Next Article in Journal
Methods for Antifungal Susceptibility Testing of the Cryptococcus neoformans/C. gattii Complex: Strengths and Limitations
Previous Article in Journal
Pioneer Tree Bellucia imperialis (Melastomataceae) from Central Amazon with Seedlings Highly Dependent on Arbuscular Mycorrhizal Fungi
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 9
Issue 5
10.3390/jof9050541
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages

by
Mateus Silveira Freitas
1,
Tamires Aparecida Bitencourt
1,
Caroline Patini Rezende
1,
Nubia Sabrina Martins
1,
Thales de Mileto Henrique Dourado
2,
Carlos R. Tirapelli
3 and
Fausto Almeida
1,*
1
Department of Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, SP, Brazil
2
Department of Pharmacology, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, SP, Brazil
3
Laboratory of Pharmacology, Department of Psychiatric Nursing and Human Sciences, College of Nursing of Ribeirão Preto, University of São Paulo, Ribeirão Preto 14040-902, SP, Brazil
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(5), 541; https://0-doi-org.brum.beds.ac.uk/10.3390/jof9050541
Submission received: 6 February 2023 / Revised: 23 April 2023 / Accepted: 24 April 2023 / Published: 4 May 2023
(This article belongs to the Special Issue Host Response to Fungal Pathogens)
Browse Figures
Versions Notes

Abstract

:
Fungal extracellular vesicles (EVs) mediate intra- and interspecies communication and are critical in host–fungus interaction, modulating inflammation and immune responses. In this study, we evaluated the in vitro pro- and anti-inflammatory properties of Aspergillus fumigatus EVs over innate leukocytes. A. fumigatus EVs induced a partial proinflammatory response by macrophages, characterized by increased tumor necrosis factor-alpha production, and increased gene expression of induced nitric oxide synthase and adhesion molecules. EVs induce neither NETosis in human neutrophils nor cytokine secretion by peripheral mononuclear cells. However, prior inoculation of A. fumigatus EVs in Galleria mellonella larvae resulted in increased survival after the fungal challenge. Taken together, these findings show that A. fumigatus EVs play a role in protection against fungal infection, although they induce a partial pro-inflammatory response.

1. Introduction

Aspergillus fumigatus is the main causative agent of aspergillosis, which can be a fatal disease [1]. Aspergillus are saprophytic organisms that release many airborne conidia [2,3]. The first line of defense against inhaled A. fumigatus conidia are resident macrophages, which interact with pathogen-associated molecular patterns from swollen conidia and promote cytokine release, phagocytosis, and intracellular killing [4]. Soluble factors, such as CXCL1 and CXCL2, released by resident macrophages, and other immune cells, recruit neutrophils to the site of infection [5]. Neutrophils are pivotal in conidia elimination and host protection [6].
Extracellular vesicles (EVs) are released by virtually all living organisms. The spherical structures formed of a lipid bilayer membrane transport several biomolecules [7,8]. Several species of fungi produce EVs [9,10,11,12,13,14] that have important biological functions [15]. Although their role in the infective process is still not clear, fungal EVs have been reported to have an effect on host immune responses and could also mediate intraspecies fungal communication [16,17]. EVs from A. flavus, Paracoccidioides brasiliensis, and Trichophyton interdigitale have strong proinflammatory activity for macrophages, with the increased release of proinflammatory mediators such as nitric oxide (NO), IL-12p40, IL-12p70, IL-6, TNF-α, IL-1α, and IL-1β, augmented phagocytosis and fungal killing, and activation toward inflammatory or M1 macrophages [13,18,19]. On the other hand, EVs from Histoplasma capsulatum display anti-inflammatory activity for macrophages and might reduce phagocytosis, intracellular killing, and the production of reactive oxygen species (ROS) [20]. These studies have demonstrated that fungal EVs have different actions on innate leukocytes, priming these cells to better control fungal infection or foster fungal growth.
Since EVs play an up- or down-modulatory role, in this study, we investigated the role of A. fumigatus EVs in the activation status of macrophages, neutrophils, and monocytes. These cells are pivotal in immune responses against A. fumigatus. Our data suggest that A. fumigatus EVs play a role in protection against fungal infection, inducing a partial pro-inflammatory response. Thus, our results suggest that A. fumigatus EVs could be exploited in antifungal therapies.

2. Materials and Methods

2.1. Ethics Statement

The protocols involving human cells used in this study were approved by the Research Ethics Committee of the University Hospital, Ribeirao Preto Medical School at the University of Sao Paulo (protocol 4.277.966), and informed written consent from all participants was obtained.

2.2. A. fumigatus Strain and Growth Conditions

A. fumigatus strain CEA17 was cultivated as described previously [16], with slight modifications. Freshly thawed vials containing conidia were seeded in a complete agar malt medium for 7 days at 37 °C. These plates were washed with PBS followed by centrifugation and filtration through sterile Miracloth (Millipore, Billerica, MA, USA) to obtain conidia suspensions. Conidia concentration was determined using a Neubauer chamber. Approximately 1 × 107 conidia were seeded in agar minimal medium [19]. After 2 days of incubation in 37 °C, the plates were washed with sterile PBS. EVs were then isolated and purified.

2.3. Isolation and Purification of EVs

Plates containing 2-day-old A. fumigatus cultures were washed twice with 5 mL of sterile PBS with the aid of inoculation loops. The recovered solution was filtered through sterile Miracloth (Millipore) and centrifuged at 5000× g for 15 min at 4 °C. The supernatant was recovered and centrifuged again at 15,000× g for 15 min at 4 °C. Supernatant concentration was performed in an Amicon system. Another centrifugation at 15,000× g for 15 min at 4 °C was performed, and the supernatant was filtered through a 0.45 µm filter. An ultracentrifugation was performed at 60,000 rpm for 1 h at 4 °C in a TLA-120.2 rotor (Beckman Coulter). The pellet was resuspended in sterile PBS. The due rotor fixed angle of rotation was 30 degrees; 60,000 rpm are equivalent of 98,800× g in its minimum radius. The obtained EVs were subjected to nanoparticle tracking analysis using a NanoSight NS300 system (Malvern Instruments, Malvern, UK) to verify their size, distribution, and concentration.

2.4. Culture of Macrophages

AMJ2-C11 and RAW 264.7 macrophages were maintained in Dulbecco’s modified Eagle’s medium (Sigma–Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA) and 1% penicillin-streptomycin (Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) at 37 °C in a 5% CO2 atmosphere. Cells were cultivated until confluence and detached from the flask bottom with Trypsin-EDTA solution (Sigma–Aldrich). The cells were counted in a Neubauer chamber and plated in 96- or 48-well culture plates (depending on the assay performed) and in a fetal bovine serum-free medium.

2.5. Isolation of PBMCs

Blood withdrawn under authorized supervision was collected using Vacutainer heparin collection tubes. PBMC separation was performed using Histopaque-1077 (Sigma–Aldrich). Briefly, collection tubes were centrifuged at 500× g for 20 min at 20 °C. The separated plasma was discarded. The remaining samples were diluted in PBS up to 15 mL. The solution was carefully layered over 6 mL of Histopaque-1077 solution and centrifuged at 500× g for 30 min at 20 °C. The rings formed with PBMCs were harvested and washed with PBS and centrifuged at 500× g for 10 min at 20 °C. The cells were resuspended in RPMI 1640 medium (Sigma–Aldrich) with 1% penicillin-streptomycin (Gibco, Thermo Fisher Scientific Inc.) lacking fetal bovine serum.

