed after 3 days of culturing. TRIzol (Invitrogen, Waltham, MA, USA) was used to isolate total RNA from the cells. After adding 500 µL of TRIzol reagent to a 60-mm culture dish and collecting it in an e-tube, 200 µL of chloroform was added into the e-tube, and the solution was vortexed and incubated for 5 min. After centrifugation (13,475× g, 4 °C, 15 min), the supernatant was transferred to a new tube, and 500 µL of isopropanol was added. After a 10-min incubation and another centrifugation step (18,340× g, 4 °C, 10 min), the solution was discarded. The pellet was washed with 1 mL of 75% ethanol and centrifuged (7580× g, 4 °C, 5 min). The solution was removed, and the pellet was air-dried. The pellet was dissolved in 20 µL of RNase-free water (Welgene) and incubated on ice for 10 min. Total RNA was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
For the RT-PCR analysis, reverse transcriptase reactions were used to synthesize cDNA from 3 µg of total RNA using an Advantage RT-PCR kit (Clontech Laboratories, Inc., Palo Alto, CA, USA) by following the manufacturer’s protocols (Table 1). Test gene expressions were normalized against β-actin in each sample.
Additionally, for the real-time PCR analysis, reverse transcriptase reactions were used to synthesize cDNA from 2 µg of total RNA using a dyne RT Dry MIX (Dyne Bio, Gyeonggi-do, Korea) by following the manufacturer’s protocols. qPCR was performed using a TB Green® Premix Ex Taq™ (Tli RNaseH Plus) and a StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with 60 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 25 s, and amplification at 72 °C for 30 s. Test gene expressions were normalized against GAPDH in each sample.

2.9. Immunofluorescence

To evaluate antigen expression, immunofluorescence staining was performed after 5 days of culturing. hDPSCs were grown on round, sterilized glass cover slips (12 mm). The cells were characterized for the markers of differentiated hDPSCs (DMP-1 and β-catenin; Abcam). Briefly, the cells were washed with cold Dulbecco’s phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde for 10 min, and washed twice in PBS with 0.1% Triton X-100 (PBS-T) for 5 min. Afterward, the cells were incubated with primary antibodies diluted in 1% bovine serum albumin (primary antibodies; DMP-1 and β-catenin, Abcam) overnight and then with appropriate secondary antibodies for 2 h. After washing twice with PBS-T, the nuclei were stained with DAPI (0.4 µg/mL) at room temperature for 2 min in the dark. The cells were washed twice with PBS-T, mounted on clean slide glasses with Mount Fluor (BioCyc, Potsdam, Germany), and stored at 4 °C. Representative images were captured using a Nikon Eclipse Ti microscope.

2.10. Von Kossa Staining

To evaluate calcium deposition, von Kossa staining was performed after 10 days of culturing. The cells were assessed using a 5% silver nitrate (Sigma-Aldrich) solution under ultraviolet light for 20 min, followed by a 5% sodium thiosulphate (Sigma-Aldrich) solution for 5 min, and then counterstained with a nuclear fast red solution (Sigma-Aldrich) for 10 min. The mineral was stained black.

2.11. Statistical Analysis

Data are expressed as the mean ± SEM of three independent experiments. One-way analysis of variance (ANOVA) followed by Tukey–Kramer multiple comparisons test was performed with GraphPad Prism (La Kolla, CA, USA). Mean differences were considered significant at p < 0.05 (* p < 0.05, ** p < 0.01, and *** p < 0.005). Graphical representations were created using SigmaPlot (Systat Software, Inc., San Jose, CA, USA). All experiments were performed in triplicate.

3. Results

3.1. Non-Cytotoxicity of PEMF Exposure

We exposed hDPSCs to various frequencies (40, 60, 70, and 150 Hz) of PEMF at an intensity of 10 mT and performed lactate dehydrogenase (LDH) and mitochondrial activity (MTT) assays. Figure 2A shows the morphologies of hDPSCs in the control group and the PEMF-exposed groups after three days. All control and PEMF-treated groups, irrespective of the PEMF frequency, did not show apoptosis or necrosis (Figure 2A), and there were no differences in mitochondrial activities between the groups in the MTT assay (Figure 2(Ba)). Furthermore, the absence of significant differences in the amount of LDH released between the groups exposed to PEMF and the controls confirmed that PEMF did not induce cellular stress (Figure 2(Bb)).

3.2. hDPSCs Were Differentiated by Media and PEMF

Cell differentiation was evaluated by fluorescence-activated cell sorter (FACS) analysis of MSC-related cell surface proteins because hDPSCs express cell surface proteins similar to those of MSCs [35,36]. Three known MSC markers, namely CD73, CD105, and CD146, were used in FACS analysis to determine whether PEMF alters hDPSC surface antigen expression (Figure 3). The cell surface proteins were expressed in over 95% of the undifferentiated hDPSCs (data not shown). The results of cultures after five days showed the expression of 61.55 ± 1.57% and 61.29 ± 0.32% CD73, 29.24 ± 6.51% and 29.33 ± 4.34% CD105, and 32.41 ± 2.16% and 30.19 ± 3.24% CD146 at 60 and 70 Hz, respectively, and 77.21 ± 1.47% CD73, 43.46 ± 1.09% CD105, and 40.38 ± 0.53% CD146 expression in the control group (Figure 2A). All surface antigens were decreased in all groups after 10 days, particularly the cells exposed to 60 and 70 Hz PEMF (Figure 3B), which indicates that some frequencies of PEMF may cause changes in hDPSC surface antigen expression. The FACS percentages are shown in Table 2.

3.3. PEMF Exposure-Induced High Expression of Odontoblast-Related Molecules

Markers related to odontoblastic differentiation were generally increased in the cells exposed to PEMF (Figure 4). The frequency of 70 Hz showed a particularly high expression of these markers (1.4-fold in runt-related transcription factor 2 (Runx2), 6.4-fold in DMP-1, and 1.6-fold in DSPP). Similarly, the cells exposed to 60 Hz PEMF showed high expression as well (3.3-fold in ALP, 1.3-fold in Runx2, 4.1-fold in DMP-1, and 1.3-fold in DSPP). Western blotting results showed that gene expressions of DMP-1 and DSPP were generally higher at 60 and 70 Hz than those in the other groups, and the cells exposed to 60 Hz PEMF expressed the highest ALP levels.
As shown in Figure 5A, all odontogenic genes (bone morphogenetic protein (BMP) 2, ALP, Runx2, osteomodulin (OMD), DMP-1, and DSPP) were expressed more in PEMF-exposed cells than in the controls based on reverse transcriptase-polymer chain reaction (RT-PCR) analysis. BMP, OMD, Runx2, and DSPP expression had slight but not statistically significant differences in frequency. However, the frequency of 60 and 70 Hz showed a high expression in ALP and DMP-1 markers compared to those of the other frequency, and the difference was statistically significant.
However, real-time PCR results differ from RT-PCR. For BMP, OMD, ALP, and Runx2 expression, there was a slight increase in the EMP-exposure groups compared to the non-exposure group, but there were no statistical differences. In particular, DSPP showed a slight decrease in expression compared to that in non-exposure group groups but increased expression at 150 Hz (Figure 5B). As a result, no statistical differences were observed in the expression of odontoblast-related mRNA by EMF-exposure.

3.4. DMP-1 and β-Catenin Increased in Nucleus and Cytoplasm of Cells Exposed to PEMF of Certain Frequency

hDPSCs were treated with PEMF at various frequencies, and the expression of DMP-1 and β-catenin was measured via immunofluorescence staining (Figure 6). Beta-catenin was upregulated at 60 and 70 Hz, and DMP-1 also showed increased expression at these frequencies. In particular, the expression of both proteins increased noticeably at 70 Hz in merged images of DMP-1, β-catenin, and 4′,6-diamidino-2-phenylindole (DAPI).

3.5. PEMF Exposure at Certain Frequencies Promotes Odontoblast-Related Proteins through Phosphorylation of Glycogen Synthase Kinase-3 Beta (GSK-3β)/β-Catenin

We aimed to determine whether GSK-3β/β-catenin signaling was involved in the differentiation of hDPSCs and the expression of odontoblast-related proteins caused by PEMF. As seen in Figure 7, PEMF increased the overall phosphorylation of GSK-3β/β-catenin significantly. Furthermore, phosphorylated-GSK-3β (p-GSK-3β (Ser9)) and phosphorylated-p38 (p-p38) levels increased markedly by approximately 1.9- and 1.8-fold after treatment with 70 Hz PEMF, respectively. The expression of β-catenin, a transcription coactivator known to affect odontoblast differentiation in GSK-3β/β-catenin signaling, increased by about 9.5-fold at 60 Hz and 15.0-fold at 70 Hz. These data collectively showed that PEMF induced hDPSC differentiation and increased odontoblast-related protein expression levels via the pathway mediated by GSK-3β/β-catenin signaling.

3.6. Increased Calcium Deposition by PEMF Exposure

The von Kossa staining performed for the evaluation of the calcium deposition of the hDPSC during differentiation (Figure 8). In the growth media culture group, no mineral deposited on the cell surface was observed at all. The EMF-exposed groups exhibited a small amount of matrix mineralization, while the non-exposed (control) group exhibited little matrix mineralization compared with the other groups on Day 10. Not enough mineral deposition was observed due to the short culture period of the cells. However, mineral deposition was formed along the cytoplasm and was observed on the cell surface. At frequency above 60 Hz, the minor deposition difference was not identified.

4. Discussion

EMF is known to be non-invasive and non-toxic and exerts diverse biological effects on the activity, growth, and differentiation of various cell types [37,38,39,40]. The purpose of this study was to identify the effects of various frequencies of PEMF on hDPSCs and also determine the optimal condition that would promote their differentiation into odontoblast-like cells. To our knowledge, this is the first study on the use of PEMF for odontogenesis.
After three days of incubation with PEMF exposure, cell activity remained similar at all frequencies without affecting mitochondrial activities (Figure 2(Ba)). We observed cell morphology and performed the LDH assay to check for cytotoxicity. No morphological changes in the cell membrane and no cytotoxicity, such as vacuole or signs of apoptosis, were observed following PEMF exposure at any frequency (Figure 2(Bb)).
Some investigators have reported that high-frequency magnetic exposure can induce mitochondrial DNA damage, reactive oxygen species, and cell apoptosis. For example, EMF of 8 mT (50 Hz) and long time (eight hours per day for eight weeks) induced an increase in mitochondrial damage and ultra-structure changes [41,42], and EMF of 10 mT (50 Hz) and long time (24 hours per day for three weeks) increased stress and abnormal behavior in rat models [43]. However, another study showed that EMF exposure of 16 mT (15 Hz) and short time (eight hours a day for 24 days) increased osteoblastic differentiation of MSCs [44]. These findings indicate that the effect of EMF on cells or animals can be regulated by the applied frequency, intensity, and exposure time [45]. According to the results of the LDH and MTT assays in the current work, although the intensity (10 mT) was high, the short exposure (15 min/day) time showed that PEMF did not cause cell damage and stress.
hDPSCs are known as adult stem cells. Both their features and the expression of their cell surface proteins are similar to those of MSCs [36]. Based on this, the cells were analyzed using FACS with CD73, CD105, and CD146 as the representative surface markers of MSCs because these markers decrease when MSCs differentiate into specific cell types [46,47,48,49]. On day five of culturing, the cells exposed to 60 and 70 Hz PEMF expressed all three MSC markers at levels about 10% lower relative to those of the control (Figure 3A). On day 10 of culturing, most of these levels had declined to below 10%, indicating the differentiation of hDPSCs (Figure 3B). In particular, the expression levels were lower in the cells exposed to 60 and 70 Hz PEMF than in the control group. Consequently, the expression levels of the cell surface markers decreased regardless of whether the cells were exposed or not exposed to PEMF, and these results indicate cell differentiation.
Figure 4 shows the protein expressions in each experimental group. ALP is a critical marker of osteo/odontoblastic differentiation and associated with mineralization [50,51,52]. Here, ALP showed high expression at 60 Hz. Runx2 was more expressed in the hDPSCs exposed to 60 and 70 Hz PEMF compared with the control group. Furthermore, the increase in the expression of Runx2, which is related to the repair of dental pulp damage, regulated the odontoblastic differentiation of hDPSCs [53,54]. DMP-1 and DSPP play key roles in dentin mineralization and maturation as major markers of odontoblasts and have been previously used to determine odontoblast-like differentiation [12,14,55,56,57]. In our study, DMP-1 was significantly expressed at 70 Hz and was high at other frequencies as well. Similarly, DSPP showed high expression at 60 and 70 Hz. Immunofluorescence showed that the expression of DMP-1 in both cytoplasm and nucleus was high at 70 Hz (Figure 6).
Through RT-PCR, we analyzed the expression of odontoblastic differentiation-related genes (Figure 5). BMP2 is an important regulator of the differentiation process because it promotes odontoblastic differentiation and supports forming mineralized nodules [58,59,60]. BMP2 gene expression was increased in the cells that were exposed to PEMF at 60 Hz. OMD was also expressed in cells exposed to any frequency. Interestingly, Lin et al. demonstrated that knockdown of OMD reduced mineralized nodule formation and inhibited osteo/odontoblastic differentiation [61]. Regarding protein expressions, ALP, Runx2, DMP-1, and DSPP showed increased expression in hDPSCs exposed to PEMF at any frequency. The effect of odontoblast-related protein and gene expression may lead to the differentiation of hDPSCs exposed to PEMF.
Figure 7 shows the significantly increased expression of β-catenin at 70 Hz. It was also verified that the phosphorylation of GSK-3β and p38 associated with the activation of β-catenin increased at 70 Hz (Figure 7). β-Catenin regulates the proliferation and differentiation of various cells, which is exemplified by its roles in osteogenesis and hair growth [62,63]. Han et al. induced tooth regeneration by odontoblastic differentiation in their experiments with rat teeth and cells, and confirmed by immunofluorescence that catenin protein and gene expression increased [53]. It is well-known that active β-catenin is transferred from the cytoplasm to the nucleus and plays a crucial role in dentinogenesis due to the proliferation and odontoblastic differentiation of hDPSCs [64]. Similar to osteogenesis, odontoblast differentiation also occurs through the GSK-3β/β-catenin pathway. In vivo, GSK-3β suppression temporarily increased bone formation, weakened bone degradation, and inhibited osteolysis induced by mechanical instability of the implants [65]. Additionally, the canonical Wnt/β-catenin pathway inhibits GSK-3β activity, which leads to the accumulation of β-catenin in the cytosol and its subsequent translocation to the nucleus [66]. Odontoblastic differentiation was promoted through the WNT, p38 mitogen-activated protein kinase (MAPK), and BMP signaling pathways [67] and suppressed by the repression of p-GSK-3β and β-catenin [68]. Disruption of p38 can affect the integration factors required for various signal inputs. In vivo, p38 deletion inhibits osteoblast terminal differentiation and the appearance of osteocytes, which directly affects bone composition and maintenance [69]. Yun et al. differentiated hDPSCs into odontoblast-like cells using a differentiation medium on a nanofiber scaffold and confirmed to the activity of p38 MAPK signaling by analyzing the protein expression. The results confirmed that p38 MAPK signaling was activated, and p-GSK-3β was increased when hDPSCs were differentiated into odontoblast-like cells [70]. Combining the known information with our findings, we can conclude that PEMF modulates the differentiation of hDPSCs into odontoblasts through the p38 MAPK signaling pathway and the GSK-3β/β-catenin pathway.

5. Conclusions

Based on the results, the characteristics of odontoblasts were well-expressed after exposure to 70 Hz PEMF for 15 min. Consequently, we have demonstrated for the first time that hDPSCs can effectively differentiate into odontoblast-like cells when exposed to PEMF. Short-term PEMF exposure methods have suggested the possibility of incorporating PEMF therapy into future dentin regeneration. In addition, non-invasive and non-toxic PEMF will provide new methods for periodontal therapy.

Author Contributions

Conceptualization, H.-M.L. and Y.-K.S.; formal analysis, H.-M.L., Y.-M.K., and Y.-M.K.; investigation, H.-M.L. and M.-H.N.; writing—original draft, H.-M.L. and Y.-M.K.; writing—review and editing, supervision, Y.-K.S.; project administration, Y.-K.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, grant number 2019R1I1A2A01063305.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data generated and analyzed during this study is available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Grawish, M.E.; Grawish, L.M.; Grawish, H.M.; Grawish, M.M.; El-Negoly, S.A. Challenges of Engineering Biomimetic Dental and Paradental Tissues. Tissue Eng. Regen. Med. 2020, 17, 403–421. [Google Scholar] [CrossRef]
  2. Han, M.-J.; Seo, Y.-K.; Yoon, H.-H.; Song, K.-Y.; Park, J.-K. Upregulation of bone-like extracellular matrix expression in human dental pulp stem cells by mechanical strain. Biotechnol. Bioprocess Eng. 2010, 15, 572–579. [Google Scholar] [CrossRef]
  3. Li, Y.; Nan, X.; Zhong, T.-Y.; Li, T.; Li, A.J.T.E.; Medicine, R. Treatment of Periodontal Bone Defects with Stem Cells from Inflammatory Dental Pulp Tissues in Miniature Swine. Tissue Eng. Regen. Med. 2019, 16, 191–200. [Google Scholar] [CrossRef] [PubMed]
  4. Cao, H.-L.; Chung, J.-H.; Choung, P.-H. Allogeneic Fibrin Clot for odontogenic/Cementogenic Differentiation of Human Dental Mesenchymal Stem Cells. Tissue Eng. Regen. Med. 2020, 17, 511–524. [Google Scholar] [CrossRef] [PubMed]
  5. Cui, X.; Chen, L.; Xue, T.; Yu, J.; Liu, J.; Ji, Y.; Cheng, L. Human umbilical cord and dental pulp-derived mesenchymal stem cells: Biological characteristics and potential roles in vitro and in vivo. Mol. Med. Rep. 2015, 11, 3269–3278. [Google Scholar] [CrossRef]
  6. Hokmabad, V.R.; Davaran, S.; Aghazadeh, M.; Alizadeh, E.; Salehi, R.; Ramazani, A.J. A comparison of the effects of silica and hydroxyapatite nanoparticles on poly (ε-caprolactone)-poly (ethylene glycol)-poly (ε-caprolactone)/chitosan Nanofibrous scaffolds for bone tissue engineering. Tissue Eng. Regen. Med. 2018, 15, 735–750. [Google Scholar] [CrossRef] [PubMed]
  7. Tjäderhane, L.; Haapasalo, M.J.E.T. The dentin–pulp border: A dynamic interface between hard and soft tissues. Endod. Top. 2009, 20, 52–84. [Google Scholar] [CrossRef]
  8. Baldión, P.A.; Velandia-Romero, M.L.; Castellanos, J.E. Odontoblast-like cells differentiated from dental pulp stem cells retain their phenotype after subcultivation. Int. J. Cell Biol. 2018, 2018, 6853189. [Google Scholar] [CrossRef] [Green Version]
  9. Narayanan, K.; Gajjeraman, S.; Ramachandran, A.; Hao, J.; George, A. Dentin matrix protein 1 regulates dentin sialophosphoprotein gene transcription during early odontoblast differentiation. J. Biol. Chem. 2006, 281, 19064–19071. [Google Scholar] [CrossRef] [Green Version]
  10. Kim, S.G.; Zheng, Y.; Zhou, J.; Chen, M.; Embree, M.C.; Song, K.; Jiang, N.; Mao, J.J. Dentin and dental pulp regeneration by the patient’s endogenous cells. Endod. Top. 2013, 28, 106–117. [Google Scholar] [CrossRef]
  11. Angelova, A.V.; Zaugg, L.K.; Neves, V.; Liu, Y.; Sharpe, P.T. Tooth Repair and Regeneration. Curr. Oral Health Rep. 2018, 5, 295–303. [Google Scholar] [CrossRef] [Green Version]
  12. Suzuki, S.; Haruyama, N.; Nishimura, F.; Kulkarni, A.B. Dentin sialophosphoprotein and dentin matrix protein-1: Two highly phosphorylated proteins in mineralized tissues. Arch. Oral Biol. 2012, 57, 1165–1175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Chen, Z.; Li, W.; Wang, H.; Wan, C.; Luo, D.; Deng, S.; Chen, H.; Chen, S. Klf10 regulates odontoblast differentiation and mineralization via promoting expression of dentin matrix protein 1 and dentin sialophosphoprotein genes. Cell Tissue Res. 2016, 363, 385–398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Tian, S.; Wang, J.; Dong, F.; Du, N.; Li, W.; Song, P.; Liu, Y. Concentrated Growth Factor Promotes Dental Pulp Cells Proliferation and Mineralization and Facilitates Recovery of Dental Pulp Tissue. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2019, 25, 10016. [Google Scholar] [CrossRef]
  15. Caiaffa, K.S.; Basso, F.G.; Santos-Filho, N.A.; de Souza-Costa, C.A.; Sakai, V.T.; Cilli, E.M.; Duque, C. Effect of analogues of cationic peptides on dentin mineralization markers in odontoblast-like cells. Arch. Oral Biol. 2019, 103, 19–25. [Google Scholar] [CrossRef]
  16. Murakami, M.; Hayashi, Y.; Iohara, K.; Osako, Y.; Hirose, Y.; Nakashima, M. Trophic effects and regenerative potential of mobilized mesenchymal stem cells from bone marrow and adipose tissue as alternative cell sources for pulp/dentin regeneration. Cell Transplant. 2015, 24, 1753–1765. [Google Scholar] [CrossRef] [PubMed]
  17. Jiang, H.B.; Tian, W.D.; Liu, L.K.; Xu, Y. In vitro odontoblast-like cell differentiation of cranial neural crest cells induced by fibroblast growth factor 8 and dentin non-collagen proteins. Cell Biol. Int. 2008, 32, 671–678. [Google Scholar] [CrossRef]
  18. Miyashita, S.; Ahmed, N.E.M.B.; Murakami, M.; Iohara, K.; Yamamoto, T.; Horibe, H.; Kurita, K.; Takano-Yamamoto, T.; Nakashima, M. Mechanical forces induce odontoblastic differentiation of mesenchymal stem cells on three-dimensional biomimetic scaffolds. J. Tissue Eng. Regen. Med. 2017, 11, 434–446. [Google Scholar] [CrossRef]
  19. Li, Z.-Y.; Chen, L.; Liu, L.; Lin, Y.-F.; Li, S.-W.; Tian, W.-D. Odontogenic potential of bone marrow mesenchymal stem cells. J. Oral Maxillofac. Surg. 2007, 65, 494–500. [Google Scholar] [CrossRef]
  20. Liao, C.; Ou, Y.; Wu, Y.; Zhou, Y.; Liang, S.; Wang, Y. Sclerostin inhibits odontogenic differentiation of human pulp-derived odontoblast-like cells under mechanical stress. J. Cell. Physiol. 2019, 234, 20779–20789. [Google Scholar] [CrossRef]
  21. Kim, Y.-M.; Cho, S.-E.; Kim, S.-C.; Jang, H.-J.; Seo, Y.-K. Effects of extremely low frequency electromagnetic fields on melanogenesis through p-ERK and p-SAPK/JNK pathways in human melanocytes. Int. J. Mol. Sci. 2017, 18, 2120. [Google Scholar] [CrossRef] [Green Version]
  22. D’Angelo, C.; Costantini, E.; Kamal, M.; Reale, M. Experimental model for ELF-EMF exposure: Concern for human health. Saudi J. Biol. Sci. 2015, 22, 75–84. [Google Scholar] [CrossRef] [Green Version]
  23. Hei, W.H.; Kim, S.; Park, J.C.; Seo, Y.K.; Kim, S.M.; Jahng, J.W.; Lee, J.H. Schwann-like cells differentiated from human dental pulp stem cells combined with a pulsed electromagnetic field can improve peripheral nerve regeneration. Bioelectromagnetics 2016, 37, 163–174. [Google Scholar] [CrossRef] [PubMed]
  24. Bao, Z.; Fan, M.; Ma, L.; Duan, Q.; Jiang, W. The effects of pulsed electromagnetic fields combined with a static magnetic intramedullary implant on the repair of bone defects: A preliminary study. Electromagn. Biol. Med. 2019, 38, 210–217. [Google Scholar] [CrossRef]
  25. Parate, D.; Franco-Obregón, A.; Fröhlich, J.; Beyer, C.; Abbas, A.A.; Kamarul, T.; Hui, J.H.; Yang, Z. Enhancement of mesenchymal stem cell chondrogenesis with short-term low intensity pulsed electromagnetic fields. Sci. Rep. 2017, 7, 9421. [Google Scholar] [CrossRef] [PubMed]
  26. Andrew, C.; Bassett, L.; Pawluk, R.J.; Pilla, A.A. Augmentation of bone repair by inductively coupled electromagnetic fields. Science 1974, 184, 575–577. [Google Scholar] [CrossRef] [PubMed]
  27. Martino, C.F.; Belchenko, D.; Ferguson, V.; Nielsen-Preiss, S.; Qi, H.J. The effects of pulsed electromagnetic fields on the cellular activity of SaOS-2 cells. Eur. Bioelectromagn. Assoc. 2008, 29, 125–132. [Google Scholar] [CrossRef] [PubMed]
  28. Tong, J.; Sun, L.; Zhu, B.; Fan, Y.; Ma, X.; Yu, L.; Zhang, J. Pulsed electromagnetic fields promote the proliferation and differentiation of osteoblasts by reinforcing intracellular calcium transients. Bioelectromagnetics 2017, 38, 541–549. [Google Scholar] [CrossRef] [PubMed]
  29. Kim, M.-O.; Jung, H.; Kim, S.-C.; Park, J.-K.; Seo, Y.-K. Electromagnetic fields and nanomagnetic particles increase the osteogenic differentiation of human bone marrow-derived mesenchymal stem cells. Int. J. Mol. Med. 2015, 35, 153–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Jazayeri, M.; Shokrgozar, M.A.; Haghighipour, N.; Bolouri, B.; Mirahmadi, F.; Farokhi, M.J.C.J. Effects of electromagnetic stimulation on gene expression of mesenchymal stem cells and repair of bone lesions. Cell J. 2017, 19, 34. [Google Scholar]
  31. Lim, K.; Hexiu, J.; Kim, J.; Seonwoo, H.; Cho, W.J.; Choung, P.-H.; Chung, J.H.J.B.r.i. Effects of electromagnetic fields on osteogenesis of human alveolar bone-derived mesenchymal stem cells. BioMed Res. Int. 2013, 2013, 296019. [Google Scholar] [CrossRef] [Green Version]
  32. Chang, W.H.S.; Chen, L.T.; Sun, J.S.; Lin, F.H. Effect of pulse-burst electromagnetic field stimulation on osteoblast cell activities. Eur. Bioelectromagn. Assoc. 2004, 25, 457–465. [Google Scholar] [CrossRef]
  33. Hyun, S.-Y.; Lee, J.-H.; Kang, K.-J.; Jang, Y.-J.J.M. Effect of FGF-2, TGF-β-1, and BMPs on teno/ligamentogenesis and osteo/cementogenesis of human periodontal ligament stem cells. Mol. Cells 2017, 40, 550. [Google Scholar] [CrossRef] [Green Version]
  34. Kwon, S.J.; Kim, Y.M.; Jang, H.J.; Seo, Y.K. Synergistic effect of rice bran extract and extremely low-frequency electromagnetic fields on dermal papilla/melanocytes in melanogenesis. Bioelectromagnetics 2018, 39, 595–603. [Google Scholar] [CrossRef]
  35. Song, M.; Lee, J.-H.; Bae, J.; Bu, Y.; Kim, E.-C. Human dental pulp stem cells are more effective than human bone marrow-derived mesenchymal stem cells in cerebral ischemic injury. Cell Transplant. 2017, 26, 1001–1016. [Google Scholar] [CrossRef]
  36. Ledesma-Martínez, E.; Mendoza-Núñez, V.M.; Santiago-Osorio, E. Mesenchymal stem cells derived from dental pulp: A review. Stem Cells Int. 2016, 2016, 4709572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Costantini, E.; Sinjari, B.; D’Angelo, C.; Murmura, G.; Reale, M.; Caputi, S. Human Gingival Fibroblasts Exposed to Extremely Low-Frequency Electromagnetic Fields: In Vitro Model of Wound-Healing Improvement. Int. J. Mol. Sci. 2019, 20, 2108. [Google Scholar] [CrossRef] [Green Version]
  38. Yin, Y.; Chen, P.; Yu, Q.; Peng, Y.; Zhu, Z.; Tian, J. The effects of a pulsed electromagnetic field on the proliferation and osteogenic differentiation of human adipose-derived stem cells. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2018, 24, 3274. [Google Scholar] [CrossRef]
  39. Leone, L.; Podda, M.V.; Grassi, C. Impact of electromagnetic fields on stem cells: Common mechanisms at the crossroad between adult neurogenesis and osteogenesis. Front. Cell. Neurosci. 2015, 9, 228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Ehnert, S.; Schröter, S.; Aspera-Werz, R.H.; Eisler, W.; Falldorf, K.; Ronniger, M.; Nussler, A.K. Translational Insights into Extremely Low Frequency Pulsed Electromagnetic Fields (ELF-PEMFs) for Bone Regeneration after Trauma and Orthopedic Surgery. J. Clin. Med. 2019, 8, 2028. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Santini, S.J.; Cordone, V.; Falone, S.; Mijit, M.; Tatone, C.; Amicarelli, F.; Di Emidio, G.J. Role of mitochondria in the oxidative stress induced by electromagnetic fields: Focus on reproductive systems. Oxidative Med. Cell. Longev. 2018, 2018, 5076271. [Google Scholar] [CrossRef] [Green Version]
  42. Khaki, A.A.; Khaki, A.; Gharachour, L.S.; Khourshidi, F.; Taj, A.N.; Madinei, N. Pre and post natal exposure of 50 Hz electromagnetic fields on prostate glands of rats: An electron microscopy study. Iran. J. Reprod. Med. 2008, 6, 77–82. [Google Scholar]
  43. Korpinar, M.; Kalkan, M.; Tuncel, H.J.B.L.L. The 50 Hz (10 mT) sinusoidal magnetic field: Effects on stress-related behavior of rats. Bratisl. Lek. List. 2012, 113, 521–524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Schwartz, Z.; Simon, B.; Duran, M.; Barabino, G.; Chaudhri, R.; Boyan, B.J. Pulsed electromagnetic fields enhance BMP-2 dependent osteoblastic differentiation of human mesenchymal stem cells. J. Orthop. Res. 2008, 26, 1250–1255. [Google Scholar] [CrossRef]
  45. Ross, C.L.; Siriwardane, M.; Almeida-Porada, G.; Porada, C.D.; Brink, P.; Christ, G.J.; Harrison, B.S. The effect of low-frequency electromagnetic field on human bone marrow stem/progenitor cell differentiation. Stem Cell Res. 2015, 15, 96–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Kang, K.-J.; Ryu, C.-J.; Jang, Y.-J. Identification of dentinogenic cell-specific surface antigens in odontoblast-like cells derived from adult dental pulp. Stem Cell Res. Ther. 2019, 10, 128. [Google Scholar] [CrossRef] [PubMed]
  47. Matsui, M.; Kobayashi, T.; Tsutsui, T.W. CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures. Hum. Cell 2018, 31, 127–138. [Google Scholar] [CrossRef] [Green Version]
  48. Noda, S.; Kawashima, N.; Yamamoto, M.; Hashimoto, K.; Nara, K.; Sekiya, I.; Okiji, T. Effect of cell culture density on dental pulp-derived mesenchymal stem cells with reference to osteogenic differentiation. Sci. Rep. 2019, 9, 5430. [Google Scholar] [CrossRef]
  49. Potdar, P.D.; Jethmalani, Y.D. Human dental pulp stem cells: Applications in future regenerative medicine. World J. Stem Cells 2015, 7, 839. [Google Scholar] [CrossRef]
  50. Semeghini, M.S.; Fernandes, R.R.; Chimello, D.T.; Oliveira, F.S.d.; Bombonato-Prado, K.F. In vitro evaluation of the odontogenic potential of mouse undifferentiated pulp cells. Braz. Dent. J. 2012, 23, 328–336. [Google Scholar] [CrossRef] [Green Version]
  51. Hanawa, M.; Takano, Y.; Wakita, M. An autoradiographic study of calcium movement in the enamel organ of rat molar tooth germs. Arch. Oral Biol. 1990, 35, 899–906. [Google Scholar] [CrossRef]
  52. Yu, D.; Zhao, X.; Cheng, J.Z.; Wang, D.; Zhang, H.H.; Han, G.H. Downregulated microRNA-488 enhances odontoblast differentiation of human dental pulp stem cells via activation of the p38 MAPK signaling pathway. J. Cell. Physiol. 2019, 234, 1442–1451. [Google Scholar] [CrossRef]
  53. Han, N.; Zheng, Y.; Li, R.; Li, X.; Zhou, M.; Niu, Y.; Zhang, Q. β-catenin enhances odontoblastic differentiation of dental pulp cells through activation of Runx2. PLoS ONE 2014, 9, e88890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Cui, D.; Xiao, J.; Zhou, Y.; Zhou, X.; Liu, Y.; Peng, Y.; Yu, Y.; Li, H.; Zhou, X.; Yuan, Q. Epiregulin enhances odontoblastic differentiation of dental pulp stem cells via activating MAPK signalling pathway. Cell Prolif. 2019, 52, e12680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Ajay Sharma, L.; Ali, M.; Love, R.; Wilson, M.; Dias, G. Novel keratin preparation supports growth and differentiation of odontoblast-like cells. Int. Endod. J. 2016, 49, 471–482. [Google Scholar] [CrossRef]
  56. Umemura, N.; Ohkoshi, E.; Tajima, M.; Kikuchi, H.; Katayama, T.; Sakagami, H. Hyaluronan induces odontoblastic differentiation of dental pulp stem cells via CD44. Stem Cell Res. Ther. 2016, 7, 135. [Google Scholar] [CrossRef] [Green Version]
  57. Ahn, J.H.; Kim, I.-R.; Kim, Y.; Kim, D.-H.; Park, S.-B.; Park, B.-S.; Bae, M.-K.; Kim, Y.-I. The Effect of Mesoporous Bioactive Glass Nanoparticles/Graphene Oxide Composites on the Differentiation and Mineralization of Human Dental Pulp Stem Cells. Nanomaterials 2020, 10, 620. [Google Scholar] [CrossRef] [Green Version]
  58. Li, S.; Hu, J.; Zhang, G.; Qi, W.; Zhang, P.; Li, P.; Zeng, Y.; Zhao, W.; Tan, Y. Extracellular Ca2+ promotes odontoblastic differentiation of dental pulp stem cells via BMP2-mediated Smad1/5/8 and Erk1/2 pathways. J. Cell. Physiol. 2015, 230, 2164–2173. [Google Scholar] [CrossRef]
  59. Saito, T.; Ogawa, M.; Hata, Y.; Bessho, K. Acceleration effect of human recombinant bone morphogenetic protein-2 on differentiation of human pulp cells into odontoblasts. J. Endod. 2004, 30, 205–208. [Google Scholar] [CrossRef] [Green Version]
  60. Yang, W.; Harris, M.; Cui, Y.; Mishina, Y.; Harris, S.E.; Gluhak-Heinrich, J. Bmp2 is required for odontoblast differentiation and pulp vasculogenesis. J. Dent. Res. 2012, 91, 58–64. [Google Scholar] [CrossRef]
  61. Lin, W.; Gao, L.; Jiang, W.; Niu, C.; Yuan, K.; Hu, X.; Ma, R.; Huang, Z. The role of osteomodulin on osteo/odontogenic differentiation in human dental pulp stem cells. BMC Oral Health 2019, 19, 22. [Google Scholar] [CrossRef] [Green Version]
  62. Duan, P.; Bonewald, L. The role of the wnt/β-catenin signaling pathway in formation and maintenance of bone and teeth. Int. J. Biochem. Cell Biol. 2016, 77, 23–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Kim, Y.-M.; Kwon, S.-J.; Jang, H.-j.; Seo, Y.-K. Rice bran mineral extract increases the expression of anagen-related molecules in human dermal papilla through wnt/catenin pathway. Food Nutr. Res. 2017, 61, 1412792. [Google Scholar] [CrossRef] [Green Version]
  64. Da Rosa, W.; Piva, E.; da Silva, A. Disclosing the physiology of pulp tissue for vital pulp therapy. Int. Endod. J. 2018, 51, 829–846. [Google Scholar] [CrossRef] [Green Version]
  65. Amirhosseini, M.; Madsen, R.V.; Escott, K.J.; Bostrom, M.P.; Ross, F.P.; Fahlgren, A. GSK-3β inhibition suppresses instability-induced osteolysis by a dual action on osteoblast and osteoclast differentiation. J. Cell. Physiol. 2018, 233, 2398–2408. [Google Scholar] [CrossRef] [PubMed]
  66. Moon, R.T.; Bowerman, B.; Boutros, M.; Perrimon, N. The promise and perils of Wnt signaling through β-catenin. Science 2002, 296, 1644–1646. [Google Scholar] [CrossRef] [PubMed]
  67. Yang, J.; Ye, L.; Hui, T.-Q.; Yang, D.-M.; Huang, D.-M.; Zhou, X.-D.; Mao, J.J.; Wang, C.-L. Bone morphogenetic protein 2-induced human dental pulp cell differentiation involves p38 mitogen-activated protein kinase-activated canonical WNT pathway. Int. J. Oral Sci. 2015, 7, 95–102. [Google Scholar] [CrossRef] [PubMed]
  68. Chen, L.; Song, Z.; Huang, S.; Wang, R.; Qin, W.; Guo, J.; Lin, Z. lncRNA DANCR suppresses odontoblast-like differentiation of human dental pulp cells by inhibiting wnt/β-catenin pathway. Cell Tissue Res. 2016, 364, 309–318. [Google Scholar] [CrossRef]
  69. Rodríguez-Carballo, E.; Gámez, B.; Ventura, F. p38 MAPK signaling in osteoblast differentiation. Front. Cell Dev. Biol. 2016, 4, 40. [Google Scholar] [CrossRef] [Green Version]
  70. Yun, H.-M.; Kang, S.-K.; Singh, R.K.; Lee, J.-H.; Lee, H.-H.; Park, K.-R.; Yi, J.-K.; Lee, D.-W.; Kim, H.-W.; Kim, E.-C. Magnetic nanofiber scaffold-induced stimulation of odontogenesis and pro-angiogenesis of human dental pulp cells through Wnt/MAPK/NF-κB pathways. Dent. Mater. 2016, 32, 1301–1311. [Google Scholar] [CrossRef]
Biomedicines 09 01049 g001 550
Figure 1. Image of the PEMF stimulation device. Helmholtz coils (A), a function generator set to 70 Hz ((B); 40, 60, 70, and 150 Hz), and a power supply (C) were used. Coils were placed in an incubator (37 °C, 5% CO2). PEMF; pulsed electromagnetic field.
Figure 1. Image of the PEMF stimulation device. Helmholtz coils (A), a function generator set to 70 Hz ((B); 40, 60, 70, and 150 Hz), and a power supply (C) were used. Coils were placed in an incubator (37 °C, 5% CO2). PEMF; pulsed electromagnetic field.
Biomedicines 09 01049 g001
Biomedicines 09 01049 g002 550
Figure 2. (A) Morphologies of human dental pulp stem cells (hDPSCs) after PEMF exposure for 3 days (10 mT). All groups were incubated with the same medium—odontoblastic differentiation medium. Each group had different frequency conditions (40, 60, 70, and 150 Hz). Scale bar = 100 μm. (B) Cell viability (a; MTT assay) and stress (b; LDH assay) of hDPSCs at 3 days. * p < 0.05 (compared with the control). PEMF; pulsed electromagnetic field; MTT; 3-(3,4-dimethylthiazol-2-yl)-2,5-diphenyltetrazolum bromide, LDH; lactate dehydrogenase. Cont = control (no PEMF treatment).
Figure 2. (A) Morphologies of human dental pulp stem cells (hDPSCs) after PEMF exposure for 3 days (10 mT). All groups were incubated with the same medium—odontoblastic differentiation medium. Each group had different frequency conditions (40, 60, 70, and 150 Hz). Scale bar = 100 μm. (B) Cell viability (a; MTT assay) and stress (b; LDH assay) of hDPSCs at 3 days. * p < 0.05 (compared with the control). PEMF; pulsed electromagnetic field; MTT; 3-(3,4-dimethylthiazol-2-yl)-2,5-diphenyltetrazolum bromide, LDH; lactate dehydrogenase. Cont = control (no PEMF treatment).
Biomedicines 09 01049 g002
Biomedicines 09 01049 g003 550
Figure 3. Fluorescence-activated cell sorter analysis of the surface markers CD73, CD105, and CD146 after PEMF exposure for 5 days (A) and 10 days (B). hDPSCs were labeled with phosphatidylethanolamine-conjugated antibodies and then analyzed in a flow cytometer. hDPSCs; human dental pulp stem cells. Cont = control (no PEMF treatment). Black line: FITC- or PE-conjugated IgG1, Red line: FITC- or PE-conjugated anti-body.
Figure 3. Fluorescence-activated cell sorter analysis of the surface markers CD73, CD105, and CD146 after PEMF exposure for 5 days (A) and 10 days (B). hDPSCs were labeled with phosphatidylethanolamine-conjugated antibodies and then analyzed in a flow cytometer. hDPSCs; human dental pulp stem cells. Cont = control (no PEMF treatment). Black line: FITC- or PE-conjugated IgG1, Red line: FITC- or PE-conjugated anti-body.
Biomedicines 09 01049 g003
Biomedicines 09 01049 g004 550
Figure 4. (A) Western blot of ALP, Runx2, DMP-1, DSPP, and β-actin after exposure to 10 mT PEMF for 3 days. (B) All markers were increased in the cells exposed to PEMF. Each target protein was normalized to β-actin. Notably, most markers were expressed at 60 and 70 Hz. * p < 0.05, ** p < 0.01, *** p < 0.005 (compared with the control). ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein, ACTB; β-actin, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Figure 4. (A) Western blot of ALP, Runx2, DMP-1, DSPP, and β-actin after exposure to 10 mT PEMF for 3 days. (B) All markers were increased in the cells exposed to PEMF. Each target protein was normalized to β-actin. Notably, most markers were expressed at 60 and 70 Hz. * p < 0.05, ** p < 0.01, *** p < 0.005 (compared with the control). ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein, ACTB; β-actin, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Biomedicines 09 01049 g004
Biomedicines 09 01049 g005 550
Figure 5. (A) RT-PCR analysis of BMP2, ALP, Runx2, OMD, DMP-1, DSPP, and ACTB after PEMF exposure for 3 days. (B) Real time-PCR analysis for odontoblast-related marker. All markers were increased in the cells exposed to PEMF. ** p < 0.01, *** p < 0.005 (compared with the control). BMP2; bone morphogenetic protein 2, OMD; osteomodulin, ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein, ACTB; β-actin, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Figure 5. (A) RT-PCR analysis of BMP2, ALP, Runx2, OMD, DMP-1, DSPP, and ACTB after PEMF exposure for 3 days. (B) Real time-PCR analysis for odontoblast-related marker. All markers were increased in the cells exposed to PEMF. ** p < 0.01, *** p < 0.005 (compared with the control). BMP2; bone morphogenetic protein 2, OMD; osteomodulin, ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein, ACTB; β-actin, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Biomedicines 09 01049 g005
Biomedicines 09 01049 g006 550
Figure 6. Effects of PEMF exposure on hDPSC odontogenesis as determined by immunofluorescence of DMP-1 and β-catenin at 5 days. DMP-1 and β-catenin expressions were visibly increased in PEMF-stimulated cells. PEMF; pulsed electromagnetic field, hDPSC; human dental pulp stem cell, DMP-1; dentin matrix acidic phosphoprotein 1. Cont = control (no PEMF treatment).
Figure 6. Effects of PEMF exposure on hDPSC odontogenesis as determined by immunofluorescence of DMP-1 and β-catenin at 5 days. DMP-1 and β-catenin expressions were visibly increased in PEMF-stimulated cells. PEMF; pulsed electromagnetic field, hDPSC; human dental pulp stem cell, DMP-1; dentin matrix acidic phosphoprotein 1. Cont = control (no PEMF treatment).
Biomedicines 09 01049 g006
Biomedicines 09 01049 g007 550
Figure 7. (A) Western blot of β-catenin, p-GSK3β, and p-p38 after 10 mT PEMF exposure for 3 days. (B) All markers were increased in the cells exposed to PEMF. PEMF-exposed groups had higher expression than the control group. * p < 0.05, ** p < 0.01, *** p < 0.005 (compared with the control). p-GSK3β; phosphorylated-glycogen synthase kinase-3 beta, p-p38; phosphorylated-p38, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Figure 7. (A) Western blot of β-catenin, p-GSK3β, and p-p38 after 10 mT PEMF exposure for 3 days. (B) All markers were increased in the cells exposed to PEMF. PEMF-exposed groups had higher expression than the control group. * p < 0.05, ** p < 0.01, *** p < 0.005 (compared with the control). p-GSK3β; phosphorylated-glycogen synthase kinase-3 beta, p-p38; phosphorylated-p38, PEMF; pulsed electromagnetic field. Cont = control (no PEMF treatment).
Biomedicines 09 01049 g007
Biomedicines 09 01049 g008 550
Figure 8. Effects of PEMF exposure on calcium deposition as determined by von Kossa staining at 10 days. Mineral detections were increased in PEMF-stimulated cells. PEMF; pulsed electromagnetic field, hDPSC; human dental pulp stem cell, Cont = control (no PEMF treatment). Growth = growth media (no PEMF treatment). Original magnification: ×200, bar = 100 μm.
Figure 8. Effects of PEMF exposure on calcium deposition as determined by von Kossa staining at 10 days. Mineral detections were increased in PEMF-stimulated cells. PEMF; pulsed electromagnetic field, hDPSC; human dental pulp stem cell, Cont = control (no PEMF treatment). Growth = growth media (no PEMF treatment). Original magnification: ×200, bar = 100 μm.
Biomedicines 09 01049 g008
Table
Table 1. PCR primer sequences. BMP2; bone morphogenetic protein 2, ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, OMD; osteomodulin, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein.
Table 1. PCR primer sequences. BMP2; bone morphogenetic protein 2, ALP; alkaline phosphatase, Runx2; runt-related transcription factor 2, OMD; osteomodulin, DMP-1; dentin matrix acidic phosphoprotein 1, DSPP; dentin sialophosphoprotein.
GeneForward (5′-3′)Reverse(5′-3′)Temp
(°C)		CyclesBase Pair
(bp)
β-actinGTGATGGTGGGCATGGGTCAGCCGGACTCGTCATACTCCT58.037972
BMP2GTCCAGCTGTAAGAGACACCGTACTAGCGACACCCACAAC58.528316
ALPATCTCGTTGTCTGAGTACCAGTCCTGGAGCTTCAGAAGCTCAACACCA59.032454
Runx2ACAGTAGATGGACCTCGGGAATACTGGGATGAGGAATGCG55.030113
OMDGCTATGGATGGGCTAGTAAACGGGATGTCTTGTAGTTTGTTGTG58.536278
DMP-1GAGTGGCTTCATTGGGCATAGGACTCACTGCTCTCCAAGGG60.037260
DSPPGGAATGGCTCTAAGTGGGCACTCATTGTGACCTGCATCGC60.037284
Table
Table 2. FACS analysis of mesenchymal stem cell markers. FACS data percentage—upper values in each row; 5 days of PEMF exposure, lower values in each row; 10 days of PEMF exposure. Cont = control (no PEMF treatment).
Table 2. FACS analysis of mesenchymal stem cell markers. FACS data percentage—upper values in each row; 5 days of PEMF exposure, lower values in each row; 10 days of PEMF exposure. Cont = control (no PEMF treatment).
Markers%Cont40 Hz60 Hz70 Hz150 Hz
CD735 D77.21 ± 1.4777.50 ± 4.7261.55 ± 1.57 ***61.29 ± 0.32 ***69.25 ± 2.71 *
10 D7.95 ± 0.347.50 ± 2.147.27 ± 3.295.50 ± 1.974.56 ± 2.12
CD1055 D43.46 ± 1.0942.33 ± 2.8729.24 ± 6.51 *29.33 ± 4.34 *36.14 ± 3.76 *
10 D4.19 ± 0.493.66 ± 1.222.82 ± 1.073.38 ± 0.922.23 ± 1.04 *
CD1465 D40.38 ± 0.5341.34 ± 1.2932.41 ± 2.16 **30.19 ± 3.24 **36.59 ± 4.24
10 D5.54 ± 2.313.59 ± 1.251.20 ± 0.46 *0.77 ± 0.13 *0.99 ± 0.40 *
* p < 0.05, ** p < 0.01, *** p < 0.005.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lim, H.-M.; Nam, M.-H.; Kim, Y.-M.; Seo, Y.-K. Increasing Odontoblast-like Differentiation from Dental Pulp Stem Cells through Increase of β-Catenin/p-GSK-3β Expression by Low-Frequency Electromagnetic Field. Biomedicines 2021, 9, 1049. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9081049

AMA Style

Lim H-M, Nam M-H, Kim Y-M, Seo Y-K. Increasing Odontoblast-like Differentiation from Dental Pulp Stem Cells through Increase of β-Catenin/p-GSK-3β Expression by Low-Frequency Electromagnetic Field. Biomedicines. 2021; 9(8):1049. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9081049

Chicago/Turabian Style

Lim, Han-Moi, Myeong-Hyun Nam, Yu-Mi Kim, and Young-Kwon Seo. 2021. "Increasing Odontoblast-like Differentiation from Dental Pulp Stem Cells through Increase of β-Catenin/p-GSK-3β Expression by Low-Frequency Electromagnetic Field" Biomedicines 9, no. 8: 1049. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9081049

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop