Antibacterial Activity and Mechanism of Self-Assembly Spermidine-Capped Carbon Dots against Staphylococcus aureus
Abstract
:1. Introduction
2. Materials
2.1. Staphylococcus aureus Culture
2.2. Synthesis of S-PCDs
2.3. Characterization of S-PCDs
2.4. Antibacterial Activity of S-PCDs
2.4.1. MIC of S-PCDs against S. aureus
2.4.2. Bacteriostatic Circle and Bacteriostatic Rate
2.4.3. Spread Plate Method to Determine Antibacterial Activity
2.4.4. Bacteriostatic and Bactericidal Curves of S. aureus
2.5. Antibacterial Mechanism of S-PCDs
2.5.1. The Damage of Membrane Permeability
2.5.2. Determination of Extracellular Nucleic Acid and Protein Content
2.5.3. Microscope Observation of Morphology of S. aureus
2.5.4. Confocal Laser Scanning Microscopy Detected Bacterial Viability
2.5.5. Intracellular Reactive Oxygen Species (ROS)
2.5.6. Gene Expression
2.6. Antibiofilm Activity of S-PCDs
2.7. Safety Evaluation of S-PCDs
2.8. Effects of S-PCDs on the Growth of S. aureus in Pasteurized Milk
2.9. Statistical Analysis
3. Results and Discussion
3.1. Performance Characterization of S-PCDs
3.2. Antibacterial Activity of S-PCDs
3.3. Cell Membrane Damage of S. aureus
3.4. ROS Generation of S. aureus
3.5. Antibiofilm Activity of S-PCDs
3.6. Safety Evaluation of S-PCDs
3.7. Effects of S-PCDs on Growth of S. aureus in Pasteurized Milk
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lai, D.; Zhou, A.; Tan, B.K.; Tang, Y.; Sarah Hamzah, S.; Zhang, Z.; Lin, S.; Hu, J. Preparation and photodynamic bactericidal effects of curcumin-beta-cyclodextrin complex. Food Chem. 2021, 361, 130117. [Google Scholar] [CrossRef] [PubMed]
- Bajpai, V.K.; Bahuguna, A.; Kumar, V.; Khan, I.; Alrokayan, S.H.; Khan, H.A.; Simal-Gandara, J.; Xiao, J.; Na, M.; Sonwal, S.; et al. Cellular antioxidant potential and inhibition of foodborne pathogens by a sesquiterpene ilimaquinone in cold storaged ground chicken and under temperature-abuse condition. Food Chem. 2022, 373, 131392. [Google Scholar] [CrossRef] [PubMed]
- Tenderis, B.; Kilic, B.; Yalcin, H.; Simsek, A. Impact of sodium lactate, encapsulated or unencapsulated polyphosphates and their combinations on Salmonella typhimurium, Escherichia coli O157:H7 and Staphylococcus aureus growth in cooked ground beef. Int. J. Food Microbiol. 2020, 321, 108560. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kong, F.; Shi, X.; Han, H.; Li, M.; Guan, B.; Yang, M.; Cao, X.; Tao, D.; Zheng, Y.; et al. Antibacterial activity and mechanism of lactobionic acid against Pseudomonas fluorescens and Methicillin-resistant Staphylococcus aureus and its application on whole milk. Food Control 2020, 108, 106876. [Google Scholar] [CrossRef]
- Wu, Z.; Tang, S.; Deng, W.; Luo, J.; Wang, X. Antibacterial chitosan composite films with food-inspired carbon spheres immobilized AgNPs. Food Chem. 2021, 363, 130342. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Tang, G.; Tang, J.; Yang, J.; Zhou, Z.; Gao, Y.; Chen, X.; Tian, Y.; Li, Y.; Li, J.; et al. Functionalized Silver Nanocapsules with Improved Antibacterial Activity Using Silica Shells Modified with Quaternary Ammonium Polyethyleneimine as a Bacterial Cell-Targeting Agent. J. Agric. Food Chem. 2021, 69, 6485–6494. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Huang, J.; Song, Y.; Zhang, M.; Wang, H.; Lu, F.; Huang, H.; Liu, Y.; Dai, X.; Gu, Z.; et al. Degradable Carbon Dots with Broad-Spectrum Antibacterial Activity. ACS Appl. Mater. Interfaces 2018, 10, 26936–26946. [Google Scholar] [CrossRef] [PubMed]
- Jian, H.J.; Wu, R.S.; Lin, T.Y.; Li, Y.J.; Lin, H.J.; Harroun, S.G.; Lai, J.Y.; Huang, C.C. Super-Cationic Carbon Quantum Dots Synthesized from Spermidine as an Eye Drop Formulation for Topical Treatment of Bacterial Keratitis. ACS Nano 2017, 11, 6703–6716. [Google Scholar] [CrossRef]
- Zheng, K.; Setyawati, M.I.; Leong, D.T.; Xie, J. Antimicrobial silver nanomaterials. Coord. Chem. Rev. 2018, 357, 1–17. [Google Scholar] [CrossRef]
- Pan, T.; Chen, H.; Gao, X.; Wu, Z.; Ye, Y.; Shen, Y. Engineering efficient artificial nanozyme based on chitosan grafted Fe-doped-carbon dots for bacteria biofilm eradication. J. Hazard Mater. 2022, 435, 128996. [Google Scholar] [CrossRef]
- Wu, L.-N.; Yang, Y.-J.; Huang, L.-X.; Zhong, Y.; Chen, Y.; Gao, Y.-R.; Lin, L.-Q.; Lei, Y.; Liu, A.-L. Levofloxacin-based carbon dots to enhance antibacterial activities and combat antibiotic resistance. Carbon 2022, 186, 452–464. [Google Scholar] [CrossRef]
- Nakamura, T.; Tamura, A.; Murotani, H.; Oishi, M.; Jinji, Y.; Matsuishi, K.; Nagasaki, Y. Large payloads of gold nanoparticles into the polyamine network core of stimuli-responsive PEGylated nanogels for selective and noninvasive cancer photothermal therapy. Nanoscale 2010, 2, 739–746. [Google Scholar] [CrossRef] [PubMed]
- Azevedo, M.M.; Ramalho, P.; Silva, A.P.; Teixeira-Santos, R.; Pina-Vaz, C.; Rodrigues, A.G. Polyethyleneimine and polyethyleneimine-based nanoparticles: Novel bacterial and yeast biofilm inhibitors. J. Med. Microbiol. 2014, 63, 1167–1173. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.J.; Harroun, S.G.; Su, Y.C.; Huang, C.F.; Unnikrishnan, B.; Lin, H.J.; Lin, C.H.; Huang, C.C. Synthesis of Self-Assembled Spermidine-Carbon Quantum Dots Effective against Multidrug-Resistant Bacteria. Adv. Healthc. Mater. 2016, 5, 2545–2554. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.-X.; An, X.-L.; Xu, Y.-N.; Hao, Y.-J.; Piao, X.-C.; Jin, M.-Y.; Lian, M.-L. Antibacterial and antibiofilm properties of dichloromethane fraction of extracts from adventitious roots of Eurycoma longifolia against Staphylococcus aureus. LWT 2022, 162, 113438. [Google Scholar] [CrossRef]
- Cui, F.; Sun, J.; Ji, J.; Yang, X.; Wei, K.; Xu, H.; Gu, Q.; Zhang, Y.; Sun, X. Carbon dots-releasing hydrogels with antibacterial activity, high biocompatibility, and fluorescence performance as candidate materials for wound healing. J. Hazard Mater. 2021, 406, 124330. [Google Scholar] [CrossRef] [PubMed]
- Hao, X.; Huang, L.; Zhao, C.; Chen, S.; Lin, W.; Lin, Y.; Zhang, L.; Sun, A.; Miao, C.; Lin, X.; et al. Antibacterial activity of positively charged carbon quantum dots without detectable resistance for wound healing with mixed bacteria infection. Mater. Sci. Eng. C Mater. Biol. Appl. 2021, 123, 111971. [Google Scholar] [CrossRef]
- Cui, T.; Bai, F.; Sun, M.; Lv, X.; Li, X.; Zhang, D.; Du, H. Lactobacillus crustorum ZHG 2-1 as novel quorum-quenching bacteria reducing virulence factors and biofilms formation of Pseudomonas aeruginosa. LWT 2020, 117, 108696. [Google Scholar] [CrossRef]
- Bag, A.; Bhattacharyya, S.K.; Pal, N.K.; Chattopadhyay, R.R. In vitro antibacterial potential of Eugenia jambolana seed extracts against multidrug-resistant human bacterial pathogens. Microbiol. Res. 2012, 167, 352–357. [Google Scholar] [CrossRef]
- Shi, Y.G.; Zhang, R.R.; Zhu, C.M.; Xu, M.F.; Gu, Q.; Ettelaie, R.; Lin, S.; Wang, Y.F.; Leng, X.Y. Antimicrobial mechanism of alkyl gallates against Escherichia coli and Staphylococcus aureus and its combined effect with electrospun nanofibers on Chinese Taihu icefish preservation. Food Chem. 2021, 346, 128949. [Google Scholar] [CrossRef]
- Wang, X.; He, S.; Yuan, L.; Deng, H.; Zhang, Z. Synthesis, Structure Characterization, and Antioxidant and Antibacterial Activity Study of Iso-orientin-Zinc Complex. J. Agric. Food Chem. 2021, 69, 3952–3964. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.; Li, G.; Zhao, P.; Cheng, Q.; He, Q.; Ma, D.; Xue, W. NIR-Laser-Controlled Hydrogen-Releasing PdH Nanohydride for Synergistic Hydrogen-Photothermal Antibacterial and Wound-Healing Therapies. Adv. Funct. Mater. 2019, 29, 1905697. [Google Scholar] [CrossRef]
- Zheng, K.; Setyawati, M.I.; Leong, D.T.; Xie, J. Overcoming bacterial physical defenses with molecule-like ultrasmall antimicrobial gold nanoclusters. Bioact. Mater. 2021, 6, 941–950. [Google Scholar] [CrossRef]
- Damiano, S.; Forino, M.; De, A.; Vitali, L.A.; Lupidi, G.; Taglialatela-Scafati, O. Antioxidant and antibiofilm activities of secondary metabolites from Ziziphus jujuba leaves used for infusion preparation. Food Chem. 2017, 230, 24–29. [Google Scholar] [CrossRef]
- Lin, W.T.; Zhang, Y.Y.; Tan, H.L.; Ao, H.Y.; Duan, Z.L.; He, G.; Tang, T.T. Inhibited Bacterial Adhesion and Biofilm Formation on Quaternized Chitosan-Loaded Titania Nanotubes with Various Diameters. Materials 2016, 9, 155. [Google Scholar] [CrossRef]
- Huang, J.; Liu, Y.; Yang, L.; Zhou, F. Synthesis of sulfonated chitosan and its antibiofilm formation activity against E. coli and S. aureus. Int. J. Biol. Macromol. 2019, 129, 980–988. [Google Scholar] [CrossRef]
- Li, Q.; Yu, S.; Han, J.; Wu, J.; You, L.; Shi, X.; Wang, S. Synergistic antibacterial activity and mechanism of action of nisin/carvacrol combination against Staphylococcus aureus and their application in the infecting pasteurized milk. Food Chem. 2022, 380, 132009. [Google Scholar] [CrossRef]
- Zhi, B.; Gallagher, M.J.; Frank, B.P.; Lyons, T.Y.; Qiu, T.A.; Da, J.; Mensch, A.C.; Hamers, R.J.; Zeev, R.; Howard, F.D. Investigation of phosphorous doping effects on polymeric carbon dots: Fluorescence, photostability, and environmental impact. Carbon 2018, 129, 438–449. [Google Scholar] [CrossRef]
- Zhan, Y.; Shang, B.; Chen, M.; Wu, L. One-Step Synthesis of Silica-Coated Carbon Dots with Controllable Solid-State Fluorescence for White Light-Emitting Diodes. Small 2019, 15, e1901161. [Google Scholar] [CrossRef]
- Cui, Y.; Zhang, J.; Zhang, G.; Huang, J.; Liu, P.; Antonietti, M.; Wang, X. Synthesis of bulk and nanoporous carbon nitride polymers from ammonium thiocyanate for photocatalytic hydrogen evolution. J. Mater. Chem. 2011, 21, 13032. [Google Scholar] [CrossRef]
- Yang, S.; Gong, Y.; Zhang, J.; Zhan, L.; Ma, L.; Fang, Z.; Vajtai, R.; Wang, X.; Ajayan, P.M. Exfoliated graphitic carbon nitride nanosheets as efficient catalysts for hydrogen evolution under visible light. Adv. Mater. 2013, 25, 2452–2456. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.-N.; Zhang, C.-Y.; Zhang, M.-F.; Pei, P.; Zhou, W.; Zha, Z.-B.; Shao, M.; Qian, H.-S. Precisely photothermal controlled releasing of antibacterial agent from Bi2S3 hollow microspheres triggered by NIR light for water sterilization. Chem. Eng. J. 2020, 381, 122630. [Google Scholar] [CrossRef]
- Girase, B.; Depan, D.; Shah, J.S.; Xu, W.; Misra, R.D.K. Silver–clay nanohybrid structure for effective and diffusion-controlled antimicrobial activity. Mater. Sci. Eng. C 2011, 31, 1759–1766. [Google Scholar] [CrossRef]
- Qi, X.; Shah, H.; Nawaz, A.; Xie, W.; Akram, M.Z. Antibacterial Carbon-Based Nanomaterials. Adv. Mater. 2018, 31, e1804838. [Google Scholar]
- Bardhan, S.; Pal, K.; Roy, S.; Das, S.; Chakraborty, A.; Karmakar, P.; Basu, R.; Das, S. Nanoparticle Size-Dependent Antibacterial Activities in Natural Minerals. J. Nanosci. Nanotechnol. 2019, 19, 7112–7122. [Google Scholar] [CrossRef]
Gene | Forward Primer 5′ to 3′ | Reverse Primer 3′ to 5′ |
---|---|---|
dmpI | TGATGCCAATCGTCAATG | CCCGTTGTTTTTTCTACG |
narJ | GAACGTGGGCAAATGTTAG | TTGAAGCATCAACGGTAG |
narK | TATTCCCGATATTTTTCTTAAGCC | CTGATGTAACACCAACAGAG |
gyrB | TCAATACAGGTTTTAGAGGGGTTA | AACCATTCAATACTTCATCGACG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, T.; Fan, Y.; Liu, Y.; Fan, X.; Sun, Y.; Cheng, G.; Cheng, J. Antibacterial Activity and Mechanism of Self-Assembly Spermidine-Capped Carbon Dots against Staphylococcus aureus. Foods 2024, 13, 67. https://0-doi-org.brum.beds.ac.uk/10.3390/foods13010067
Cui T, Fan Y, Liu Y, Fan X, Sun Y, Cheng G, Cheng J. Antibacterial Activity and Mechanism of Self-Assembly Spermidine-Capped Carbon Dots against Staphylococcus aureus. Foods. 2024; 13(1):67. https://0-doi-org.brum.beds.ac.uk/10.3390/foods13010067
Chicago/Turabian StyleCui, Tianqi, Ya Fan, Yaping Liu, Xuejing Fan, Yuxue Sun, Guiguang Cheng, and Jianjun Cheng. 2024. "Antibacterial Activity and Mechanism of Self-Assembly Spermidine-Capped Carbon Dots against Staphylococcus aureus" Foods 13, no. 1: 67. https://0-doi-org.brum.beds.ac.uk/10.3390/foods13010067