Detection and Quantification of Adulterated Beef and Mutton Products by Multiplex Droplet Digital PCR
Abstract
:1. Introduction
2. Materials and Methods
2.1. Meat-Sample Preparation
2.2. DNA Extraction
2.3. Primers and Probes
2.4. Specificity Assays
2.5. Sensitivity Analysis of Primers and Probes
2.6. Fluorescence Interference
2.7. Droplet Digital PCR Assay
2.8. Analysis of Samples of Known Composition
3. Results
3.1. Species Specificity
3.2. Amplification Efficiency of Primers
3.3. Sensitivity of Primers and Probes
3.4. Accuracy of Multiplex PCR
3.5. Analysis of Samples of Known Composition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, W.; Xue, J. Economically Motivated Food Fraud and Adulteration in China: An Analysis Based on 1553 Media Reports. Food Control 2016, 67, 192–198. [Google Scholar] [CrossRef]
- O’Mahony, P.J. Finding Horse Meat in Beef Products—A Global Problem. QJM 2013, 106, 595–597. [Google Scholar] [CrossRef] [PubMed]
- Floren, C.; Wiedemann, I.; Brenig, B.; Schütz, E.; Beck, J. Species Identification and Quantification in Meat and Meat Products Using Droplet Digital PCR (DdPCR). Food Chem. 2015, 173, 1054–1058. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.; Deng, T.; Huang, W.; Ge, Y.; Chen, Y. A Precise Quantitative Assay for Measuring Pork Incorporated into Mutton Products by Droplet Digital PCR. Food Sci. 2017, 38, 311–316. [Google Scholar]
- Rodríguez, M.A.; García, T.; González, I.; Asensio, L.; Mayoral, B.; López-Calleja, I.; Hernández, P.E.; Martin, R. Identification of Goose, Mule Duck, Chicken, Turkey, and Swine in Foie Gras by Species-Specific Polymerase Chain Reaction. J. Agric. Food Chem. 2003, 51, 1524–1529. [Google Scholar] [CrossRef] [PubMed]
- Dreo, T.; Pirc, M.; Ramšak, Ž.; Pavšič, J.; Milavec, M.; Žel, J.; Gruden, K. Optimising Droplet Digital PCR Analysis Approaches for Detection and Quantification of Bacteria: A Case Study of Fire Blight and Potato Brown Rot. Anal. Bioanal. Chem. 2014, 406, 6513–6528. [Google Scholar] [CrossRef] [PubMed]
- Druml, B.; Mayer, W.; Cichna-Markl, M.; Hochegger, R. Development and Validation of a TaqMan Real-Time PCR Assay for the Identification and Quantification of Roe Deer (Capreolus capreolus) in Food to Detect Food Adulteration. Food Chem. 2015, 178, 319–326. [Google Scholar] [CrossRef]
- Yang, H.; Wang, X.; Xiao, Y.; Wei, W.; Xu, J. Rapid Detection of Chicken, Duck and Pork Blending in Beef Products by Multiple Digital PCR. Acta Agric. Zhejiangensis 2017, 29, 994–1000. [Google Scholar]
- Cai, Y.; He, Y.; Lv, R.; Chen, H.; Wang, Q.; Pan, L. Detection and Quantification of Beef and Pork Materials in Meat Products by Duplex Droplet Digital PCR. PLoS ONE 2017, 12, e0181949. [Google Scholar] [CrossRef]
- Yang, S.; Jiang, F.; Liu, Y.; Li, S.; Wang, M.; Ma, Y.; Lin, M.; Zhang, L. Duplex Digital Droplet PCR for the Determination of Walnut-Derived and Soybean-Derived Ingredients in Walnut Protein Drink. Food Sci. 2017, 38, 280–286. [Google Scholar] [CrossRef]
- Deb, R.; Sengar, G.S.; Singh, U.; Kumar, S.; Alyethodi, R.R.; Alex, R.; Raja, T.V.; Das, A.K.; Prakash, B. Application of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Cow Components Adulterated in Buffalo Milk/Meat. Mol. Biotechnol. 2016, 58, 850–860. [Google Scholar] [CrossRef] [PubMed]
- Morisset, D.; Štebih, D.; Milavec, M.; Gruden, K.; Žel, J. Quantitative Analysis of Food and Feed Samples with Droplet Digital PCR. PLoS ONE 2013, 8, e62583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Köppel, R.; Ganeshan, A.; van Velsen, F.; Weber, S.; Schmid, J.; Graf, C.; Hochegger, R. Digital Duplex versus Real-Time PCR for the Determination of Meat Proportions from Sausages Containing Pork and Beef. Eur. Food Res. Technol. 2019, 245, 151–157. [Google Scholar] [CrossRef]
- Temisak, S.; Thangsunan, P.; Boonnil, J.; Yenchum, W.; Hongthong, K.; Oss Boll, H.; Yata, T.; Rios-Solis, L.; Morris, P. Accurate Determination of Meat Mass Fractions Using DNA Measurements for Quantifying Meat Adulteration by Digital PCR; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2021; Volume 56. [Google Scholar]
- Köppel, R.; Ganeshan, A.; Weber, S.; Pietsch, K.; Graf, C.; Hochegger, R.; Griffiths, K.; Burkhardt, S. Duplex Digital PCR for the Determination of Meat Proportions of Sausages Containing Meat from Chicken, Turkey, Horse, Cow, Pig and Sheep. Eur. Food Res. Technol. 2019, 245, 853–862. [Google Scholar] [CrossRef]
- Köppel, R.; Ruf, J.; Zimmerli, F.; Breitenmoser, A. Multiplex Real-Time PCR for the Detection and Quantification of DNA from Beef, Pork, Chicken and Turkey. Eur. Food Res. Technol. 2008, 227, 1199–1203. [Google Scholar] [CrossRef]
- Fang, X.; Zhang, C. Detection of Adulterated Murine Components in Meat Products by TaqMan© Real-Time PCR. Food Chem. 2016, 192, 485–490. [Google Scholar] [CrossRef]
- Cai, Y.; Li, X.; Lv, R.; Yang, J.; Li, J.; He, Y.; Pan, L. Quantitative Analysis of Pork and Chicken Products by Droplet Digital PCR. Biomed Res. Int. 2014, 2014, 810209. [Google Scholar] [CrossRef]
- Ren, J.; Huang, W.; Ge, Y.; Chen, Y. Progress in Meat Adulteration Detection Techniques. Food Sci. 2016, 37, 247–257. [Google Scholar] [CrossRef]
- Wu, X.; Lv, B.; Jiang, W.; Bai, L.; Wu, G.; Wang, J.; Wang, R.; Pan, A.; Tang, X. Rapid Detection Technique of Duck-Derived Components in Beef and Sheep Products by LAMP. J. Food Sci. Biotechnol. 2019, 38, 126–133. [Google Scholar]
- Liu, H.; Wang, J.; Li, P.; Bai, L.; Jia, J.; Pan, A.; Long, X.; Cui, W.; Tang, X. Rapid Detection of P–35S and T-Nos in Genetically Modified Organisms by Recombinase Polymerase Amplification Combined with a Lateral Flow Strip. Food Control 2020, 107, 106775. [Google Scholar] [CrossRef]
- Kitpipit, T.; Sittichan, K.; Thanakiatkrai, P. Direct-Multiplex PCR Assay for Meat Species Identification in Food Products. Food Chem. 2014, 163, 77–82. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Bai, L.; Li, W.; Zhang, J.; Wang, R.; Wu, W.; Tang, X. Optimization of Five-Plx PCR Method for the Identification of Five Animal Species and Analysis of Its Detection Limit. J. Nucl. Agric. Sci. 2018, 32, 506–514. [Google Scholar]
- Pinheiro, L.B.; Coleman, V.A.; Hindson, C.M.; Herrmann, J.; Hindson, B.J.; Bhat, S.; Emslie, K.R. Evaluation of a Droplet Digital Polymerase Chain Reaction Format for DNA Copy Number Quantification. Anal. Chem. 2012, 84, 1003–1011. [Google Scholar] [CrossRef] [PubMed]
Name | Primers and Probes | Base Sequence (5′ to 3′) |
---|---|---|
Bos taurus | F | ATACTCCATCCAGAACACCCAG |
R | ATGCGAAGCAGCTCCAAGT | |
P | HEX-CTTCTCTGAAACCATC-MGB | |
Ovis aries | F | CAGCCCTCGCCATAGTTCAC |
R | TTGTCTGGGTCTCCGAGTAAGTC | |
P | HEX-TCTTCCTCCACGAAACAGGATCCAACA-MGB | |
Anas platyrhynchos | F | GATTCTACTTCACCGCCCTAC |
R | CTACGAAGTGTCAGTATCAGGC | |
P | FAM-ATCCACCTTCCTAACCGTCTGCC-MGB | |
Sus scrofa | F | GGAGTGTGTATCCCGTAGGTG |
R | CTGGGGACATGCAGAGAGTG | |
P | FAM-TCTGACGTGACTCCCCGACCTGG-MGB | |
Gallus gallus | F | AAGTGCTGGCTGTGAGTTGG |
R | CGCTCCGCTACCTAATTCCT | |
P | FAM-CTGTACCTTAAGCCTGCTCAGACTCTGG-MGB |
Reaction Components | Volume (µL) | |||
---|---|---|---|---|
Double | Triple | Quadruple | Quintuple | |
ddPCR Supermix for Probes (No dUTP) | 10 | 10 | 10 | 10 |
Bos taurus-F/R/P (10 µM each) | 1 + 1 + 0.5 | — | 0.8 + 0.8 + 0.4/— | 0.6 + 0.6 + 0.3 |
Ovis aries-F/R/P (10 µM each) | 1 + 1 + 0.5 | — | —/0.8 + 0.8 + 0.4 | 0.6 + 0.6 + 0.3 |
Sus scrofa-F/R/P (10 µM each) | — | 0.8 + 0.8 + 0.4 | 0.8 + 0.8 + 0.4 | 0.6 + 0.6 + 0.3 |
Gallus gallus-F/R/P (10 µM each) | — | 0.8 + 0.8 + 0.4 | 0.8 + 0.8 + 0.4 | 0.6 + 0.6 + 0.3 |
Anas platyrhynchos-F/R/P (10 µM each) | — | 0.8 + 0.8 + 0.4 | 0.8 + 0.8 + 0.4 | 0.6 + 0.6 + 0.3 |
Template | 1 | 1 | 1 | 1 |
ddH2O | 4 | 3 | 1 | 1.5 |
ID | Sample Type | 260Abs (10 mm) | 280Abs (10 mm) | 260/280 | Conc. (ng/μL) |
---|---|---|---|---|---|
Bos taurus | dsDNA | 6.394 | 3.42 | 1.87 | 319.68 |
Ovis aries | dsDNA | 5.151 | 2.764 | 1.86 | 257.53 |
Sus scrofa | dsDNA | 5.892 | 3.178 | 1.85 | 294.6 |
Gallus gallus | dsDNA | 10.364 | 5.674 | 1.83 | 318.19 |
Anas platyrhynchos | dsDNA | 6.055 | 3.238 | 1.87 | 299.77 |
Species | Regression Equation of Standard Curve | R2 | Standard Error |
---|---|---|---|
Bos taurus | Ct = −3.702x + 30.76 | 0.9994 | 0.0406 |
Ovis aries | Ct = −3.321x + 28.15 | 0.9995 | 0.0235 |
Sus scrofa | Ct = −3.404x + 29.74 | 0.9994 | 0.0253 |
Gallus gallus | Ct = −3.420x + 30.23 | 0.9994 | 0.0280 |
Anas platyrhynchos | Ct = −3.401x + 29.12 | 0.9990 | 0.0474 |
DNA Template | Primers and Probe | Theory Value (Copies/μL) | Detection Value (Copies/μL) | Deviation |
---|---|---|---|---|
beef:mutton (1:1) | beef | 171 | 164 | −0.04 |
mutton | 169 | 166 | −0.02 | |
beef and mutton | 340 | 319 | −0.06 |
DNA Template | Primers and Probe | Theory Value (Copies/μL) | Detection Value (Copies/μL) | Deviation |
---|---|---|---|---|
pork:chicken:duck (1:1:1) | pork | 125 | 132 | 0.06 |
chicken | 119 | 114 | −0.04 | |
duck | 109 | 97 | −0.11 | |
pork, chicken and duck | 353 | 323 | −0.08 | |
pork:chicken:duck (1:2:3) | pork | 63 | 65 | 0.03 |
chicken | 119 | 106 | −0.11 | |
duck | 163 | 162 | −0.01 | |
pork, chicken and duck | 345 | 330 | −0.04 | |
pork:chicken:duck (1:3:6) | pork | 38 | 35 | −0.08 |
chicken | 107 | 104 | −0.03 | |
duck | 196 | 201 | 0.03 | |
pork, chicken and duck | 341 | 316 | −0.07 |
Template | Theory Value (Copies/μL) (HEX) | Detection Value (Copies/μL) (HEX) | Theory Value (Copies/μL) (FAM) | Detection Value (Copies/μL) (FAM) | Proportion | Deviation | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Beef | Mutton | Pork Chicken Duck | Beef | Mutton | Pork Chicken Duck | Beef | Mutton | Pork Chicken Duck | ||||
95% | 0 | 5% | 325 | 271 | 18 | 22 | 92.4% | 0 | 8.6% | −0.03 | 0 | 0.72 |
50% | 0 | 50% | 171 | 149 | 176 | 136 | 52.2% | 0 | 47.8% | 0.04 | 0 | −0.04 |
5% | 0 | 95% | 17 | 12 | 335 | 298 | 3.8% | 0 | 96.2% | −0.24 | 0 | 0.01 |
0 | 95% | 5% | 321 | 254 | 18 | 15 | 0 | 94.8% | 5.2% | 0 | 0.00 | 0.04 |
0 | 50% | 50% | 169 | 152 | 176 | 138 | 0 | 52.4% | 47.6% | 0 | 0.05 | −0.05 |
0 | 5% | 95% | 17 | 15 | 335 | 263 | 0 | 5.4% | 94.6% | 0 | 0.08 | 0.00 |
95% | 5% | 323 | 261 | 18 | 10 | 96.3% | 3.7% | 0.01 | −0.26 | |||
50% | 50% | 170 | 146 | 176 | 138 | 51.4% | 48.6% | 0.03 | −0.03 | |||
5% | 95% | 17 | 13 | 335 | 244 | 5.1% | 94.9% | 0.02 | 0.00 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, C.; Bai, L.; Chen, Y.; Jiang, W.; Jia, J.; Pan, A.; Lv, B.; Wu, X. Detection and Quantification of Adulterated Beef and Mutton Products by Multiplex Droplet Digital PCR. Foods 2022, 11, 3034. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11193034
He C, Bai L, Chen Y, Jiang W, Jia J, Pan A, Lv B, Wu X. Detection and Quantification of Adulterated Beef and Mutton Products by Multiplex Droplet Digital PCR. Foods. 2022; 11(19):3034. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11193034
Chicago/Turabian StyleHe, Chuan, Lan Bai, Yifan Chen, Wei Jiang, Junwei Jia, Aihu Pan, Beibei Lv, and Xiao Wu. 2022. "Detection and Quantification of Adulterated Beef and Mutton Products by Multiplex Droplet Digital PCR" Foods 11, no. 19: 3034. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11193034