Non-Coding RNA-Based Biosensors for Early Detection of Liver Cancer
Abstract
:1. Introduction
2. Liver Cancer-Related Noncoding RNAs
miRNA | Sequence (5′ to 3′) | References |
---|---|---|
miRNA-122 | UGGAGUGUGACAAUGGUGUUUG | [67,68,69,70] |
miRNA-148b | GCCTGAGTGTATAACAGAACTT | [70] |
miRNA-192 | GGCTGTCAATTCATAGGTCAG | [70] |
miRNA-Let7a | UGAGGUAGUAGGUUGUAUAGUU | [71,72] |
miRNA-21 | UAGCUUAUCAGACUGAUGUUGA | [73] |
miRNA-199a | ACAGUAGUCUGCACAUUGGUUA | [74] |
miRNA-223 | UGUCAGUUUGUCAAAUACCCC | [75] |
miRNA-125-b | UCCCUGAGACCCUAACUUGUGA | [76] |
3. Other Biomarkers Related to Liver Cancer
4. Biosensors for Liver Cancer-Related ncRNA Detection
4.1. Electrochemical Biosensors
4.2. Optical Biosensors
4.3. Electromechanical Biosensors
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Mathers, C.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int. J. Cancer 2019, 144, 1941–1953. [Google Scholar] [CrossRef] [Green Version]
- Petrick, J.L.; McGlynn, K.A. The changing epidemiology of primary liver cancer. Curr. Epidemiol. Rep. 2019, 6, 104–111. [Google Scholar] [CrossRef]
- de Martel, C.; Georges, D.; Bray, F.; Ferlay, J.; Clifford, G.M. Global burden of cancer attributable to infections in 2018: A worldwide incidence analysis. Lancet Glob. Health 2020, 8, 180–190. [Google Scholar] [CrossRef] [Green Version]
- Ringelhan, M.; O’Connor, T.; Protzer, U.; Heikenwalder, M. The direct and indirect roles of HBV in liver cancer: Prospective markers for HCC screening and potential therapeutic targets. J. Pathol. 2015, 235, 355–367. [Google Scholar] [CrossRef] [PubMed]
- Pradat, P.; Virlogeux, V.; Trépo, E. Epidemiology and elimination of HCV-related liver disease. Viruses 2018, 10, 545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, P.; Zheng, H.; She, J.; Feng, N.; Zou, H.; Gu, J.; Yuan, Y.; Liu, X.; Liu, Z.; Bian, J. Molecular mechanism of aflatoxin-induced hepatocellular carcinoma derived from a bioinformatics analysis. Toxins 2020, 12, 203. [Google Scholar] [CrossRef] [Green Version]
- Grewal, P.; Viswanathen, V.A. Liver cancer and alcohol. Clin. Liver Dis. 2012, 16, 839–850. [Google Scholar] [CrossRef] [PubMed]
- Marengo, A.; Rosso, C.; Bugianesi, E. Liver cancer: Connections with obesity, fatty liver, and cirrhosis. Annu. Rev. Med. 2016, 67, 103–117. [Google Scholar] [CrossRef]
- Pang, Y.; Kartsonaki, C.; Turnbull, I.; Guo, Y.; Clarke, R.; Chen, Y.; Bragg, F.; Yang, L.; Bian, Z.; Millwood, I.Y.; et al. Diabetes, plasma glucose, and incidence of fatty liver, cirrhosis, and liver cancer: A prospective study of 0.5 million people. Hepatology 2018, 68, 1308–1318. [Google Scholar] [CrossRef]
- Pinter, M.; Trauner, M.; Peck-Radosavljevic, M.; Sieghart, W. Cancer and liver cirrhosis: Implications on prognosis and management. ESMO Open 2016, 1, e000042. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Guo, X.; Wu, L.; Yang, M.; Li, Z.; Gao, Y.; Liu, S.; Zhou, G.; Zhao, J. Lipid rafts promote liver cancer cell proliferation and migration by up-regulation of TLR7 expression. Oncotarget 2016, 7, 63856–63869. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cabibbo, G.; Craxi, A. Epidemiology, risk factors and surveillance of hepatocellular carcinoma. Eur. Rev. Med. Pharmacol. Sci. 2010, 14, 352–355. [Google Scholar]
- Sarveazad, A.; Agah, S.; Babahajian, A.; Amini, N.; Bahardoust, M. Predictors of 5 year survival rate in hepatocellular carcinoma patients. J. Res. Med. Sci. 2019, 24, 86–93. [Google Scholar] [PubMed]
- Lepage, C.; Capocaccia, R.; Hackl, M.; Lemmens, V.; Molina, E.; Pierannunzio, D.; Sant, M.; Trama, A.; Faivre, J. Survival in patients with primary liver cancer, gallbladder and extrahepatic biliary tract cancer and pancreatic cancer in Europe 1999–2007: Results of EUROCARE-5. Eur. J. Cancer 2015, 51, 2169–2178. [Google Scholar] [CrossRef]
- Oliva, M.R.; Saini, S. Liver cancer imaging: Role of CT, MRI, US and PET. Cancer Imaging 2004, 4 Spec No A, 42–48. [Google Scholar] [CrossRef]
- Strassburg, C.P.; Manns, M.P. Approaches to liver biopsy techniques—revisited. Semin. Liver Dis. 2006, 26, 318–327. [Google Scholar] [CrossRef]
- Tanaka, H. Current role of ultrasound in the diagnosis of hepatocellular carcinoma. J. Med. Ultrason. 2020, 47, 239–255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strimbu, K.; Tavel, J.A. What are biomarkers? Curr. Opin. HIV AIDS 2010, 5, 463–466. [Google Scholar] [CrossRef]
- Piñero, F.; Dirchwolf, M.; Pessôa, M.G. Biomarkers in hepatocellular carcinoma: Diagnosis, prognosis and treatment response assessment. Cells 2020, 9, 1370. [Google Scholar] [CrossRef]
- Mansouri, V.; Razzaghi, M.; Nikzamir, A.; Ahmadzadeh, A.; Iranshahi, M.; Haghazali, M.; Hamdieh, M. Assessment of liver cancer biomarkers. Gastroenterol. Hepatol. Bed Bench 2020, 13, 29–39. [Google Scholar]
- Gao, Y.-X.; Yang, T.-W.; Yin, J.-M.; Yang, P.-X.; Kou, B.-X.; Chai, M.-Y.; Liu, X.-N.; Chen, D.-X. Progress and prospects of biomarkers in primary liver cancer (Review). Int. J. Oncol. 2020, 57, 54–66. [Google Scholar] [CrossRef] [PubMed]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E.; et al. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wan, Q.; Dingerdissen, H.; Fan, Y.; Gulzar, N.; Pan, Y.; Wu, T.-J.; Yan, C.; Zhang, H.; Mazumder, R. BioXpress: An integrated RNA-seq-derived gene expression database for pan-cancer analysis. Database (Oxford) 2015, 2015, bav019. [Google Scholar] [CrossRef] [Green Version]
- Available online: https://data.oncomx.org/cancerbiomarkers (accessed on 15 November 2020).
- Kaur, H.; Bhalla, S.; Kaur, D.; Raghava, G.P. CancerLivER: A database of liver cancer gene expression resources and biomarkers. Database (Oxford) 2020, 2020, baaa012. [Google Scholar] [CrossRef]
- Yang, J.D.; Dai, J.; Singal, A.G.; Gopal, P.; Addissie, B.D.; Nguyen, M.H.; Befeler, A.S.; Reddy, K.R.; Schwartz, M.; Harnois, D.M.; et al. Improved performance of serum alpha-fetoprotein for hepatocellular carcinoma diagnosis in HCV cirrhosis with normal alanine transaminase. Cancer Epidemiol. Biomark. Prev. 2017, 26, 1085–1092. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruix, J.; Sherman, M. Management of hepatocellular carcinoma: An update. Hepatology 2011, 53, 1020–1022. [Google Scholar] [CrossRef]
- Saffroy, R.; Pham, P.; Reffas, M.; Takka, M.; Lemoine, A.; Debuire, B. New perspectives and strategy research biomarkers for hepatocellular carcinoma. Clin. Chem. Lab. Med. 2007, 45, 1169–1179. [Google Scholar] [CrossRef]
- Peschansky, V.J.; Wahlestedt, C. Non-coding RNAs as direct and indirect modulators of epigenetic regulation. Epigenetics 2014, 9, 3–12. [Google Scholar] [CrossRef] [Green Version]
- Hauptman, N.; Glavac, D. MicroRNAs and long non-coding RNAs: Prospects in diagnostics and therapy of cancer. Radiol. Oncol. 2013, 47, 311–318. [Google Scholar] [CrossRef] [Green Version]
- Huo, X.; Han, S.; Wu, G.; Latchoumanin, O.; Zhou, G.; Hebbard, L.; George, J.; Qiao, L. Dysregulated long noncoding RNAs (lncRNAs) in hepatocellular carcinoma: Implications for tumorigenesis, disease progression, and liver cancer stem cells. Mol. Cancer 2017, 16, 165–175. [Google Scholar] [CrossRef] [PubMed]
- El-Serag, H.B.; Marrero, J.A.; Rudolph, L.; Reddy, K.R. Diagnosis and treatment of hepatocellular carcinoma. Gastroenterology 2008, 134, 1752–1763. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Yu, F.; Li, P. Circular RNAs: Characteristics, function and clinical significance in hepatocellular carcinoma. Cancers 2018, 10, 258. [Google Scholar] [CrossRef] [Green Version]
- Torres, A.G.; Fabani, M.M.; Vigorito, E.; Gait, M.J. MicroRNA fate upon targeting with anti-miRNA oligonucleotides as revealed by an improved Northern-blot-based method for miRNA detection. RNA 2011, 17, 933–943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, X.; Shen, S.; Yi, S.; Hu, J.; Sun, Y.; Gao, K.; Zhu, L. Screening of differentially expressed miRNAs in tensile strain-treated HepG2 cells by miRNA microarray analysis. Mol. Med. Rep. 2020, 21, 2415–2426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, S.; Kim, W.J.; Kim, B.K.; Kim, J.; Kim, M.J.; Kim, K.P.; Kim, S.K. In-particle stem-loop RT-qPCR for specific and multiplex microRNA profiling. Biosens. Bioelectron. 2020, 163, 112301–112308. [Google Scholar] [CrossRef] [PubMed]
- Rafiee-Pour, H.-A.; Behpour, M.; Keshavarz, M. A novel label-free electrochemical miRNA biosensor using methylene blue as redox indicator: Application to breast cancer biomarker miRNA-21. Biosens. Bioelectron. 2016, 77, 202–207. [Google Scholar] [CrossRef]
- Mujica, M.L.; Gallay, P.A.; Perrachione, F.; Montemerlo, A.E.; Tamborelli, L.A.; Vaschetti, V.M.; Reartes, D.F.; Bollo, S.; Rodríguez, M.C.; Dalmasso, P.R.; et al. New trends in the development of electrochemical biosensors for the quantification of microRNAs. J. Pharm. Biomed. Anal. 2020, 189, 113478–113524. [Google Scholar] [CrossRef] [PubMed]
- Malhotra, B.D.; Kumar, S.; Pandey, C.M. Nanomaterials based biosensors for cancer biomarker detection. J. Phys. Conf. Ser. 2016, 704, 12011–12023. [Google Scholar] [CrossRef] [Green Version]
- Keshavarz, M.; Behpour, M.; Rafiee-Pour, H.-A. Recent trends in electrochemical microRNA biosensors for early detection of cancer. RSC Adv. 2015, 5, 35651–35660. [Google Scholar] [CrossRef]
- Dai, Y.; Han, B.; Dong, L.; Zhao, J.; Cao, Y. Recent advances in nanomaterial-enhanced biosensing methods for hepatocellular carcinoma diagnosis. TrAC Trends Anal. Chem. 2020, 130, 115965–116028. [Google Scholar] [CrossRef]
- Khandelwal, A.; Bacolla, A.; Vasquez, K.M.; Jain, A. Long non-coding RNA: A new paradigm for lung cancer. Mol. Carcinog. 2015, 54, 1235–1251. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Kondo, S.; Matsuzaki, J.; Esaki, M.; Okusaka, T.; Shimada, K.; Murakami, Y.; Enomoto, M.; Tamori, A.; Kato, K.; et al. Highly sensitive circulating microRNA panel for accurate detection of hepatocellular carcinoma in patients with liver disease. Hepatol. Commun. 2020, 4, 284–297. [Google Scholar] [CrossRef] [PubMed]
- Gargalionis, A.N.; Basdra, E.K. Insights in microRNAs biology. Curr. Top. Med. Chem. 2013, 13, 1493–1502. [Google Scholar] [CrossRef] [PubMed]
- Klimenko, O.V. Small non-coding RNAs as regulators of structural evolution and carcinogenesis. Non-coding RNA Res. 2017, 2, 88–92. [Google Scholar] [CrossRef] [PubMed]
- Ma, F.; Jiang, S.; Zhang, C.-Y. SiRNA-directed self-assembled quantum dot biosensor for simultaneous detection of multiple microRNAs at the single-particle level. Biosens. Bioelectron. 2020, 157, 112177–112199. [Google Scholar] [CrossRef] [PubMed]
- Mei, Y.; Clark, D.; Mao, L. Novel dimensions of piRNAs in cancer. Cancer Lett. 2013, 336, 46–52. [Google Scholar] [CrossRef] [Green Version]
- Cordeiro, A.; Navarro, A.; Gaya, A.; Díaz-Beyá, M.; Gonzalez-Farré, B.; Castellano, J.J.; Fuster, D.; Martínez, C.; Martínez, A.; Monzó, M. PiwiRNA-651 as marker of treatment response and survival in classical Hodgkin lymphoma. Oncotarget 2016, 7, 46002–46013. [Google Scholar] [CrossRef] [Green Version]
- Ding, Y.; Sun, Z.; Zhang, S.; Han, X.; Li, Y.; Xu, Q.; Zhou, L.; Xu, H.; Bai, Y.; Xu, C.; et al. Down-regulation of small nuclear RNA (snRNA) RNU5E-1 in hepatocellular carcinoma presents with vital clinical significance. J. Gastrointest. Oncol. 2020, 11, 738–746. [Google Scholar] [CrossRef]
- Mitchell, P.S.; Parkin, R.K.; Kroh, E.M.; Fritz, B.R.; Wyman, S.K.; Pogosova-Agadjanyan, E.L.; Peterson, A.; Noteboom, J.; O’Briant, K.C.; Allen, A.; et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc. Natl. Acad. Sci. USA 2008, 105, 10513–10518. [Google Scholar] [CrossRef] [Green Version]
- Gong, J.; He, X.-X.; Tian, D.-A. Emerging role of microRNA in hepatocellular carcinoma (Review). Oncol. Lett. 2015, 9, 1027–1033. [Google Scholar] [CrossRef] [Green Version]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, Y.; Croce, C.M. The role of MicroRNAs in human cancer. Signal Transduct. Target. Ther. 2016, 1, 15004. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, K.-Q.; Lin, Z.; Chen, X.-J.; Song, M.; Wang, Y.-Q.; Cai, Y.-J.; Yang, N.-B.; Zheng, M.-H.; Dong, J.-Z.; Zhang, L.; et al. Hepatocellular carcinoma associated microRNA expression signature: Integrated bioinformatics analysis, experimental validation and clinical significance. Oncotarget 2015, 6, 25093–25108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zekri, A.-R.N.; Youssef, A.S.E.-D.; El-Desouky, E.D.; Ahmed, O.S.; Lotfy, M.M.; Nassar, A.A.-M.; Bahnassey, A.A. Serum microRNA panels as potential biomarkers for early detection of hepatocellular carcinoma on top of HCV infection. Tumour Biol. 2016, 37, 12273–12286. [Google Scholar] [CrossRef] [PubMed]
- Ulitsky, I.; Bartel, D.P. lincRNAs: Genomics, evolution, and mechanisms. Cell 2013, 154, 26–46. [Google Scholar] [CrossRef] [Green Version]
- Schmitz, S.U.; Grote, P.; Herrmann, B.G. Mechanisms of long noncoding RNA function in development and disease. Cell. Mol. Life Sci. 2016, 73, 2491–2509. [Google Scholar] [CrossRef] [Green Version]
- Yang, Z.; Zhou, L.; Wu, L.-M.; Lai, M.-C.; Xie, H.-Y.; Zhang, F.; Zheng, S.-S. Overexpression of long non-coding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation. Ann. Surg. Oncol. 2011, 18, 1243–1250. [Google Scholar] [CrossRef]
- Kallen, A.N.; Zhou, X.-B.; Xu, J.; Qiao, C.; Ma, J.; Yan, L.; Lu, L.; Liu, C.; Yi, J.-S.; Zhang, H.; et al. The imprinted H19 lncRNA antagonizes let-7 microRNAs. Mol. Cell 2013, 52, 101–112. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Yang, F.; Yuan, J.; Yuan, S.; Zhou, W.; Huo, X.; Xu, D.; Bi, H.; Wang, F.; Sun, S. Epigenetic activation of the MiR-200 family contributes to H19-mediated metastasis suppression in hepatocellular carcinoma. Carcinogenesis 2013, 34, 577–586. [Google Scholar] [CrossRef] [Green Version]
- Li, S.-P.; Xu, H.-X.; Yu, Y.; He, J.-D.; Wang, Z.; Xu, Y.-J.; Wang, C.-Y.; Zhang, H.-M.; Zhang, R.-X.; Zhang, J.-J.; et al. LncRNA HULC enhances epithelial-mesenchymal transition to promote tumorigenesis and metastasis of hepatocellular carcinoma via the miR-200a-3p/ZEB1 signaling pathway. Oncotarget 2016, 7, 42431–42446. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Lu, L.; Feng, B.; Zhang, K.; Han, S.; Hou, D.; Chen, L.; Chu, X.; Wang, R. The lincRNA-ROR/miR-145 axis promotes invasion and metastasis in hepatocellular carcinoma via induction of epithelial-mesenchymal transition by targeting ZEB2. Sci. Rep. 2017, 7, 4637–4651. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Zhang, D.; Wu, W.; Wu, S.; Qian, J.; Hao, Y.; Yan, F.; Zhu, P.; Wu, J.; Huang, G.; et al. Mesenchymal stem cells promote hepatocarcinogenesis via lncRNA-MUF interaction with ANXA2 and miR-34a. Cancer Res. 2017, 77, 6704–6716. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Yao, H.; Wang, K.; Liu, X. Long Non-Coding RNA MALAT1 Regulates ZEB1 expression by sponging miR-143-3p and promotes hepatocellular carcinoma progression. J. Cell. Biochem. 2017, 118, 4836–4843. [Google Scholar] [CrossRef] [PubMed]
- Braconi, C.; Kogure, T.; Valeri, N.; Huang, N.; Nuovo, G.; Costinean, S.; Negrini, M.; Miotto, E.; Croce, C.M.; Patel, T. microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer. Oncogene 2011, 30, 4750–4756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasturi, S.; Eom, Y.; Torati, S.R.; Kim, C. Highly sensitive electrochemical biosensor based on naturally reduced rGO/Au nanocomposite for the detection of miRNA-122 biomarker. J. Ind. Eng. Chem. 2021, 93, 186–195. [Google Scholar] [CrossRef]
- Zou, R.; Zhang, F.; Chen, C.; Cai, C. An ultrasensitive guanine wire-based resonance light scattering method using G-quadruplex self-assembly for determination of microRNA-122. Mikrochim. Acta 2019, 186, 599–606. [Google Scholar] [CrossRef]
- Liu, Y.; Shen, T.; Li, J.; Gong, H.; Chen, C.; Chen, X.; Cai, C. Ratiometric fluorescence sensor for the microRNA determination by catalyzed hairpin assembly. ACS Sens. 2017, 2, 1430–1434. [Google Scholar] [CrossRef]
- Duffy, J.; Padovani, F.; Brunetti, G.; Noy, P.; Certa, U.; Hegner, M. Towards personalised rapid label free miRNA detection for cancer and liver injury diagnostics in cell lysates and blood based samples. Nanoscale 2018, 10, 12797–12804. [Google Scholar] [CrossRef]
- Azab, S.M.; Elhakim, H.K.; Fekry, A.M. The strategy of nanoparticles and the flavone chrysin to quantify miRNA-let 7a in zepto-molar level: Its application as tumor marker. J. Mol. Struct. 2019, 1196, 647–652. [Google Scholar] [CrossRef]
- Aly, D.M.; Gohar, N.A.-H.; Abd El-Hady, A.A.; Khairy, M.; Abdullatif, M.M. Serum microRNA let-7a-1/let-7d/let-7f and miRNA 143/145 Gene expression profiles as potential biomarkers in HCV induced hepatocellular carcinoma. Asian Pac. J. Cancer Prev. 2020, 21, 555–562. [Google Scholar] [CrossRef] [PubMed]
- Mohammadniaei, M.; Go, A.; Chavan, S.G.; Koyappayil, A.; Kim, S.-E.; Yoo, H.J.; Min, J.; Lee, M.-H. Relay-race RNA/barcode gold nanoflower hybrid for wide and sensitive detection of microRNA in total patient serum. Biosens. Bioelectron. 2019, 141, 111468–111476. [Google Scholar] [CrossRef]
- Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. In situ DNA-templated synthesis of silver nanoclusters for ultrasensitive and label-free electrochemical detection of microRNA. ACS Appl. Mater. Interfaces 2015, 7, 1188–1193. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Tian, Y.-F.; Yin, B.-C.; Ye, B.-C. Simultaneous surface-enhanced raman spectroscopy detection of multiplexed microRNA biomarkers. Anal. Chem. 2017, 89, 6120–6128. [Google Scholar] [CrossRef]
- Yu, H.; Han, R.; Su, J.; Chen, H.; Li, D. Multi-marker diagnosis method for early hepatocellular carcinoma based on surface plasmon resonance. Clin. Chim. Acta 2020, 502, 9–14. [Google Scholar] [CrossRef]
- Li, J.; Shang, L.; Jia, L.-P.; Ma, R.-N.; Zhang, W.; Jia, W.-L.; Wang, H.-S.; Xu, K.-H. An ultrasensitive electrochemiluminescence sensor for the detection of HULC based on Au@Ag/GQDs as a signal indicator. J. Electroanal. Chem. 2018, 824, 114–120. [Google Scholar] [CrossRef]
- Soda, N.; Umer, M.; Kasetsirikul, S.; Salomon, C.; Kline, R.; Nguyen, N.-T.; Rehm, B.H.A.; Shiddiky, M.J.A. An amplification-free method for the detection of HOTAIR long non-coding RNA. Anal. Chim. Acta 2020, 1132, 66–73. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.N.; Moriam, S.; Umer, M.; Phan, H.-P.; Salomon, C.; Kline, R.; Nguyen, N.-T.; Shiddiky, M.J.A. Naked-eye and electrochemical detection of isothermally amplified HOTAIR long non-coding RNA. Analyst 2018, 143, 3021–3028. [Google Scholar] [CrossRef] [PubMed]
- Tzartzeva, K.; Singal, A.G. Testing for AFP in combination with ultrasound improves early liver cancer detection. Expert Rev. Gastroenterol. Hepatol. 2018, 12, 947–949. [Google Scholar] [CrossRef] [Green Version]
- Tsai, S.L.; Huang, G.T.; Yang, P.M.; Sheu, J.C.; Sung, J.L.; Chen, D.S. Plasma des-gamma-carboxyprothrombin in the early stage of hepatocellular carcinoma. Hepatology 1990, 11, 481–488. [Google Scholar] [CrossRef]
- Ge, T.; Shen, Q.; Wang, N.; Zhang, Y.; Ge, Z.; Chu, W.; Lv, X.; Zhao, F.; Zhao, W.; Fan, J.; et al. Diagnostic values of alpha-fetoprotein, dickkopf-1, and osteopontin for hepatocellular carcinoma. Med. Oncol. 2015, 32, 59–69. [Google Scholar] [CrossRef]
- Koide, N.; Hada, H.; Shinji, T.; Ujike, K.; Hirasaki, S.; Yumoto, Y.; Hanafusa, T.; Kadomatsu, K.; Muramatsu, H.; Muramatsu, T.; et al. Expression of the midkine gene in human hepatocellular carcinomas. Hepatogastroenterology 1999, 46, 3189–3196. [Google Scholar] [PubMed]
- Shen, Q.; Fan, J.; Yang, X.-R.; Tan, Y.; Zhao, W.; Xu, Y.; Wang, N.; Niu, Y.; Wu, Z.; Zhou, J.; et al. Serum DKK1 as a protein biomarker for the diagnosis of hepatocellular carcinoma: A large-scale, multicentre study. Lancet Oncol. 2012, 13, 817–826. [Google Scholar] [CrossRef]
- Jia, X.; Liu, J.; Gao, Y.; Huang, Y.; Du, Z. Diagnosis accuracy of serum glypican-3 in patients with hepatocellular carcinoma: A systematic review with meta-analysis. Arch. Med. Res. 2014, 45, 580–588. [Google Scholar] [CrossRef]
- Xing, H.; Qiu, H.; Ding, X.; Han, J.; Li, Z.; Wu, H.; Yan, C.; Li, H.; Han, R.; Zhang, H.; et al. Clinical performance of α-L-fucosidase for early detection of hepatocellular carcinoma. Biomarks Med. 2019, 13, 545–555. [Google Scholar] [CrossRef]
- Marrero, J.A.; Romano, P.R.; Nikolaeva, O.; Steel, L.; Mehta, A.; Fimmel, C.J.; Comunale, M.A.; D’Amelio, A.; Lok, A.S.; Block, T.M. GP73, a resident Golgi glycoprotein, is a novel serum marker for hepatocellular carcinoma. J. Hepatol. 2005, 43, 1007–1012. [Google Scholar] [CrossRef] [PubMed]
- Carr, B.I.; Kanke, F.; Wise, M.; Satomura, S. Clinical evaluation of lens culinaris agglutinin-reactive α-fetoprotein and Des-γ-Carboxy prothrombin in histologically proven hepatocellular carcinoma in the united states. Dig. Dis. Sci. 2007, 52, 776–782. [Google Scholar] [CrossRef] [PubMed]
- Capurro, M.; Wanless, I.R.; Sherman, M.; Deboer, G.; Shi, W.; Miyoshi, E.; Filmus, J. Glypican-3: A novel serum and histochemical marker for hepatocellular carcinoma. Gastroenterology 2003, 125, 89–97. [Google Scholar] [CrossRef]
- Kakar, S.; Muir, T.; Murphy, L.M.; Lloyd, R.V.; Burgart, L.J. Immunoreactivity of Hep Par 1 in hepatic and extrahepatic tumors and its correlation with albumin in situ hybridization in hepatocellular carcinoma. Am. J. Clin. Pathol. 2003, 119, 361–366. [Google Scholar] [CrossRef]
- Wang, C.; Zhang, Y.; Guo, K.; Wang, N.; Jin, H.; Liu, Y.; Qin, W. Heat shock proteins in hepatocellular carcinoma: Molecular mechanism and therapeutic potential. Int. J. Cancer 2016, 138, 1824–1834. [Google Scholar] [CrossRef]
- Cheng, L.; Zhang, Z.; Zuo, D.; Zhu, W.; Zhang, J.; Zeng, Q.; Yang, D.; Li, M.; Zhao, Y. Ultrasensitive detection of serum microRNA using bbranched DNA-Based SERS platform combining simultaneous detection of α-fetoprotein for early diagnosis of liver cancer. ACS Appl. Mater. Interfaces 2018, 10, 34869–34877. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.-F.; Cheng, L.-X.; Li, M.; Zuo, D.; Zhang, N.; Zhuang, H.-J.; Xie, D.; Zeng, Q.-D.; Hutchison, J.A.; Zhao, Y.-L. Frequency shift raman-based sensing of serum microRNAs for early diagnosis and discrimination of primary liver cancers. Anal. Chem. 2018, 90, 10144–10151. [Google Scholar] [CrossRef]
- Ye, D.; Zuo, X.; Fan, C. DNA Nanotechnology-enabled interfacial engineering for biosensor development. Annu. Rev. Anal. Chem. 2018, 11, 171–195. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.; Lu, Y.-C.; Lai, J.J. Recent advances in biosensors for nucleic acid and exosome detection. Chonnam Med. J. 2019, 55, 86–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El Aamri, M.; Yammouri, G.; Mohammadi, H.; Amine, A.; Korri-Youssoufi, H. Electrochemical biosensors for detection of microRNA as a cancer biomarker: Pros and cons. Biosensors 2020, 10, 186. [Google Scholar] [CrossRef] [PubMed]
- Mohammadi, H.; Yammouri, G.; Amine, A. Current advances in electrochemical genosensors for detecting microRNA cancer markers. Curr. Opin. Electrochem. 2019, 16, 96–105. [Google Scholar] [CrossRef]
- Rafique, B.; Iqbal, M.; Mehmood, T.; Shaheen, M.A. Electrochemical DNA biosensors: A review. Sens. Rev. 2019, 39, 34–50. [Google Scholar] [CrossRef]
- Sadighbayan, D.; Sadighbayan, K.; Khosroushahi, A.Y.; Hasanzadeh, M. Recent advances on the DNA-based electrochemical biosensing of cancer biomarkers: Analytical approach. TrAC Trends Anal. Chem. 2019, 119, 115609–115638. [Google Scholar] [CrossRef]
- Mao, X.; Ma, Y.; Zhang, A.; Zhang, L.; Zeng, L.; Liu, G. Disposable nucleic acid biosensors based on gold nanoparticle probes and lateral flow strip. Anal. Chem. 2009, 81, 1660–1668. [Google Scholar] [CrossRef]
- Johnson, B.N.; Mutharasan, R. Biosensor-based microRNA detection: Techniques, design, performance, and challenges. Analyst 2014, 139, 1576–1588. [Google Scholar] [CrossRef]
- Zeng, D.; Wang, Z.; Meng, Z.; Wang, P.; San, L.; Wang, W.; Aldalbahi, A.; Li, L.; Shen, J.; Mi, X. DNA Tetrahedral nanostructure-based electrochemical miRNA biosensor for simultaneous detection of multiple miRNAs in pancreatic carcinoma. ACS Appl. Mater. Interfaces 2017, 9, 24118–24125. [Google Scholar] [CrossRef]
- Jampasa, S.; Siangproh, W.; Laocharoensuk, R.; Yanatatsaneejit, P.; Vilaivan, T.; Chailapakul, O. A new DNA sensor design for the simultaneous detection of HPV type 16 and 18 DNA. Sens. Actuators B Chem. 2018, 265, 514–521. [Google Scholar] [CrossRef]
- Mao, D.; Chen, H.; Tang, Y.; Li, J.; Cao, Y.; Zhao, J. Application of isothermal nucleic acid signal amplification in the detection of hepatocellular carcinoma-associated microRNA. Chempluschem 2019, 84, 8–17. [Google Scholar] [CrossRef] [PubMed]
- Bartosik, M.; Jirakova, L. Electrochemical analysis of nucleic acids as potential cancer biomarkers. Curr. Opin. Electrochem. 2019, 14, 96–103. [Google Scholar] [CrossRef]
- Rashid, J.I.A.; Yusof, N.A. The strategies of DNA immobilization and hybridization detection mechanism in the construction of electrochemical DNA sensor: A review. Sens. Bio-Sens. Res. 2017, 16, 19–31. [Google Scholar] [CrossRef]
- Zhang, S.; Zhuang, X.; Chen, D.; Luan, F.; He, T.; Tian, C.; Chen, L. Simultaneous voltammetric determination of guanine and adenine using MnO2 nanosheets and ionic liquid-functionalized graphene combined with a permeation-selective polydopamine membrane. Mikrochim. Acta 2019, 186, 450–460. [Google Scholar] [CrossRef]
- Wang, D.; Huang, B.; Liu, J.; Guo, X.; Abudukeyoumu, G.; Zhang, Y.; Ye, B.-C.; Li, Y. A novel electrochemical sensor based on Cu@Ni/MWCNTs nanocomposite for simultaneous determination of guanine and adenine. Biosens. Bioelectron. 2018, 102, 389–395. [Google Scholar] [CrossRef]
- Huang, K.-J.; Niu, D.-J.; Sun, J.-Y.; Han, C.-H.; Wu, Z.-W.; Li, Y.-L.; Xiong, X.-Q. Novel electrochemical sensor based on functionalized graphene for simultaneous determination of adenine and guanine in DNA. Colloids Surf. B Biointerfaces 2011, 82, 543–549. [Google Scholar] [CrossRef] [PubMed]
- Vishnu, N.; Badhulika, S. Single step grown MoS2 on pencil graphite as an electrochemical sensor for guanine and adenine: A novel and low cost electrode for DNA studies. Biosens. Bioelectron. 2019, 124-125, 122–128. [Google Scholar] [CrossRef] [PubMed]
- Hai, X.; Li, Y.; Zhu, C.; Song, W.; Cao, J.; Bi, S. DNA-based label-free electrochemical biosensors: From principles to applications. TrAC Trends Anal. Chem. 2020, 133, 116098116155. [Google Scholar] [CrossRef]
- Dong, H.; Zhu, Z.; Ju, H.; Yan, F. Triplex signal amplification for electrochemical DNA biosensing by coupling probe-gold nanoparticles-graphene modified electrode with enzyme functionalized carbon sphere as tracer. Biosens. Bioelectron. 2012, 33, 228–232. [Google Scholar] [CrossRef]
- Lee, A.-C.; Du, D.; Chen, B.; Heng, C.-K.; Lim, T.-M.; Lin, Y. Electrochemical detection of leukemia oncogenes using enzyme-loaded carbon nanotube labels. Analyst 2014, 139, 4223–4230. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Xiong, E.; Zhang, X.; Zhang, X.; Chen, J. Nanomaterials as signal amplification elements in DNA-based electrochemical sensing. Nano Today 2014, 9, 197–211. [Google Scholar] [CrossRef]
- Merkoçi, A.; Aldavert, M. New materials for electrochemical sensing V: Nanoparticles for DNA labeling. TrAC Trends Anal. Chem. 2005, 24, 341–349. [Google Scholar] [CrossRef]
- Daneshpour, M.; Moradi, L.S.; Izadi, P.; Omidfar, K. Femtomolar level detection of RASSF1A tumor suppressor gene methylation by electrochemical nano-genosensor based on Fe3O4/TMC/Au nanocomposite and PT-modified electrode. Biosens. Bioelectron. 2016, 77, 1095–1103. [Google Scholar] [CrossRef]
- Miao, X.; Wang, W.; Kang, T.; Liu, J.; Shiu, K.-K.; Leung, C.-H.; Ma, D.-L. Ultrasensitive electrochemical detection of miRNA-21 by using an iridium(III) complex as catalyst. Biosens. Bioelectron. 2016, 86, 454–458. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Zhang, X.; Chang, Y.; Xu, S.; Yuan, R.; Chai, Y. Co-catalytic Fc/HGQs/Fe3O4 nanocomposite mediated enzyme-free electrochemical biosensor for ultrasensitive detection of MicroRNA. Chem. Commun. (Camb.) 2021, 57, 5179–5182. [Google Scholar] [CrossRef]
- He, P.; Dai, L. Aligned carbon nanotube-DNA electrochemical sensors. Chem. Commun. (Camb.) 2004, 3, 348–349. [Google Scholar] [CrossRef] [PubMed]
- Akhavan, O.; Ghaderi, E.; Rahighi, R. Toward single-DNA electrochemical biosensing by graphene nanowalls. ACS Nano 2012, 6, 2904–2916. [Google Scholar] [CrossRef]
- Hansen, J.A.; Mukhopadhyay, R.; Hansen, J.Ø.; Gothelf, K.V. Femtomolar electrochemical detection of DNA targets using metal sulfide nanoparticles. J. Am. Chem. Soc. 2006, 128, 3860–3861. [Google Scholar] [CrossRef]
- Gong, Q.; Han, H.; Yang, H.; Zhang, M.; Sun, X.; Liang, Y.; Liu, Z.; Zhang, W.; Qiao, J. Sensitive electrochemical DNA sensor for the detection of HIV based on a polyaniline/graphene nanocomposite. J. Mater. 2019, 5, 313–319. [Google Scholar] [CrossRef]
- Shabaninejad, Z.; Yousefi, F.; Movahedpour, A.; Ghasemi, Y.; Dokanehiifard, S.; Rezaei, S.; Aryan, R.; Savardashtaki, A.; Mirzaei, H. Electrochemical-based biosensors for microRNA detection: Nanotechnology comes into view. Anal. Biochem. 2019, 581, 113349–113362. [Google Scholar] [CrossRef]
- Lusi, E.A.; Passamano, M.; Guarascio, P.; Scarpa, A.; Schiavo, L. Innovative electrochemical approach for an early detection of microRNAs. Anal. Chem. 2009, 81, 2819–2822. [Google Scholar] [CrossRef] [PubMed]
- Kilic, T.; Kaplan, M.; Demiroglu, S.; Erdem, A.; Ozsoz, M. Label-Free Electrochemical detection of microRNA-122 in real samples by graphene modified disposable electrodes. J. Electrochem. Soc. 2016, 163, 227–233. [Google Scholar] [CrossRef]
- Nag, A.; Mitra, A.; Mukhopadhyay, S.C. Graphene and its sensor-based applications: A review. Sens. Actuators A Phys. 2018, 270, 177–194. [Google Scholar] [CrossRef]
- Fang, Y.; Xu, Y.; He, P. DNA Biosensors based on metal nanoparticles. J. Biomed. Nanotechnol. 2005, 1, 276–285. [Google Scholar] [CrossRef]
- Wang, F.; Chu, Y.; Ai, Y.; Chen, L.; Gao, F. Graphene oxide with in-situ grown Prussian Blue as an electrochemical probe for microRNA-122. Mikrochim. Acta 2019, 186, 116–125. [Google Scholar] [CrossRef]
- Liu, F.; Xiang, G.; Jiang, D.; Zhang, L.; Chen, X.; Liu, L.; Luo, F.; Li, Y.; Liu, C.; Pu, X. Ultrasensitive strategy based on PtPd nanodendrite/nano-flower-like@GO signal amplification for the detection of long non-coding RNA. Biosens. Bioelectron. 2015, 74, 214–221. [Google Scholar] [CrossRef]
- Elhakim, H.K.A.; Azab, S.M.; Fekry, A.M. A novel simple biosensor containing silver nanoparticles/propolis (bee glue) for microRNA let-7a determination. Mater. Sci. Eng. C Mater. Biol. Appl. 2018, 92, 489–495. [Google Scholar] [CrossRef]
- Zhang, H.; Wang, Q.; Yang, X.; Wang, K.; Li, Q.; Li, Z.; Gao, L.; Nie, W.; Zheng, Y. An isothermal electrochemical biosensor for the sensitive detection of microRNA based on a catalytic hairpin assembly and supersandwich amplification. Analyst 2017, 142, 389–396. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Zhang, L.; Wang, L. DNA-Functionalized Plasmonic Nanomaterials for Optical Biosensing. Biotechnol. J. 2020, 15, 1800741–1800750. [Google Scholar] [CrossRef]
- Nazmul Islam, M.; Yadav, S.; Hakimul Haque, M.; Munaz, A.; Islam, F.; Al Hossain, M.S.; Gopalan, V.; Lam, A.K.; Nguyen, N.-T.; Shiddiky, M.J.A. Optical biosensing strategies for DNA methylation analysis. Biosens. Bioelectron. 2017, 92, 668–678. [Google Scholar] [CrossRef]
- Peng, H.-I.; Miller, B.L. Recent advancements in optical DNA biosensors: Exploiting the plasmonic effects of metal nanoparticles. Analyst 2011, 136, 436–447. [Google Scholar] [CrossRef] [PubMed]
- Huertas, C.S.; Calvo-Lozano, O.; Mitchell, A.; Lechuga, L.M. Advanced evanescent-wave optical biosensors for the detection of nucleic acids: An analytic perspective. Front. Chem. 2019, 7, 724–749. [Google Scholar] [CrossRef] [Green Version]
- Tort, N.; Salvador, J.-P.; Marco, M.-P. Multimodal plasmonic biosensing nanostructures prepared by DNA-directed immobilization of multifunctional DNA-gold nanoparticles. Biosens. Bioelectron. 2017, 90, 13–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, R.-D.; Yin, B.-C.; Ye, B.-C. Ultrasensitive, colorimetric detection of microRNAs based on isothermal exponential amplification reaction-assisted gold nanoparticle amplification. Biosens. Bioelectron. 2016, 86, 1011–1016. [Google Scholar] [CrossRef]
- Si, Y.; Xu, L.; Wang, N.; Zheng, J.; Yang, R.; Li, J. Target microRNA-responsive DNA hydrogel-based surface-enhanced raman scattering sensor arrays for microRNA-marked cancer screening. Anal. Chem. 2020, 92, 2649–2655. [Google Scholar] [CrossRef] [PubMed]
- Aoki, H.; Corn, R.M.; Matthews, B. MicroRNA detection on microsensor arrays by SPR imaging measurements with enzymatic signal enhancement. Biosens. Bioelectron. 2019, 142, 111565–111572. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Lu, P.; Yan, J.; Zhang, Y.; Huang, L.; Ali, Z.; Li, Z.; He, N. Rapid and sensitive detection of RNA viruses based on reverse transcription loop-mediated isothermal amplification, magnetic nanoparticles, and chemiluminescence. J. Biomed. Nanotechnol. 2016, 12, 710–716. [Google Scholar] [CrossRef] [PubMed]
- Mauriz, E. Clinical Applications of Visual Plasmonic Colorimetric Sensing. Sensors 2020, 20, 6214. [Google Scholar] [CrossRef]
- Carrascosa, L.G.; Huertas, C.S.; Lechuga, L.M. Prospects of optical biosensors for emerging label-free RNA analysis. TrAC Trends Anal. Chem. 2016, 80, 177–189. [Google Scholar] [CrossRef] [Green Version]
- Piao, J.; Zhao, Q.; Zhou, D.; Peng, W.; Gao, W.; Chen, M.; Shu, G.; Gong, X.; Chang, J. Enzyme-free colorimetric detection of MicroRNA-21 using metal chelator as label for signal generation and amplification. Anal. Chim. Acta 2019, 1052, 145–152. [Google Scholar] [CrossRef]
- Wang, Q.; Li, R.-D.; Yin, B.-C.; Ye, B.-C. Colorimetric detection of sequence-specific microRNA based on duplex-specific nuclease-assisted nanoparticle amplification. Analyst 2015, 140, 6306–6312. [Google Scholar] [CrossRef]
- Xue, N.; Wu, S.; Li, Z.; Miao, X. Ultrasensitive and label-free detection of ATP by using gold nanorods coupled with enzyme assisted target recycling amplification. Anal. Chim. Acta 2020, 1104, 117–124. [Google Scholar] [CrossRef] [PubMed]
- Srinivas, A.R.G.; Peng, H.; Barker, D.; Travas-Sejdic, J. Switch on or switch off: An optical DNA sensor based on poly(p-phenylenevinylene) grafted magnetic beads. Biosens. Bioelectron. 2012, 35, 498–502. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.-S.; Li, B.-C.; Zhou, Y.-L.; Wang, H.-Y.; Wang, M.-H.; Ai, S.-Y. Signal-on fluorescence biosensor for microRNA-21 detection based on DNA strand displacement reaction and Mg2+-dependent DNAzyme cleavage. Biosens. Bioelectron. 2017, 96, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Sípová, H.; Zhang, S.; Dudley, A.M.; Galas, D.; Wang, K.; Homola, J. Surface plasmon resonance biosensor for rapid label-free detection of microribonucleic acid at subfemtomole level. Anal. Chem. 2010, 82, 10110–10115. [Google Scholar] [CrossRef] [Green Version]
- Xu, Z.; Yu, J. A novel solid-state electrochemiluminescence sensor based on Ru(bpy)32+ immobilization on TiO2 nanotube arrays and its application for detection of amines in water. Nanotechnology 2010, 21, 245501–245508. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Xie, Y.; Fang, J.; Ling, Y.; Yu, C.; Liu, X.; Dai, Y.; Qin, Y.; Zhou, D. CdS quantum dots confined in mesoporous TiO2 with exceptional photocatalytic performance for degradation of organic polutants. Chemosphere 2017, 178, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.-P.; Zhou, Y.; Wang, J.; Zhu, J.-J. Electrogenerated chemiluminescence resonance energy transfer between Ru(bpy)32+ electrogenerated chemiluminescence and gold nanoparticles/graphene oxide nanocomposites with graphene oxide as coreactant and its sensing application. Anal. Chem. 2016, 88, 5469–5475. [Google Scholar] [CrossRef]
- Hao, N.; Zhang, X.; Zhou, Z.; Hua, R.; Zhang, Y.; Liu, Q.; Qian, J.; Li, H.; Wang, K. AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensors. Biosens. Bioelectron. 2017, 97, 377–383. [Google Scholar] [CrossRef]
- Li, Y.; Hu, Y.; Zhao, Y.; Shi, G.; Deng, L.; Hou, Y.; Qu, L. An electrochemical avenue to green-luminescent graphene quantum dots as potential electron-acceptors for photovoltaics. Adv. Mater. 2011, 23, 776–780. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Liu, W.; Ma, C.; Zhang, Y.; Wang, X.; Yu, J.; Song, X. Gold–silver nanocomposite-functionalized graphene based electrochemiluminescence immunosensor using graphene quantum dots coated porous PtPd nanochains as labels. Electrochim. Acta 2014, 123, 470–476. [Google Scholar] [CrossRef]
- Johnson, B.N.; Mutharasan, R. Sample preparation-free, real-time detection of microRNA in human serum using piezoelectric cantilever biosensors at attomole level. Anal. Chem. 2012, 84, 10426–10436. [Google Scholar] [CrossRef]
- Husale, S.; Persson, H.H.J.; Sahin, O. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets. Nature 2009, 462, 1075–1078. [Google Scholar] [CrossRef] [Green Version]
- Noy, P.; Steiner, R.; Voelkle, J.; Hegner, M.; Fattinger, C. Instrument for label-free detection of noncoding RNAs. J. Sens. 2012, 2012, 1–5. [Google Scholar] [CrossRef]
- Basu, A.K.; Basu, A.; Bhattacharya, S. Micro/Nano fabricated cantilever based biosensor platform: A review and recent progress. Enzym. Microb. Technol. 2020, 139, 109558–109573. [Google Scholar] [CrossRef]
- Kuang, Y.; Salem, N.; Wang, F.; Schomisch, S.J.; Chandramouli, V.; Lee, Z. A colorimetric assay method to measure acetyl-CoA synthetase activity: Application to woodchuck model of hepatitis virus-induced hepatocellular carcinoma. J. Biochem. Biophys. Methods 2007, 70, 649–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ward, M.D.; Buttry, D.A. In situ interfacial mass detection with piezoelectric transducers. Science 1990, 249, 1000–1007. [Google Scholar] [CrossRef]
- Länge, K.; Rapp, B.E.; Rapp, M. Surface acoustic wave biosensors: A review. Anal. Bioanal. Chem. 2008, 391, 1509–1519. [Google Scholar] [CrossRef] [PubMed]
- Mujahid, A.; Dickert, F.L. Surface Acoustic Wave (SAW) for Chemical sensing applications of recognition layers. Sensors 2017, 17, 2716. [Google Scholar] [CrossRef] [Green Version]
- Lim, J.Y.; Lee, S.S. Sensitive detection of microRNA using QCM biosensors: Sandwich hybridization and signal amplification by TiO2 nanoparticles. Anal. Methods 2020, 12, 5103–5109. [Google Scholar] [CrossRef]
- Li, X.; Ma, D.; Zheng, S.-R.; Fan, J.; Wang, T.; Dai, Z.; Zou, X.-Y.; Teng, S.-H.; Zhang, W.-G. Assembly of a miRNA-modified QCM sensor for miRNA recognition through response patterns. J. Mol. Recognit. 2019, 32, 2772–2776. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Lee, S.S. QCM sensing of miR-21 by formation of microRNA-DNA hybrid duplexes and intercalation on surface-functionalized pyrene. Analyst 2019, 144, 6936–6943. [Google Scholar] [CrossRef]
- Haring, A.P.; Cesewski, E.; Johnson, B.N. Piezoelectric cantilever biosensors for label-free, real-time detection of DNA and RNA. Methods Mol. Biol. 2017, 1572, 247–262. [Google Scholar]
- Huang, K.-N.; Shen, C.-Y.; Wang, S.-H.; Hung, C.-H. Development of quartz crystal microbalance-based immunosensor for detecting alpha-fetoprotein. Instrum. Sci. Technol. 2013, 41, 311–324. [Google Scholar] [CrossRef]
- White, R.M.; Voltmer, F.W. Direct piezoelectric coupling to surface elastic waves. Appl. Phys. Lett. 1965, 7, 314–316. [Google Scholar] [CrossRef]
- Go, D.B.; Atashbar, M.Z.; Ramshani, Z.; Chang, H.-C. Surface acoustic wave devices for chemical sensing and microfluidics: A review and perspective. Anal. Methods 2017, 9, 4112–4134. [Google Scholar] [CrossRef]
- Taller, D.; Richards, K.; Slouka, Z.; Senapati, S.; Hill, R.; Go, D.B.; Chang, H.-C. On-chip surface acoustic wave lysis and ion-exchange nanomembrane detection of exosomal RNA for pancreatic cancer study and diagnosis. Lab Chip 2015, 15, 1656–1666. [Google Scholar] [CrossRef] [PubMed]
Target | Technique | Sensor Material | Electrode | IP 1 (h) | HP 2 (h) | LOD | LR 3 | References |
---|---|---|---|---|---|---|---|---|
miRNA-122 | DPV | rGO/AuNP | Gold | 12 | 1 | 1.73 pM | 10 pM to 10 µM | [67] |
DPV | PB/GO | Gold | 24 | 1 | 1.5 fM | 10 fM to 10 nM | [128] | |
DPV | n.m. 4 | SPE | 1 | 1 | 1 pM | 5 nM to 1 μM | [124] | |
DPV | Graphene | PGE | 0.5 | 0.5 | 1.06 pM | 0.5 to 7 μg/ml | [125] | |
miRNA let7a | DPV | CNT/Chrysin/AuNPs | CPE | 0.5 | 0.5 | 1.0 zM | 1 zM to 11 nM | [71] |
EIS | AgNPs/P | CPE | n.a. 5 | 0.5 | 1 aM | 1 aM to 1 μM | [130] | |
miRNA-21 | DPV | Pt | SPE | n.a. | n.a. | 135 aM | 500 aM to 1 μM | [73] |
miRNA-221 | Amperometry | n.m. | Gold | 3 | Over night | 0.6 pM | 0 to 20 nM | [131] |
lncRNA (HULC) | CV | PtPd BND/BNF@GO/Au/HRP | GCE 6 | 3 | 3 | 0.247 fM | 1 pM to 1 mM | [129] |
lncRNA (HOTAIR) | Amperometry | n.m. | SPE | 1 | 2 | 1 fM | 1 fM to 1 nM | [78] |
Target | Technique | Sensor Material | LOD | LR | References |
---|---|---|---|---|---|
miRNA-122 | SPR | Antibody-based | 2 pM | 10 pM to 100 pM | [148] |
Colorimetric | AuNP | 16 pM | 20 pM to 1 nM | [144] | |
miRNA-21 | Colorimetric | SiO2MPs | 8.9 fM | 10 fM to 0.1 pM | [143] |
miRNA-125b | SPR | Antibody-based | 123 pM | 8 nM to 1000 pM | [76] |
miRNA-223 | SERS | AuNP | >pM | 10 pM to 10 nM | [75] |
lncRNA (HULC) | ECL | Au@Ag/GQDs | 0.3 fM | 1 fM to 1 nM | [77] |
miRNA-122 miRNA-148b miRNA-192 | Cantilever-based | Pyrene | n.a. 1 | 0 to 1 pM | [70] |
miRNA-21 | QCM | Ti 2/Au | 3.6 fM | 2.5 pM to 2.5 μM | [165] |
Abbreviation | Explanation | Abbreviation | Explanation |
---|---|---|---|
HCC | Hepatocellular carcinoma | CNTs | Carbon nanotubes |
ICC | Intrahepatic cholangiocarcinoma | G | Graphene |
HBV | Hepatitis B virus | LOD | Limit of detection |
HCV | Hepatitis C virus | LR | Linear range |
NAFLD | Non-alcoholic fatty liver disease | SPE | Screen-printed electrode |
CT | Computed tomography | PGEs | Pencil graphite electrode |
US | Ultrasonography | GO | Graphene oxide |
MRI | Magnetic resonance imaging | RGO | Reduced graphene oxide |
AFP | Alpha-fetoprotein | NPs | Nanoparticles |
mRNAS | Messenger RNAs | AuNPs | Gold nanoparticles |
ncRNAs | Non-protein coding RNAs | PB | Prussian blue |
sncRNAs | Short ncRNAs | BND/BNF | Bimetallic nanodendrites/nanoflower |
piRNAs | PiWi interacting RNAs | HRP | Horseradish peroxidase |
siRNAs | Small-interfering RNAs | Pt | Platinum |
rRNA | Ribosomal RN | Pd | Palladium |
tRNA | Transfer RNA | HQ | Hydroquinone |
snRNAs | Small nuclear RNAs | 3WJ | Three-way joint |
lncRNAs | Long ncRNAs | H | Hairpin |
miRNAs | Micro-RNAs | GNF | Gold nanoflower |
RT-qPCR | Reverse transcriptase quantitative polymerase chain reaction | AgNPs | Silver nanoparticles |
LC | Liver cirrhosis | P | Propolis |
CHC | Chronic hepatitis C | barG | Barcode gold nanoparticles |
HULC | Highly up-regulated non-coding RNA | EIS | Electrochemical impedance spectroscopy |
EMT | Epithelial-mesenchymal transition | CP | Carbon paste |
HOX | Homeobox | zm | Zepto-molar |
HOTAIR | Transcript antisense intergenic RNA | CHA | Catalyzed hairpin assembly |
DCP | Des-gamma carboxyprothrombin | LSPR | Localize surface plasmon resonance |
MDK | Midkine | SiO2MPs | Silicon dioxide microparticles |
DKK1 | Dikkopf-1 | DSN | Duplex-specific nuclease |
GPC-3 | Glypican-3 | DASM | Double antibody sandwich method |
AFU | Alpha-1 fucosidase | ECL | Electrochemiluminescence |
GP-73 | Golgi protein-73 | QDs | Quantum dots |
AFP-L3% | Lens culinaris agglutinin-reactive fraction of alpha-fetoprotein | GQDs | Graphene quantum dots |
Hep Par 1 | Hepatocyte paraffin 1 | QCM | Quartz crystal microbalance |
HSP70 | Heat shock protein 70 | SAW | Surface acoustic wave |
SPR | Surface plasmon resonance | aa | Ascorbic acid |
SERS | Shift Raman-based sensing | FC | Ferrocene |
MB | Methylene blue |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Falahi, S.; Rafiee-Pour, H.-A.; Zarejousheghani, M.; Rahimi, P.; Joseph, Y. Non-Coding RNA-Based Biosensors for Early Detection of Liver Cancer. Biomedicines 2021, 9, 964. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9080964
Falahi S, Rafiee-Pour H-A, Zarejousheghani M, Rahimi P, Joseph Y. Non-Coding RNA-Based Biosensors for Early Detection of Liver Cancer. Biomedicines. 2021; 9(8):964. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9080964
Chicago/Turabian StyleFalahi, Sedigheh, Hossain-Ali Rafiee-Pour, Mashaalah Zarejousheghani, Parvaneh Rahimi, and Yvonne Joseph. 2021. "Non-Coding RNA-Based Biosensors for Early Detection of Liver Cancer" Biomedicines 9, no. 8: 964. https://0-doi-org.brum.beds.ac.uk/10.3390/biomedicines9080964