2.6. Cytokine Measurement

AMJ2-C11 or RAW 264.7 macrophages were plated in 96-well plates (3 × 104 cells/well) at 37 °C in a 5% CO2 atmosphere and rested overnight. Cells were stimulated with EVs (107 to 1010 EVs/mL), LPS (1 µg/mL) or medium alone for 24 h at 37 °C in a 5% CO2 atmosphere. After incubation, the supernatant was tested for the presence of TNF-α, IL-6, and IL-1β via enzyme-linked immunosorbent assay using an OptEIA kit (Pharmingen, San Diego, CA, USA), according to the manufacturer’s instructions. For the PBMCs, the cells were plated in 96-well plates (2 × 105 cells/well) at 37 °C in a 5% CO2 atmosphere, and soon after they were stimulated with EVs (109 to 1010 EVs/mL), LPS (1 µg/mL) or medium alone for 24 h at 37 °C in a 5% CO2 atmosphere. The presence of human cytokines (TNF-α, IL-6 and IL-10) was assessed using an OptEIA kit as described above. Absorbance was read at 450 nm in the Power Wave-X microplate scanning spectrophotometer (BioTek Instruments, Inc., Winooski, VT, USA).

2.7. Nitric Oxide (NO) Measurement

NO was measured in the supernatant of AMJ2-C11 cells plated (3 × 104 cells/well) in 96-well plates at 37 °C in a 5% CO2 atmosphere stimulated for 24 h with EVs (109 and 1010 EVs/mL), Pam3CSK4 (1 µg/mL), or medium alone. NO was quantified using the Griess method [21]. Briefly, 50 µL of cell supernatant was mixed with the same volume of Griess reagent (1.0% sulfanilamide, 0.1% naphthalenediamine dihydrochloride, and 2.5% H3PO4) at room temperature for 10 min in 96-well plates. Absorbance at 550 nm was read using a Power Wave-X microplate reader (BioTek Instruments, Inc.). The absorbance was converted to micromolar (µM) NO based on a standard curve generated using known concentrations of NaNO2.

2.8. Detection of O2•− by Lucigenin Enhanced Chemiluminescence

Superoxide levels were measured in AMJ2-C11 and RAW 264.7 culture supernatants using the lucigenin-derived chemiluminescence assay. Both cells were plated (3 × 104 cells/well) in 96-well plates at 37 °C in a 5% CO2 atmosphere and stimulated for 24 h with EVs (109 and 1010 EVs/mL), LPS (1 µg/mL), or medium alone. The reaction was carried out by the addition of 50 µL of the sample in the assay buffer, containing 50 mM KH2PO4, 1 mM EGTA, 150 mM sucrose, (pH 7.4) 5 µM lucigenin in 250 µL total volume. The addition of 0.1 mM of NAD(P)H started the reaction. Luminescence was measured with an Orion II luminometer (Berthold Technologies, Pforzheim, Germany). Blank was subtracted from each sample reading. The production of superoxide was expressed as relative light unit (RLU)/3 × 104 cells.

2.9. qPCR

AMJ2-C11 and RAW 264.7 macrophages were plated in 48-well plates (4 × 105 cells/well) at 37 °C in a 5% CO2 atmosphere and rested overnight. The cells were stimulated with EVs (1 × 1010 EVs/mL), LPS (1 µg/mL), LPS + Pam3CSK4 (500 ng/mL each), or medium alone for 6 and 24 h at 37 °C in a 5% CO2 atmosphere. The supernatant was discarded, and the cells were used for RNA extraction using the Illustra RNAspin Mini RNA isolation kit (GE Healthcare, Chicago, IL, USA) following the manufacturer’s instructions. RNA concentration and quality were measured using a nanophotometer (Implen, Westlake Village, CA, USA). Before complementary DNA (cDNA) synthesis, RNA was treated with DNase (Sigma–Aldrich). cDNA synthesis was performed using a high-capacity cDNA reverse-transcription kit (Applied Biosystems, Foster City, CA, USA), following the manufacturer’s instructions. Quantitative real-time PCR was performed using SYBR Green (Applied Biosystems) in the Step One Plus platform. The relative expression of transcripts was quantified using the ΔΔCt method and normalized relative to Gapdh expression. The primers used are listed in Table 1.

2.10. Macrophage Adhesion Assay

High binding plates were coated with fibrinogen (20 µg/mL; Sigma–Aldrich) overnight at 4 °C. The plate was washed with sterile PBS, and RAW 264.7 macrophages were seeded at 6 × 104 cells/well. Immediately after seeding, the cells were treated with LPS (1 µg/mL) or EVs (1 × 1010 EVs/mL). The plate was kept in a humidified incubator at 37 °C in a 5% CO2 atmosphere for 24 h. Each well was washed three times with 200 µL of PBS to remove non-adherent cells. After the last wash, the cells were incubated with a solution of 100 µM Resazurin (Sigma–Aldrich) in 150 µL of incomplete DMEM. After 4 and 24 h of incubation at 37 °C in a 5% CO2 atmosphere, the plate was read in a plate reader (BioTek Instruments, Inc.) at 570 and 600 nm. The percentage of the reduced form of Resazurin was calculated following the manufacturer’s instructions. Increased levels of reduced Resazurin were an indication of more cells in each well.

2.11. Isolation and Culture of Neutrophils

Healthy volunteers provided consent to serve as blood donors. Blood was withdrawn under authorized supervision. The blood was collected in tubes containing EDTA, and neutrophils were isolated by a Percoll gradient. Briefly, the gradient was layered by adding Percoll concentrations of 72, 64, 54, and 45%. Blood sample was added above the 45% layer. The gradient was centrifuged at 650× g for 32 min. The layer of polymorphonuclear cells was collected, centrifuged at 400× g for 10 min, and plated (5 × 105 cells/well). The cells were stimulated with EVs (109 or 1010 EVs/mL) overnight. As the positive control, cells were stimulated with 10 µM phorbol myristate acetate (PMA) for 2 to 4 h. PMA is a known inducer of NETosis [25].

2.12. Detection of NETs by Flow Cytometry

Cultured neutrophils were labeled with FVS780 viability stain (BD Biosciences, San Diego, CA, USA) and Sytox Green (Thermo Fisher Scientific). Fluorescence was detected using a FACS Melody device (BD Biosciences, San Jose, CA, USA). Analysis was performed using the FlowJo software (Becton Dickinson and Company, Franklin Lakes, NJ, USA).

2.13. G. mellonella Survival Assay

G. mellonella larvae were kept in sterile glass flasks with modified lids, with a hole in the center covered with an ultra-fine stainless steel wire mesh for better ventilation. They were maintained in a BOD SL-200 incubator (Solab cientifica) in the dark with a controlled temperature of 28 °C. They were fed with an in-house-produced mixture of bee wax, beer yeast, soy, honey, powder milk, and corn meal. G. mellonella survival was assayed as previously described [19]. Ten healthy G. mellonella larvae of similar weight (approximately 240 to 300 mg) were used in each group. Each larva was inoculated with 57 µL of 1010, 109, or 108 EVs, or with PBS as the control, into the last left proleg, directly on the hemocoel. After 48 h, all larvae were infected with 10 µL of a solution containing 100 conidia/larvae (1 × 104 conidia/mL) of A. fumigatus at the same site of injection. Preliminary experiments using 103 and 106 conidia/larvae showed the early death of the larvae (2 days) after conidia inoculum. With the above-mentioned concentration of 100 conidia/larvae, the larvae were able to survive longer, and we could perform the survival analysis clearly. The larvae were kept at 37 °C in the dark. Mortality was monitored daily; a lack of movement after physical stimuli was indicative of larva death. We performed a test to verify that neither the inoculum volume nor the site of injection was the cause of larva death. The results showed that despite the inoculum volume (57 µL) and the site of the second injection (the same proleg) there was no increase in larvae mortality.

2.14. Statistical Analysis

The results are expressed as the mean ± SEM of the three independent experiments. The statistical analysis was carried out using the Graph Pad Prism software version 8.4.3 (GraphPad Software, San Diego, CA, USA). Homogeneous variance was analyzed, and the difference between the means of the groups was calculated by analysis of variance (one-way) and Dunnett’s test thereafter. In addition, a two-tailed unpaired t test was used for the parametric data. For comparisons of survival curves, log rank (Mantel–Cox) tests were used. Differences with p < 0.05 were considered statistically significant.

3. Results

3.1. A. fumigatus EVs Induce TNF-α by Macrophages

Fungal EVs transport several molecules that up- or down-modulate inflammation and immune responses. To clarify the in vitro inflammatory properties of A. fumigatus EVs, we analyzed the AMJ2-C11 and RAW 264.7 macrophage lines stimulated with different concentrations of A. fumigatus EVs (107 to 1010 EVs/mL) for 24 h. In parallel, those cells were stimulated with LPS, as a positive control, or were left unstimulated (medium). AMJ2-C11 macrophages showed significant and increased production of TNF-α at the highest concentration of EVs (1010 EVs/mL) compared to the unstimulated cells (medium), which were not statistically different from the LPS-stimulated cells (Figure 1A). The production of IL-6 was not altered (Figure S1A). Similar results were observed with RAW 264.7 cells; TNF-α production was increased upon stimulation with 109 and 1010 EVs/mL (Figure 1D), but no alterations in IL-6 and IL-1β production were observed (Figure S1B,C).
Nitric oxide (NO) and superoxide (O2•−) play important roles in killing invading organisms, acting in phagolysosomes inside phagocytes. O2•− is involved in host defense against A. fumigatus infection in vivo [26]. After 24 h of stimulation with A. fumigatus EVs at the highest concentration (1010 EVs/mL), AMJ2-C11 macrophages exhibited increased NO production (Figure 1C) and no O2•− production (Figure 1B). RAW 264.7 macrophages showed reduced O2•− production after stimulation with 1010 EVs/mL (Figure 1E).

3.2. A. fumigatus EVs Induce Lower Arginase-1 and Higher iNOS Transcription in RAW 264.7 Macrophages

Activated macrophages or M1 macrophages, which express the iNOS enzyme and produce proinflammatory mediators, are effective for killing A. fumigatus [27,28]; anti-inflammatory or M2 macrophages that express arginase 1 (Arg1) also have a phagocytic profile in an in vivo infection, but their killing capabilities have not been addressed [29]. To address the polarization status of macrophages in response to A. fumigatus EVs, we analyzed their transcriptional gene profile. AMJ2C-11 and RAW 264.7 cells were stimulated for 24 h with 1010 A. fumigatus EVs/mL. Both mRNA levels of iNOS and arginase-1 were increased in RAW 264.7 cells after incubation with A. fumigatus EVs (Figure 2A,B). Only arginase-1 had increased gene expression in AMJ2-C11 cells (Figure 2C).

3.3. A. fumigatus EVs Augment Adhesion Molecule Gene Expression in RAW 264.7 Macrophages

Optical microscopy revealed the altered morphology of RAW 264.7 cells stimulated with A. fumigatus EVs for 24 h (Figure S2). The cells displayed more dendritic-like protrusions and adhered more avidly to the flask bottom, suggesting increased production of adhesion molecules. Treatment with EVs for 6 h had no influence on CD11b or CD18 transcript levels (Figure 3A,C), while increased CD11b and CD18 expression levels were detected after 24 h stimulation (Figure 3B,D). CD11b and CD18 form the alpha and beta chain of the Macrophage-1 antigen (Mac-1), respectively, which mediates cellular adhesion and other responses [30]. The optical microscopy results were consistent with qPCR results. Regarding AMJ2-C11 cells stimulated with A. fumigatus, EVs did not display morphological changes, and CD11b and CD18 transcript levels were not altered at any time point (Figure 3E–H). Using an adhesion assay with plates coated with fibrinogen, the ligand for Mac-1 [30], we showed that RAW 264.7 macrophages stimulated with A. fumigatus EVs showed no difference between treatment with EVs and unstimulated cells (medium); both showed similar percentages of reduced Resazurin (Figure S3). LPS induced increased adhesion of RAW 264.7 cells, as demonstrated by the higher percentage of reduced Resazurin, which correlated with the attachment of more cells in the wells (Figure S3).

3.4. A. fumigatus EVs Fail to Induce NETs Release and Cytokine Production by Neutrophils

To evaluate the effect of A. fumigatus EVs on the release of neutrophil extracellular traps (NETs), neutrophils isolated from the blood of healthy donors were stimulated with A. fumigatus EVs. Flow cytometry analysis confirmed that stimulation with (PMA) as the positive control induced the release of NETs and promoted neutrophil death, a mechanism known as NETosis. Increased NETosis or the release of NETs was not evident when neutrophils were stimulated with 109 or 1010 A. fumigatus EVs/mL was compared with the negative control (Figure 4A,B). Moreover, A. fumigatus EVs did not induce IL-6 and IL-1β production by human neutrophils (Supplementary Material). The results suggest that A. fumigatus EVs neither induce NET release nor alter cytokine production by human neutrophils. We also assessed the production of IL-6, TNF-α, and IL-10 by human PBMCs treated with A. fumigatus EVs for 24 h. IL-6 secretion was increased due to 1010 EVs/mL (Figure 5A); however, EVs did not induce TNF-α or IL-10 production (Figure 5B,C).

3.5. EVs Induce Increased Survival in Galleria Mellonella Model of A. fumigatus Infection

Since A. fumigatus EVs were unable to induce a robust proinflammatory response from innate leukocytes and human PBMCs, we assessed whether A. fumigatus EVs could influence G. mellonella survival in an in vivo model of infection. G. mellonella has an immune system that, in some respects, shows similarities to the mammal innate immune system which can be used to explore the interaction of fungal pathogens and the host [31]. G. mellonella larvae were treated with 108 to 1010 A. fumigatus EVs/larvae for 48 h and were then infected with A. fumigatus conidia. In the control group (PBS-treated), all larvae were dead by day 11. In contrast, survival was greater among the treated larvae (Figure 6). Treatment with 108 or 109 EVs significantly increased the survival of G. mellonella, leading to death only by days 15 and 16; this indicates the protective effect of A. fumigatus EVs in vivo.

4. Discussion

Several biomolecules transported by EVs are related to fungal survival, virulence, and immune evasion [32]. Herein we investigated the in vitro pro- and anti-inflammatory properties of A. fumigatus EVs. A previous study by our group showed that treatment with A. flavus EVs induced the production of TNF-α, IL-6, IL-1β, and NO by bone marrow-derived macrophages (BMDMs) [19]. A. flavus EV-treated BMDMs showed an increased phagocytic index and intracellular killing abilities, which were related to an M1 macrophage polarization [19].
In this study, we used AMJ2-C11 and RAW 264.7 macrophages. AMJ2-C11 is an alveolar macrophage line. Thus, AMJ2-C11 cells would mimic the first phagocytes to interact with EVs in vivo, while RAW 264.7 macrophages would mimic the contact of EVs in a disseminated infection. Our results show a lower pro-inflammatory profile for A. fumigatus EVs compared to A. flavus EVs. Both macrophage cell lines displayed increased TNF-α production only when stimulated with the highest concentrations of EVs (109 and 1010 EVs/mL). NO production was only increased in AMJ2-C11 macrophages stimulated with the highest concentration of EVs (1010 EVs/mL). Superoxide was not induced by EVs in AMJ2-C11 cells, and a decrease was noted in RAW 264.7 cells, even when stimulated with the highest concentration of EVs compared to the control. The results suggest that A. fumigatus EVs may act differentially in both macrophage lines tested. In AMJ2-C11 alveolar macrophages derived from C57BL6J mice, EVs induced an increased expression of arginase-1 mRNA with no increased expression of iNOS mRNA. RAW 264.7 macrophages derived from the ascites of BALB/c mice displayed increased expression of arginase-1 and iNOS mRNA. Souza et al., 2019 also studied A. fumigatus EVs. They used the A. fumigatus A1163 strain grown in a YG liquid medium (yeast extract powder, glucose, and trace elements), while we have used the A. fumigatus CEA17 strain grown in a solid minimal medium. The nutrition status of the medium influences the fungal EVs’ profile. Fungal species can produce different EVs with altered size and cargo depending on growth media [33]. EVs from Histoplasma capsulatum cultured in a rich medium (supplemented Ham’s F-12) have double protein content, 18 times more sterol content, and altered protein expression when compared to a less nutritional medium such as RPMI-1640 [33]. Despite the differences in growth conditions and strain, Souza et al., 2019 showed increases in both the phagocytosis and fungal killing activities of RAW 264.7 macrophages, as well the production of TNF-α and chemokine CCL2, but not IFN-γ or IL-10 [34]. A similar response was noted when bone marrow-derived neutrophils (BMDNs) were tested, increasing phagocytosis and fungal killing but not prompting the production of TNF-α, IL-1β or IFN-γ [34]. Thus, these findings suggest that albeit the difference in the strain and culture conditions, EVs from A. fumigatus promote low pro-inflammatory cytokine production in vitro by some innate leukocytes. The production of inflammatory mediators after the interaction of A. fumigatus conidia with alveolar macrophages is necessary to convey the message to leukocytes indicating a microbe invasion. TNF-α secreted by alveolar macrophages is critical for fungal clearance [35], while NO and superoxide production within phagolysosomes are essential for fungal killing [26,27]. Secreted EVs may act as an immunomodulatory component of the invading A. fumigatus conidia. In this sense, it was demonstrated that immunization with A. fumigatus EVs could partially protect mice from fungal infection by evoking a less pronounced inflammation [36]. After the A. fumigatus conidia challenge, mice immunized with EVs displayed an immune regulatory profile in the lungs, evident as a reduced influx of inflammatory cells and primarily neutrophils and reduced vascular permeability. Furthermore, immunized animals produced fewer inflammatory cytokines in the lungs 48 h after infection, with increasing conidia phagocytosis and killing by neutrophils compared to non-immunized mice [36]. However, despite the less inflammatory profile of the EV-immunized mice, no difference in survival was observed when compared to the non-immunized ones [36]. Differing from this study, the above-mentioned study was performed using EVs from A. fumigatus strain A1163 cultivated in a liquid YG medium. Similar to the macrophage response, EVs failed to induce the production of IL-6 or IL1-β by human neutrophils. The production of TNF-α and IL-1β by BMDNs was reportedly achieved only when the cells were treated with EVs and infected by A. fumigatus in vitro [34]. The findings demonstrate a priming role for A. fumigatus EVs. Likewise, when human PBMCs were treated with EVs, only IL-6 production was induced at the highest concentration of EVs, but no increased production of TNF-α or IL-10 was noted.
Fungal EVs can modulate innate cells [15]. Candida albicans EVs can induce the production of inflammatory mediators such as IL-12p40, TNF-α, IL-6, and NO by BMDCs, BMDMs, and RAW 264.7 cells [37,38]. C. auris EVs increased the production of IL-6 by BMDC [39]. C. neoformans EVs increased the production of TNF-α, TGF-β, IL-6, and NO by RAW 264.7 macrophages [40]. P. brasiliensis EVs induce a strong proinflammatory response by murine peritoneal macrophages with the production of IL-12p40, IL-12p70, IL-6, TNF-α, IL-1α, IL-1β, and NO, which was related to an M1 macrophage polarization [18]. Similarly, T. interdigitale EVs can induce inflammatory mediators by BMDMs, which include TNF-α, IL-6, IL-1β, and NO, also displaying M1 macrophage polarization. H. capsulatum EVs impair the phagocytosis and fungal killing of stimulated BMDMs [20]. Thus, fungal EVs play different roles in activating or modulating innate responses. Our group has summarized these properties elsewhere [15].
RAW 264.7, but not AMJ2-C11 cells, stimulated with A. fumigatus EVs displayed an altered morphology with the formation of elongated protrusions, suggesting augmented expression of adhesion molecules. Indeed, we demonstrated increased mRNA levels of CD11b and CD18 integrins in EV-stimulated RAW 264.7 cells. In contrast, an adhesion assay showed no difference comparing the negative control to EV-treated cells. Due to the nature of the assay, the sensitivity may be not high enough to capture subtle changes in the expression of adhesion molecules. Therefore, further studies are necessary to definitively understand whether A. fumigatus EVs influence the expression and function of adhesion molecules.
Integrins are involved in several steps in phagocyte function. They modulate adhesion to extracellular matrix, phagocytosis, migration, and spreading [41]. An in vitro assay demonstrated that peritoneal polymorphonuclear neutrophils (PMNs) use Mac-1 or CD11b (αMβ2), while peritoneal activated macrophages use Mac-1 and complement receptor 4 (CR4) (αXβ2) to engulf and kill germinated C. albicans cells [42]. In vivo experiments with C. albicans infection demonstrated that Mac-1 is required for the elimination of invading fungi by PMNs, while CR4 is necessary for macrophage fungal killing [42]. Additionally, Mac-1 is important for the adhesion and internalization of A. fumigatus conidia into alveolar epithelial cells [43] and plays a pivotal role in NET formation by human neutrophils [44,45].
Conidia from A. fumigatus induce NET formation by human neutrophils [44,45]. In the present study, EVs failed to induce NET formation by human neutrophils. NETs released by neutrophils do not directly kill A. fumigatus [45]. However, NETs are a powerful tool to promote the control of the hyphal form of A. fumigatus by virtue of their fungistatic activity [46,47].
G. mellonella is an established invertebrate model of fungal infection, as its immune system shares some similarities with mammal innate immunity [31,48]. The G. mellonella hemolymph, which is analogous to human blood, contains hemocytes. Hemocytes are immune cells capable of many functions, including phagocytosis, nodulation, and encapsulation [49]. Accordingly, G. mellonella larvae are used to study many fungal infections [50,51,52,53,54,55]. Here we demonstrate that treatment with EVs prior to the A. fumigatus conidia infection of G. mellonella protected the larvae from early death. G. mellonella lack adaptive immunity [31]. Thus, the observed outcome must reflect the activation of hemocytes, which in turn partially protect larvae. As discussed above, Souza et al., 2022 demonstrated the EVs’ vaccinal properties from A. fumigatus in a pulmonary aspergillosis mice model, probably by engaging the adaptive arm of immunity. Our work shows that the activation of G. mellonella immune cells by A. fumigatus EVs resulted in increased larva survival, suggesting that A. fumigatus EVs could promote an immune cell activation that protects the larvae. Other fungal EVs have been used in a similar manner to study the protection conferred by these vesicles. Our group showed that treatment with A. flavus EVs resulted in a reduced CFU count and increased survival of G. mellonella larvae after A. flavus infection [19]. We observed a similar survival curve in PBS-treated larvae after A. fumigatus or a A. flavus infection, with larvae infected with A. fumigatus conidia showing slightly earlier death. Previous reports showed the opposite: in one case, A. flavus showed an increased pathogenicity in G. mellonella larvae when compared to A. fumigatus or A. nidulans [56]. Although the same number of A. flavus or A. fumigatus conidia per inoculum was used in both studies (100 conidia per larvae), in this study a much higher concentration of EVs was capable of conferring protection for the larvae after fungal infection. C. albicans EVs did not affect larva survival but significantly decreased the fungal burden of G. mellonella-infected larvae [37]. Interestingly, G. mellonella treatment with C. neoformans EVs resulted in the early death of treated larvae [57].
In summary, this work shows that A. fumigatus EVs induce a partial pro-inflammatory response by mouse macrophage lines, human neutrophils, and PBMCs. Also, A. fumigatus EVs act differently in macrophage lines, probably because those macrophages express a differential density of pattern recognition receptors. Finally, EVs protect G. mellonella larvae in an infection model, demonstrating its effects over innate cells responsible for the larvae protection. This work contributes to elucidating the inflammatory properties of EVs, which may account for the modulation of immune responses and possibly the control of infection. The understanding of initial steps in the crosstalk between A. fumigatus EVs and innate leukocytes might drive the identification of critical targets for the development of new anti-fungal therapies and adjuvants.

Supplementary Materials

The following supporting information can be downloaded at: https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/jof9050541/s1, Figure S1: EVs fail to induce the production of IL-6 and IL-1β by macrophages.; Figure S2: EVs induce membrane extended processes in RAW 264.7 macrophages.; Figure S3: EVs fail to increase macrophage adhesion.

Author Contributions

M.S.F. and F.A. conceived the study. M.S.F., F.A., T.A.B. and C.P.R. performed the experimental design. M.S.F., T.A.B., C.P.R., N.S.M. and T.d.M.H.D. performed the laboratory experiments. M.S.F. and F.A. wrote the manuscript. M.S.F., T.A.B., C.P.R., N.S.M., T.d.M.H.D., C.R.T. and F.A. contributed to the editing and preparation of the final version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Brazilian Agencies: São Paulo Research Foundation—FAPESP [2019/22454-0; 2021/06794-5]; National Council for Scientific and Technological Development—CNPq [420670/2018-1], Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—CAPES; and Fundação de Apoio ao Ensino, Pesquisa e Assistência—FAEPA.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the University Hospital, Ribeirao Preto Medical School at the University of Sao Paulo (protocol 4.277.966 approval in 8 July 2020).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Carlos Alberto Vieira for technical assistance and Luiz Ricardo Goulart Filho whose laboratory facility was used during this project and passed away due to COVID-19 complications.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Abad, A.; Fernandez-Molina, J.V.; Bikandi, J.; Ramirez, A.; Margareto, J.; Sendino, J.; Hernando, F.L.; Ponton, J.; Garaizar, J.; Rementeria, A. What makes Aspergillus fumigatus a successful pathogen? Genes and molecules involved in invasive aspergillosis. Rev. Iberoam. Micol. 2010, 27, 155–182. [Google Scholar] [CrossRef]
  2. van de Veerdonk, F.L.; Gresnigt, M.S.; Romani, L.; Netea, M.G.; Latge, J.P. Aspergillus fumigatus morphology and dynamic host interactions. Nat. Rev. Microbiol. 2017, 15, 661–674. [Google Scholar] [CrossRef]
  3. McCormick, A.; Loeffler, J.; Ebel, F. Aspergillus fumigatus: Contours of an opportunistic human pathogen. Cell. Microbiol. 2010, 12, 1535–1543. [Google Scholar] [CrossRef]
  4. Xu, S.; Shinohara, M.L. Tissue-Resident Macrophages in Fungal Infections. Front. Immunol. 2017, 8, 1798. [Google Scholar] [CrossRef] [PubMed]
  5. Chotirmall, S.H.; Al-Alawi, M.; Mirkovic, B.; Lavelle, G.; Logan, P.M.; Greene, C.M.; McElvaney, N.G. Aspergillus-associated airway disease, inflammation, and the innate immune response. BioMed Res. Int. 2013, 2013, 723129. [Google Scholar] [CrossRef]
  6. Latge, J.P.; Chamilos, G. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019, 33, e00140-18. [Google Scholar] [CrossRef]
  7. Deatherage, B.L.; Cookson, B.T. Membrane vesicle release in bacteria, eukaryotes, and archaea: A conserved yet underappreciated aspect of microbial life. Infect. Immun. 2012, 80, 1948–1957. [Google Scholar] [CrossRef]
  8. Yanez-Mo, M.; Siljander, P.R.; Andreu, Z.; Zavec, A.B.; Borras, F.E.; Buzas, E.I.; Buzas, K.; Casal, E.; Cappello, F.; Carvalho, J.; et al. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 2015, 4, 27066. [Google Scholar] [CrossRef]
  9. Albuquerque, P.C.; Nakayasu, E.S.; Rodrigues, M.L.; Frases, S.; Casadevall, A.; Zancope-Oliveira, R.M.; Almeida, I.C.; Nosanchuk, J.D. Vesicular transport in Histoplasma capsulatum: An effective mechanism for trans-cell wall transfer of proteins and lipids in ascomycetes. Cell. Microbiol. 2008, 10, 1695–1710. [Google Scholar] [CrossRef] [PubMed]
  10. Gehrmann, U.; Qazi, K.R.; Johansson, C.; Hultenby, K.; Karlsson, M.; Lundeberg, L.; Gabrielsson, S.; Scheynius, A. Nanovesicles from Malassezia sympodialis and host exosomes induce cytokine responses—Novel mechanisms for host-microbe interactions in atopic eczema. PLoS ONE 2011, 6, e21480. [Google Scholar] [CrossRef] [PubMed]
  11. Vallejo, M.C.; Matsuo, A.L.; Ganiko, L.; Medeiros, L.C.; Miranda, K.; Silva, L.S.; Freymuller-Haapalainen, E.; Sinigaglia-Coimbra, R.; Almeida, I.C.; Puccia, R. The pathogenic fungus Paracoccidioides brasiliensis exports extracellular vesicles containing highly immunogenic alpha-Galactosyl epitopes. Eukaryot. Cell 2011, 10, 343–351. [Google Scholar] [CrossRef]
  12. Silva, B.M.; Prados-Rosales, R.; Espadas-Moreno, J.; Wolf, J.M.; Luque-Garcia, J.L.; Goncalves, T.; Casadevall, A. Characterization of Alternaria infectoria extracellular vesicles. Med. Mycol. 2014, 52, 202–210. [Google Scholar] [CrossRef] [PubMed]
  13. Bitencourt, T.A.; Rezende, C.P.; Quaresemin, N.R.; Moreno, P.; Hatanaka, O.; Rossi, A.; Martinez-Rossi, N.M.; Almeida, F. Extracellular Vesicles from the Dermatophyte Trichophyton interdigitale Modulate Macrophage and Keratinocyte Functions. Front. Immunol. 2018, 9, 2343. [Google Scholar] [CrossRef] [PubMed]
  14. Ikeda, M.A.K.; de Almeida, J.R.F.; Jannuzzi, G.P.; Cronemberger-Andrade, A.; Torrecilhas, A.C.T.; Moretti, N.S.; da Cunha, J.P.C.; de Almeida, S.R.; Ferreira, K.S. Extracellular Vesicles from Sporothrix brasiliensis Are an Important Virulence Factor That Induce an Increase in Fungal Burden in Experimental Sporotrichosis. Front. Microbiol. 2018, 9, 2286. [Google Scholar] [CrossRef] [PubMed]
  15. Freitas, M.S.; Pessoni, A.M.; Coelho, C.; Bonato, V.L.D.; Rodrigues, M.L.; Casadevall, A.; Almeida, F. Interactions of Extracellular Vesicles from Pathogenic Fungi with Innate Leukocytes. Curr. Top. Microbiol. Immunol. 2021, 432, 89–120. [Google Scholar] [CrossRef]
  16. Bitencourt, T.A.; Hatanaka, O.; Pessoni, A.M.; Freitas, M.S.; Trentin, G.; Santos, P.; Rossi, A.; Martinez-Rossi, N.M.; Alves, L.L.; Casadevall, A.; et al. Fungal Extracellular Vesicles Are Involved in Intraspecies Intracellular Communication. mBio 2022, 13, e03272-21. [Google Scholar] [CrossRef]
  17. Bielska, E.; May, R.C. Extracellular vesicles of human pathogenic fungi. Curr. Opin. Microbiol. 2019, 52, 90–99. [Google Scholar] [CrossRef]
  18. Freitas, M.S.; Oliveira, A.F.; da Silva, T.A.; Fernandes, F.F.; Goncales, R.A.; Almeida, F.; Roque-Barreira, M.C. Paracoccin Induces M1 Polarization of Macrophages via Interaction with TLR4. Front. Microbiol. 2016, 7, 1003. [Google Scholar] [CrossRef]
  19. Brauer, V.S.; Pessoni, A.M.; Bitencourt, T.A.; de Paula, R.G.; de Oliveira Rocha, L.; Goldman, G.H.; Almeida, F. Extracellular Vesicles from Aspergillus flavus Induce M1 Polarization In Vitro. mSphere 2020, 5, e00190-20. [Google Scholar] [CrossRef]
  20. Baltazar, L.M.; Zamith-Miranda, D.; Burnet, M.C.; Choi, H.; Nimrichter, L.; Nakayasu, E.S.; Nosanchuk, J.D. Concentration-dependent protein loading of extracellular vesicles released by Histoplasma capsulatum after antibody treatment and its modulatory action upon macrophages. Sci. Rep. 2018, 8, 8065. [Google Scholar] [CrossRef]
  21. Green, L.C.; Wagner, D.A.; Glogowski, J.; Skipper, P.L.; Wishnok, J.S.; Tannenbaum, S.R. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 1982, 126, 131–138. [Google Scholar] [CrossRef]
  22. Wang, X.Z.; Zhang, S.Y.; Xu, Y.; Zhang, L.Y.; Jiang, Z.Z. The role of neutrophils in triptolide-induced liver injury. Chin. J. Nat. Med. 2018, 16, 653–664. [Google Scholar] [CrossRef]
  23. Huang, J.; Zhou, Q. CD8+T Cell-Related Gene Biomarkers in Macular Edema of Diabetic Retinopathy. Front. Endocrinol. 2022, 13, 907396. [Google Scholar] [CrossRef]
  24. Ip, W.K.; Medzhitov, R. Macrophages monitor tissue osmolarity and induce inflammatory response through NLRP3 and NLRC4 inflammasome activation. Nat. Commun. 2015, 6, 6931. [Google Scholar] [CrossRef]
  25. Pruchniak, M.P.; Demkow, U. Potent NETosis inducers do not show synergistic effects in vitro. Cent. Eur. J. Immunol. 2019, 44, 51–58. [Google Scholar] [CrossRef] [PubMed]
  26. Aratani, Y.; Kura, F.; Watanabe, H.; Akagawa, H.; Takano, Y.; Suzuki, K.; Dinauer, M.C.; Maeda, N.; Koyama, H. Relative contributions of myeloperoxidase and NADPH-oxidase to the early host defense against pulmonary infections with Candida albicans and Aspergillus fumigatus. Med. Mycol. 2002, 40, 557–563. [Google Scholar] [CrossRef] [PubMed]
  27. Ibrahim-Granet, O.; Philippe, B.; Boleti, H.; Boisvieux-Ulrich, E.; Grenet, D.; Stern, M.; Latge, J.P. Phagocytosis and intracellular fate of Aspergillus fumigatus conidia in alveolar macrophages. Infect. Immun. 2003, 71, 891–903. [Google Scholar] [CrossRef] [PubMed]
  28. Philippe, B.; Ibrahim-Granet, O.; Prevost, M.C.; Gougerot-Pocidalo, M.A.; Sanchez Perez, M.; Van der Meeren, A.; Latge, J.P. Killing of Aspergillus fumigatus by alveolar macrophages is mediated by reactive oxidant intermediates. Infect. Immun. 2003, 71, 3034–3042. [Google Scholar] [CrossRef]
  29. Bhatia, S.; Fei, M.; Yarlagadda, M.; Qi, Z.; Akira, S.; Saijo, S.; Iwakura, Y.; van Rooijen, N.; Gibson, G.A.; St Croix, C.M.; et al. Rapid host defense against Aspergillus fumigatus involves alveolar macrophages with a predominance of alternatively activated phenotype. PLoS ONE 2011, 6, e15943. [Google Scholar] [CrossRef]
  30. Schittenhelm, L.; Hilkens, C.M.; Morrison, V.L. beta2 Integrins As Regulators of Dendritic Cell, Monocyte, and Macrophage Function. Front. Immunol. 2017, 8, 1866. [Google Scholar] [CrossRef]
  31. Smith, D.F.Q.; Casadevall, A. Fungal immunity and pathogenesis in mammals versus the invertebrate model organism Galleria mellonella. Pathog. Dis. 2021, 79, ftab013. [Google Scholar] [CrossRef] [PubMed]
  32. Freitas, M.S.; Bonato, V.L.D.; Pessoni, A.M.; Rodrigues, M.L.; Casadevall, A.; Almeida, F. Fungal Extracellular Vesicles as Potential Targets for Immune Interventions. mSphere 2019, 4, e00747-19. [Google Scholar] [CrossRef] [PubMed]
  33. Cleare, L.G.; Zamith, D.; Heyman, H.M.; Couvillion, S.P.; Nimrichter, L.; Rodrigues, M.L.; Nakayasu, E.S.; Nosanchuk, J.D. Media matters! Alterations in the loading and release of Histoplasma capsulatum extracellular vesicles in response to different nutritional milieus. Cell. Microbiol. 2020, 22, e13217. [Google Scholar] [CrossRef] [PubMed]
  34. Souza, J.A.M.; Baltazar, L.M.; Carregal, V.M.; Gouveia-Eufrasio, L.; de Oliveira, A.G.; Dias, W.G.; Campos Rocha, M.; Rocha de Miranda, K.; Malavazi, I.; Santos, D.A.; et al. Characterization of Aspergillus fumigatus Extracellular Vesicles and Their Effects on Macrophages and Neutrophils Functions. Front. Microbiol. 2019, 10, 2008. [Google Scholar] [CrossRef]
  35. Phadke, A.P.; Mehrad, B. Cytokines in host defense against Aspergillus: Recent advances. Med. Mycol. 2005, 43 (Suppl. S1), S173–S176. [Google Scholar] [CrossRef]
  36. Souza, J.A.M.; Gurgel, I.; Malacco, N.; Martins, F.R.B.; Queiroz-Junior, C.M.; Teixeira, M.M.; Soriani, F.M. Pre-Exposure with Extracellular Vesicles from Aspergillus fumigatus Attenuates Inflammatory Response and Enhances Fungal Clearance in a Murine Model Pulmonary Aspergillosis. Front. Cell. Infect. Microbiol. 2022, 12, 898619. [Google Scholar] [CrossRef]
  37. Vargas, G.; Rocha, J.D.; Oliveira, D.L.; Albuquerque, P.C.; Frases, S.; Santos, S.S.; Nosanchuk, J.D.; Gomes, A.M.; Medeiros, L.C.; Miranda, K.; et al. Compositional and immunobiological analyses of extracellular vesicles released by Candida albicans. Cell. Microbiol. 2015, 17, 389–407. [Google Scholar] [CrossRef]
  38. Vargas, G.; Honorato, L.; Guimaraes, A.J.; Rodrigues, M.L.; Reis, F.C.G.; Vale, A.M.; Ray, A.; Nosanchuk, J.D.; Nimrichter, L. Protective effect of fungal extracellular vesicles against murine candidiasis. Cell. Microbiol. 2020, 22, e13238. [Google Scholar] [CrossRef] [PubMed]
  39. Zamith-Miranda, D.; Heyman, H.M.; Couvillion, S.P.; Cordero, R.J.B.; Rodrigues, M.L.; Nimrichter, L.; Casadevall, A.; Amatuzzi, R.F.; Alves, L.R.; Nakayasu, E.S.; et al. Comparative Molecular and Immunoregulatory Analysis of Extracellular Vesicles from Candida albicans and Candida auris. mSystems 2021, 6, e00822-21. [Google Scholar] [CrossRef]
  40. Oliveira, D.L.; Freire-de-Lima, C.G.; Nosanchuk, J.D.; Casadevall, A.; Rodrigues, M.L.; Nimrichter, L. Extracellular vesicles from Cryptococcus neoformans modulate macrophage functions. Infect. Immun. 2010, 78, 1601–1609. [Google Scholar] [CrossRef]
  41. Brown, E.J. Integrins of Macrophages and Macrophage-Like Cells. In The Macrophage as Therapeutic Target; Gordon, S., Ed.; Springer: Berlin/Heidelberg, Germany, 2003; pp. 111–130. [Google Scholar]
  42. Jawhara, S.; Pluskota, E.; Cao, W.; Plow, E.F.; Soloviev, D.A. Distinct Effects of Integrins αXβ2 and αMβ2 on Leukocyte Subpopulations during Inflammation and Antimicrobial Responses. Infect. Immun. 2017, 85, e00644-16. [Google Scholar] [CrossRef] [PubMed]
  43. Han, X.; Su, X.; Li, Z.; Liu, Y.; Wang, S.; Zhu, M.; Zhang, C.; Yang, F.; Zhao, J.; Li, X.; et al. Complement receptor 3 mediates Aspergillus fumigatus internalization into alveolar epithelial cells with the increase of intracellular phosphatidic acid by activating FAK. Virulence 2021, 12, 1980–1996. [Google Scholar] [CrossRef]
  44. Silva, J.C.; Rodrigues, N.C.; Thompson-Souza, G.A.; Muniz, V.S.; Neves, J.S.; Figueiredo, R.T. Mac-1 triggers neutrophil DNA extracellular trap formation to Aspergillus fumigatus independently of PAD4 histone citrullination. J. Leukoc. Biol. 2020, 107, 69–83. [Google Scholar] [CrossRef] [PubMed]
  45. Gazendam, R.P.; van Hamme, J.L.; Tool, A.T.; Hoogenboezem, M.; van den Berg, J.M.; Prins, J.M.; Vitkov, L.; van de Veerdonk, F.L.; van den Berg, T.K.; Roos, D.; et al. Human Neutrophils Use Different Mechanisms to Kill Aspergillus fumigatus Conidia and Hyphae: Evidence from Phagocyte Defects. J. Immunol. 2016, 196, 1272–1283. [Google Scholar] [CrossRef] [PubMed]
  46. Urban, C.F.; Nett, J.E. Neutrophil extracellular traps in fungal infection. Semin. Cell Dev. Biol. 2019, 89, 47–57. [Google Scholar] [CrossRef] [PubMed]
  47. McCormick, A.; Heesemann, L.; Wagener, J.; Marcos, V.; Hartl, D.; Loeffler, J.; Heesemann, J.; Ebel, F. NETs formed by human neutrophils inhibit growth of the pathogenic mold Aspergillus fumigatus. Microbes Infect. 2010, 12, 928–936. [Google Scholar] [CrossRef]
  48. Borman, A.M. Of mice and men and larvae: Galleria mellonella to model the early host-pathogen interactions after fungal infection. Virulence 2018, 9, 9–12. [Google Scholar] [CrossRef]
  49. Pereira, T.C.; de Barros, P.P.; Fugisaki, L.R.O.; Rossoni, R.D.; Ribeiro, F.C.; de Menezes, R.T.; Junqueira, J.C.; Scorzoni, L. Recent Advances in the Use of Galleria mellonella Model to Study Immune Responses against Human Pathogens. J. Fungi 2018, 4, 128. [Google Scholar] [CrossRef]
  50. Slater, J.L.; Gregson, L.; Denning, D.W.; Warn, P.A. Pathogenicity of Aspergillus fumigatus mutants assessed in Galleria mellonella matches that in mice. Med. Mycol. 2011, 49 (Suppl. S1), S107–S113. [Google Scholar] [CrossRef] [PubMed]
  51. Thomaz, L.; Garcia-Rodas, R.; Guimaraes, A.J.; Taborda, C.P.; Zaragoza, O.; Nosanchuk, J.D. Galleria mellonella as a model host to study Paracoccidioides lutzii and Histoplasma capsulatum. Virulence 2013, 4, 139–146. [Google Scholar] [CrossRef] [PubMed]
  52. Scorzoni, L.; de Paula e Silva, A.C.; Singulani Jde, L.; Leite, F.S.; de Oliveira, H.C.; da Silva, R.A.; Fusco-Almeida, A.M.; Mendes-Giannini, M.J. Comparison of virulence between Paracoccidioides brasiliensis and Paracoccidioides lutzii using Galleria mellonella as a host model. Virulence 2015, 6, 766–776. [Google Scholar] [CrossRef]
  53. Coleman, J.J.; Muhammed, M.; Kasperkovitz, P.V.; Vyas, J.M.; Mylonakis, E. Fusarium pathogenesis investigated using Galleria mellonella as a heterologous host. Fungal Biol. 2011, 115, 1279–1289. [Google Scholar] [CrossRef]
  54. Firacative, C.; Duan, S.; Meyer, W. Galleria mellonella model identifies highly virulent strains among all major molecular types of Cryptococcus gattii. PLoS ONE 2014, 9, e105076. [Google Scholar] [CrossRef] [PubMed]
  55. Bouklas, T.; Diago-Navarro, E.; Wang, X.; Fenster, M.; Fries, B.C. Characterization of the virulence of Cryptococcus neoformans strains in an insect model. Virulence 2015, 6, 809–813. [Google Scholar] [CrossRef] [PubMed]
  56. St Leger, R.J.; Screen, S.E.; Shams-Pirzadeh, B. Lack of host specialization in Aspergillus flavus. Appl. Environ. Microbiol. 2000, 66, 320–324. [Google Scholar] [CrossRef] [PubMed]
  57. Colombo, A.C.; Rella, A.; Normile, T.; Joffe, L.S.; Tavares, P.M.; de S. Araújo, G.R.; Frases, S.; Orner, E.P.; Farnoud, A.M.; Fries, B.C.; et al. Cryptococcus neoformans Glucuronoxylomannan and Sterylglucoside Are Required for Host Protection in an Animal Vaccination Model. mBio 2019, 10, e02909-18. [Google Scholar] [CrossRef]
Jof 09 00541 g001 550
Figure 1. Production of inflammatory mediators by macrophages stimulated with EVs. AMJ2-C11 and RAW 264.7 macrophages were stimulated with EVs (107 to 1010 EVs/mL) for 24 h. For AMJ2-C11 macrophages, TNF-α (A), O2•− (B), and NO (C) were measured in the supernatant. For RAW 264.7 macrophages, TNF-α (D) and O2•− (E) were measured. The results are expressed as mean ± SEM and were compared to medium through one-way analysis of variance followed by Dunnett’s test. **** p < 0.0001, *** p < 0.001, ** p < 0.01 and * p < 0.05.
Figure 1. Production of inflammatory mediators by macrophages stimulated with EVs. AMJ2-C11 and RAW 264.7 macrophages were stimulated with EVs (107 to 1010 EVs/mL) for 24 h. For AMJ2-C11 macrophages, TNF-α (A), O2•− (B), and NO (C) were measured in the supernatant. For RAW 264.7 macrophages, TNF-α (D) and O2•− (E) were measured. The results are expressed as mean ± SEM and were compared to medium through one-way analysis of variance followed by Dunnett’s test. **** p < 0.0001, *** p < 0.001, ** p < 0.01 and * p < 0.05.
Jof 09 00541 g001
Jof 09 00541 g002 550
Figure 2. RAW 264.7 macrophages, but not AMJ2-C11, display polarization toward an M1 profile after stimulation with EVs. After 24 h of stimulation with 1010 EVs/mL, mRNA was extracted from AMJ2-C11 and RAW 264.7 macrophages. qPCR was performed to assess the expression of polarization signature genes. Panels A and B show the relative expression of arginase-1 (A) and iNOS (B) of RAW 264.7 macrophages. Panel (C) shows the relative expression of arginase-1 in AMJ2-C11 macrophages after 24 h of treatment. The results are expressed as mean ± SEM and were compared to the medium through an unpaired two-tailed t test. T test. **** p < 0.0001, ** p < 0.01 and * p < 0.05.
Figure 2. RAW 264.7 macrophages, but not AMJ2-C11, display polarization toward an M1 profile after stimulation with EVs. After 24 h of stimulation with 1010 EVs/mL, mRNA was extracted from AMJ2-C11 and RAW 264.7 macrophages. qPCR was performed to assess the expression of polarization signature genes. Panels A and B show the relative expression of arginase-1 (A) and iNOS (B) of RAW 264.7 macrophages. Panel (C) shows the relative expression of arginase-1 in AMJ2-C11 macrophages after 24 h of treatment. The results are expressed as mean ± SEM and were compared to the medium through an unpaired two-tailed t test. T test. **** p < 0.0001, ** p < 0.01 and * p < 0.05.
Jof 09 00541 g002
Jof 09 00541 g003 550
Figure 3. RAW 264.7 macrophages, but not AMJ2-C11, show increased mRNA levels in adhesion molecules after stimulation with EVs. AMJ2-C11 and RAW 264.7 cells were treated with 1010 EVs/mL for 6 and 24 h. The relative expression of CD11b and CD18 was assessed by qPCR. The relative expression of CD11b and CD18 after 6 and 24h of treatment in RAW 264.7 cells is shown in panels (A–D). The relative expression of CD11b and CD18 after 6 and 24 h of treatment in AMJ2-C11 cells is shown in panels (E–H). The results are expressed as mean ± SEM and were compared to the medium through an unpaired two-tailed t test. T test. **** p < 0.0001, *** p < 0.001, ** p < 0.01, and * p < 0.05.
Figure 3. RAW 264.7 macrophages, but not AMJ2-C11, show increased mRNA levels in adhesion molecules after stimulation with EVs. AMJ2-C11 and RAW 264.7 cells were treated with 1010 EVs/mL for 6 and 24 h. The relative expression of CD11b and CD18 was assessed by qPCR. The relative expression of CD11b and CD18 after 6 and 24h of treatment in RAW 264.7 cells is shown in panels (A–D). The relative expression of CD11b and CD18 after 6 and 24 h of treatment in AMJ2-C11 cells is shown in panels (E–H). The results are expressed as mean ± SEM and were compared to the medium through an unpaired two-tailed t test. T test. **** p < 0.0001, *** p < 0.001, ** p < 0.01, and * p < 0.05.
Jof 09 00541 g003
Jof 09 00541 g004 550
Figure 4. EVs do not induce NETosis in human neutrophils. Human neutrophils were stimulated with EVs or phorbol myristate acetate (PMA). Representative dot plot of neutrophils stimulated with PMA (positive control) or 109 or 1010 EVs/mL (A). Percentage of live cells (FVS780−Sytox−), dead cells (FVS780+Sytox−), NETs (FVS780−Sytox+), and NETosis (FVS780+Sytox+) (B). Data are representative of three experiments (n = 9/group) and are expressed as mean ± SD. * p < 0.05; ** p < 0.001.
Figure 4. EVs do not induce NETosis in human neutrophils. Human neutrophils were stimulated with EVs or phorbol myristate acetate (PMA). Representative dot plot of neutrophils stimulated with PMA (positive control) or 109 or 1010 EVs/mL (A). Percentage of live cells (FVS780−Sytox−), dead cells (FVS780+Sytox−), NETs (FVS780−Sytox+), and NETosis (FVS780+Sytox+) (B). Data are representative of three experiments (n = 9/group) and are expressed as mean ± SD. * p < 0.05; ** p < 0.001.
Jof 09 00541 g004
Jof 09 00541 g005 550
Figure 5. EVs induce the release of IL-6 by human PBMCs. PBMCs (2 × 105 cells/well) were stimulated with 109 or 1010 EVs/mL for 24 h. The production of IL-6 (A), TNF-α (B), and IL-10 (C) was measured in the supernatant. The results are expressed as mean ± SEM and were compared to the medium through one-way analysis of variance followed by Dunnett’s test. **** p < 0.0001, *** p < 0.001, and * p < 0.05.
Figure 5. EVs induce the release of IL-6 by human PBMCs. PBMCs (2 × 105 cells/well) were stimulated with 109 or 1010 EVs/mL for 24 h. The production of IL-6 (A), TNF-α (B), and IL-10 (C) was measured in the supernatant. The results are expressed as mean ± SEM and were compared to the medium through one-way analysis of variance followed by Dunnett’s test. **** p < 0.0001, *** p < 0.001, and * p < 0.05.
Jof 09 00541 g005
Jof 09 00541 g006 550
Figure 6. Treatment of G. mellonella with EVs increases larvae survival after fungal challenge. G. mellonella larvae were treated with 108, 109, or 1010 EVs. After 48 h, each larva was infected with 100 conidia of A. fumigatus. Larva survival was assessed daily until all larvae were dead. Log rank (Mantel–Cox) test for survival curve analysis. **** p < 0.0001, * p < 0.05. The PBS-injected-only group were injected with 57 µL of PBS in the last left proleg; after 48 h, 10 µL of PBS was injected at the same site, and mortality was recorded.
Figure 6. Treatment of G. mellonella with EVs increases larvae survival after fungal challenge. G. mellonella larvae were treated with 108, 109, or 1010 EVs. After 48 h, each larva was infected with 100 conidia of A. fumigatus. Larva survival was assessed daily until all larvae were dead. Log rank (Mantel–Cox) test for survival curve analysis. **** p < 0.0001, * p < 0.05. The PBS-injected-only group were injected with 57 µL of PBS in the last left proleg; after 48 h, 10 µL of PBS was injected at the same site, and mortality was recorded.
Jof 09 00541 g006
Table
Table 1. Primers used in qPCR.
Table 1. Primers used in qPCR.
GeneSequence 5′–3′Concentration (nM)Efficiency (%)Ref.
iNOS2FWD: CCGAAGCAAACATCACATTCA
REV: GGTCTAAAGGCTCCGGGCT		70110.11[18]
arginase-1FWD: GTTCCCAGATGTACCAGGATTC
REV: CGATGTCTTTGGCAGATATGC		10099.33[18]
CD11bFWD: TACTTCGGGCAGTCTCTGAGTG
REV: ATGGTTGCCTCCAGTCTCAGCA		30094[22]
CD18FWD: CTTTCCGAGAGCAACATCCAGC
REV: GTTGCTGGAGTCGTCAGACAGT		300105.5[23]
GapdhFWD: GGTGCTGAGTATGTCGTGGA
REV: CGGAGATGATGACCCTTTTG		300108.76[24]
The term efficiency (%) is related to the efficiency of the qPCR reaction, considering the kinetics of the reaction, assuming a twofold increase in amplicon in each cycle for 100% efficiency. In general, PCR efficiency should be 90–110% for target and normalizing genes, which ensures accurate quantification. To verify this information, a standard curve was performed using two-fold serial dilutions; the reaction efficiency for each pair of primers is provided within the table.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Freitas, M.S.; Bitencourt, T.A.; Rezende, C.P.; Martins, N.S.; Dourado, T.d.M.H.; Tirapelli, C.R.; Almeida, F. Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages. J. Fungi 2023, 9, 541. https://0-doi-org.brum.beds.ac.uk/10.3390/jof9050541

AMA Style

Freitas MS, Bitencourt TA, Rezende CP, Martins NS, Dourado TdMH, Tirapelli CR, Almeida F. Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages. Journal of Fungi. 2023; 9(5):541. https://0-doi-org.brum.beds.ac.uk/10.3390/jof9050541

Chicago/Turabian Style

Freitas, Mateus Silveira, Tamires Aparecida Bitencourt, Caroline Patini Rezende, Nubia Sabrina Martins, Thales de Mileto Henrique Dourado, Carlos R. Tirapelli, and Fausto Almeida. 2023. "Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages" Journal of Fungi 9, no. 5: 541. https://0-doi-org.brum.beds.ac.uk/10.3390/jof9050541

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop