Activation of Innate Immunity by Therapeutic Nucleic Acids
Abstract
:1. Introduction
2. Recognition of Nucleic Acids and Immunostimulation
2.1. Ligands and Receptors
2.2. Sequence Dependent Immunostimulation
Type | Sequence 5′–3′ | Length n/bp | Effects | Reference |
---|---|---|---|---|
G4-CpG | GGGGTTGTCGTTTTGTCGTTGGGGTTGTCGTTTTGTCGTTGGGGTTGTCGTTTTGTCGTTGGGG | 64 | Forms G-quadruplex; induces IL-6 | [65] |
CpG ODN | AACGTTGTCGTCGACGTCGTCGTC | 24 | Reduces viability of human bladder cancer cells (UM-UC-3 and T24) | [61] |
1826-CpG | TCCATGACGTTCCTGACGTT | 20 | Induces apoptosis in A20 lymphoma cells, but not as effective as KSK-CpG | [62] |
KSK-CpG | TCGTCGTTTTCGTCGTCGTTTT | 22 | Decreases mitochondrial membrane potential; induces apoptosis in A20 lymphoma cells | [62] |
ssRNA40 from HIV-1 genome | GCCCGUCUGUUGUGUGACUC | 20 | Induces TNF-α secretion in mice | [70] |
ssRNA120 SARS-CoV genome | GUCUGAGUGUGUUCUUG | 17 | Induces TNF-α secretion in mice; induces pro-inflammatory cytokine release in hPBMCs | [70] |
ssRNA83 SARS-CoV genome | GUGCUUGUGUAUUGUGC | 17 | Induces TNF alpha release in mice | [70] |
ssRNA-DR | GCCCGACAGAAGAGAGACAC | 20 | Activates TLR 7/8 | [78] |
short dsRNA | GUGUCAGGCUUUCAGAUUUUUU/ AAAUCUGAAAGCCUGACACUUA | 22 | Has antiproliferative effect against tumor cells | [73,74] |
1826 CpG SNA | TCCATGACGTTCCTGACGTT | 20 | Decreases growth rate of cancer cells; activates innate immune cells in vivo | [79] |
2.3. Sequence-Independent Immunostimulation
PRR | Location | Ligands | Signaling | Reference |
---|---|---|---|---|
TLR 3 | Endosome | long dsRNA (minimum length 40–50 bp); poly (I:C) | TRIF-dependent | [34] |
TLR 7 | Endosome | ssRNA with preference for 3-mers with U located in second position | MyD88-dependent | [107] |
TLR 8 | Endosome | ssRNA with preference for UG dinucleotides | MyD88-dependent | [34] |
TLR 9 | Endosome | non-methylated CpG DNA; spherical nucleic acids containing CpG motifs | MyD88-dependent | [58,108] |
RIG-I | Cytosol | short dsRNA and ssRNA with 5′-triphosphate; circRNA | MAVS-dependent | [43,49] |
MDA5 | Cytosol | long dsRNA; poly (I:C) | MAVS-dependent | [43,109] |
2.4. Signaling Pathways
3. Challenges and Further Studies
3.1. Immunostimulating Nucleic Acids in Cancer Therapy
3.2. Nucleic Acid-Based Vaccines and Adjuvants
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Miao, L.; Zhang, Y.; Huang, L. MRNA Vaccine for Cancer Immunotherapy. Mol. Cancer 2021, 20, 41. [Google Scholar] [CrossRef]
- Long, B.; Brém, E.; Koyfman, A. Oncologic Emergencies: Immune-Based Cancer Therapies and Complications. West. J. Emerg. Med. 2020, 21, 566–580. [Google Scholar] [CrossRef]
- Bagchi, S.; Yuan, R.; Engleman, E.G. Immune Checkpoint Inhibitors for the Treatment of Cancer: Clinical Impact and Mechanisms of Response and Resistance. Annu. Rev. Pathol. 2021, 16, 223–249. [Google Scholar] [CrossRef]
- Christofi, T.; Baritaki, S.; Falzone, L.; Libra, M.; Zaravinos, A. Current Perspectives in Cancer Immunotherapy. Cancers 2019, 11, 1472. [Google Scholar] [CrossRef] [Green Version]
- Posner, J.; Barrington, P.; Brier, T.; Datta-Mannan, A. Monoclonal Antibodies: Past, Present and Future. Handb. Exp. Pharmacol. 2019, 260, 81–141. [Google Scholar] [CrossRef] [PubMed]
- Mullard, A. FDA Approves 100th Monoclonal Antibody Product. Nat. Rev. Drug Discov. 2021, 20, 491–495. [Google Scholar] [CrossRef]
- Baldo, B.A. Side Effects of Cytokines Approved for Therapy. Drug Saf. 2014, 37, 921–943. [Google Scholar] [CrossRef]
- Berraondo, P.; Sanmamed, M.F.; Ochoa, M.C.; Etxeberria, I.; Aznar, M.A.; Pérez-Gracia, J.L.; Rodríguez-Ruiz, M.E.; Ponz-Sarvise, M.; Castañón, E.; Melero, I. Cytokines in Clinical Cancer Immunotherapy. Br. J. Cancer 2019, 120, 6–15. [Google Scholar] [CrossRef] [Green Version]
- Mian, M.F.; Ahmed, A.N.; Rad, M.; Babaian, A.; Bowdish, D.; Ashkar, A.A. Length of DsRNA (Poly I:C) Drives Distinct Innate Immune Responses, Depending on the Cell Type. J. Leukoc. Biol. 2013, 94, 1025–1036. [Google Scholar] [CrossRef] [PubMed]
- Kabilova, T.; Shmendel, E.; Gladkikh, D.; Morozova, N.; Maslov, M.; Chernolovskaya, E.; Vlassov, V.; Zenkova, M. Novel PEGylated Liposomes Enhance Immunostimulating Activity of IsRNA. Mol. Basel Switz. 2018, 23, 3101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kabilova, T.O.; Sen’kova, A.V.; Nikolin, V.P.; Popova, N.A.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Antitumor and Antimetastatic Effect of Small Immunostimulatory RNA against B16 Melanoma in Mice. PloS ONE 2016, 11, e0150751. [Google Scholar] [CrossRef]
- Durymanov, M.; Reineke, J. Non-Viral Delivery of Nucleic Acids: Insight Into Mechanisms of Overcoming Intracellular Barriers. Front. Pharmacol. 2018, 9, 971. [Google Scholar] [CrossRef] [Green Version]
- Peng, L.; Wagner, E. Polymeric Carriers for Nucleic Acid Delivery: Current Designs and Future Directions. Biomacromolecules 2019, 20, 3613–3626. [Google Scholar] [CrossRef] [PubMed]
- Torres-Vanegas, J.D.; Cruz, J.C.; Reyes, L.H. Delivery Systems for Nucleic Acids and Proteins: Barriers, Cell Capture Pathways and Nanocarriers. Pharmaceutics 2021, 13, 428. [Google Scholar] [CrossRef]
- Jang, J.-H.; Shin, H.W.; Lee, J.M.; Lee, H.-W.; Kim, E.-C.; Park, S.H. An Overview of Pathogen Recognition Receptors for Innate Immunity in Dental Pulp. Mediators Inflamm. 2015, 2015, e794143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Liang, C. Innate Recognition of Microbial-Derived Signals in Immunity and Inflammation. Sci. China Life Sci. 2016, 59, 1210–1217. [Google Scholar] [CrossRef] [Green Version]
- Hou, S.; Liu, Z.; Shen, H.; Wu, D. Damage-Associated Molecular Pattern-Triggered Immunity in Plants. Front. Plant Sci. 2019, 10, 646. [Google Scholar] [CrossRef]
- Schlee, M.; Hornung, V.; Hartmann, G. SiRNA and IsRNA: Two Edges of One Sword. Mol. Ther. 2006, 14, 463–470. [Google Scholar] [CrossRef]
- Roh, J.S.; Sohn, D.H. Damage-Associated Molecular Patterns in Inflammatory Diseases. Immune Netw. 2018, 18. [Google Scholar] [CrossRef] [PubMed]
- Maverakis, E.; Kim, K.; Shimoda, M.; Gershwin, M.E.; Patel, F.; Wilken, R.; Raychaudhuri, S.; Ruhaak, L.R.; Lebrilla, C.B. Glycans In The Immune System and The Altered Glycan Theory of Autoimmunity: A Critical Review. J. Autoimmun. 2015, 57, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gardella, S.; Andrei, C.; Ferrera, D.; Lotti, L.V.; Torrisi, M.R.; Bianchi, M.E.; Rubartelli, A. The Nuclear Protein HMGB1 Is Secreted by Monocytes via a Non-Classical, Vesicle-Mediated Secretory Pathway. EMBO Rep. 2002, 3, 995–1001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belkaid, Y.; Hand, T. Role of the Microbiota in Immunity and Inflammation. Cell 2014, 157, 121–141. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, A.; Tait, S.W.G. Targeting Immunogenic Cell Death in Cancer. Mol. Oncol. 2020, 14, 2994–3006. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zhou, Q.; Xu, W.; Cai, Y.; Yin, Z.; Gao, X.; Xiong, S. DNA-Dependent Activator of Interferon-Regulatory Factors (DAI) Promotes Lupus Nephritis by Activating the Calcium Pathway. J. Biol. Chem. 2013, 288, 13534–13550. [Google Scholar] [CrossRef] [Green Version]
- Le Naour, J.; Galluzzi, L.; Zitvogel, L.; Kroemer, G.; Vacchelli, E. Trial Watch: TLR3 Agonists in Cancer Therapy. Oncoimmunology 2020, 9, 1771143. [Google Scholar] [CrossRef]
- Komura, F.; Takahashi, Y.; Inoue, T.; Takakura, Y.; Nishikawa, M. Development of a Nanostructured RNA/DNA Assembly as an Adjuvant Targeting Toll-Like Receptor 7/8. Nucleic Acid Ther. 2019, 29, 335–342. [Google Scholar] [CrossRef]
- Leifer, C.A.; Medvedev, A.E. Molecular Mechanisms of Regulation of Toll-like Receptor Signaling. J. Leukoc. Biol. 2016, 100, 927–941. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, M.; Funami, K.; Oshiumi, H.; Seya, T. Chapter Eighteen - Toll-IL-1-Receptor-Containing Adaptor Molecule-1: A Signaling Adaptor Linking Innate Immunity to Adaptive Immunity. In Progress in Molecular Biology and Translational Science; Giraldo, J., Ciruela, F., Eds.; Oligomerization in Health and Disease; Academic Press: Cambridge, MA, USA, 2013; Volume 117, pp. 487–510. [Google Scholar]
- Sallusto, F.; Lanzavecchia, A. The Instructive Role of Dendritic Cells on T-Cell Responses. Arthritis Res. 2002, 4 (Suppl. 3), S127–132. [Google Scholar] [CrossRef] [PubMed]
- Delneste, Y.; Beauvillain, C.; Jeannin, P. Innate immunity: Structure and function of TLRs. Med. Sci. 2007, 23, 67–73. [Google Scholar] [CrossRef] [Green Version]
- Alexopoulou, L.; Holt, A.C.; Medzhitov, R.; Flavell, R.A. Recognition of Double-Stranded RNA and Activation of NF-KappaB by Toll-like Receptor 3. Nature 2001, 413, 732–738. [Google Scholar] [CrossRef]
- Leonard, J.N.; Ghirlando, R.; Askins, J.; Bell, J.K.; Margulies, D.H.; Davies, D.R.; Segal, D.M. The TLR3 Signaling Complex Forms by Cooperative Receptor Dimerization. Proc. Natl. Acad. Sci. USA 2008, 105, 258–263. [Google Scholar] [CrossRef] [Green Version]
- Hu, T.; Suter, S.R.; Mumbleau, M.M.; Beal, P.A. TLR8 Activation and Inhibition by Guanosine Analogs in RNA: Importance of Functional Groups and Chain Length. Bioorg. Med. Chem. 2018, 26, 77–83. [Google Scholar] [CrossRef] [PubMed]
- Ohto, U.; Shimizu, T. Structural Aspects of Nucleic Acid-Sensing Toll-like Receptors. Biophys. Rev. 2016, 8, 33–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, Z.; Tanji, H.; Jiang, S.; Zhang, S.; Koo, K.; Chan, J.; Sakaniwa, K.; Ohto, U.; Candia, A.; Shimizu, T.; et al. Small-Molecule TLR8 Antagonists via Structure-Based Rational Design. Cell Chem. Biol. 2018, 25, 1286–1291.e3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanji, H.; Ohto, U.; Shibata, T.; Taoka, M.; Yamauchi, Y.; Isobe, T.; Miyake, K.; Shimizu, T. Toll-like Receptor 8 Senses Degradation Products of Single-Stranded RNA. Nat. Struct. Mol. Biol. 2015, 22, 109–115. [Google Scholar] [CrossRef]
- Kawasaki, T.; Kawai, T. Chapter One—Discrimination Between Self and Non-Self-Nucleic Acids by the Innate Immune System. In International Review of Cell and Molecular Biology; Vanpouille-Box, C., Galluzzi, L., Eds.; Nucleic Acid Sensing and Immunity, Part A; Academic Press: Cambridge, MA, USA, 2019; Volume 344, pp. 1–30. [Google Scholar]
- Ohto, U.; Shibata, T.; Tanji, H.; Ishida, H.; Krayukhina, E.; Uchiyama, S.; Miyake, K.; Shimizu, T. Structural Basis of CpG and Inhibitory DNA Recognition by Toll-like Receptor 9. Nature 2015, 520, 702–705. [Google Scholar] [CrossRef]
- Ohto, U.; Ishida, H.; Shibata, T.; Sato, R.; Miyake, K.; Shimizu, T. Toll-like Receptor 9 Contains Two DNA Binding Sites That Function Cooperatively to Promote Receptor Dimerization and Activation. Immunity 2018, 48, 649–658.e4. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.; Lu, Y.; Thulasi Raman, S.N.; Xu, F.; Wu, Q.; Li, Z.; Brownlie, R.; Liu, Q.; Zhou, Y. Nuclear-Resident RIG-I Senses Viral Replication Inducing Antiviral Immunity. Nat. Commun. 2018, 9, 3199. [Google Scholar] [CrossRef]
- Pippig, D.A.; Hellmuth, J.C.; Cui, S.; Kirchhofer, A.; Lammens, K.; Lammens, A.; Schmidt, A.; Rothenfusser, S.; Hopfner, K.-P. The Regulatory Domain of the RIG-I Family ATPase LGP2 Senses Double-Stranded RNA. Nucleic Acids Res. 2009, 37, 2014–2025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brisse, M.; Ly, H. Comparative Structure and Function Analysis of the RIG-I-Like Receptors: RIG-I and MDA5. Front. Immunol. 2019, 10, 1586. [Google Scholar] [CrossRef]
- Onomoto, K.; Onoguchi, K.; Yoneyama, M. Regulation of RIG-I-like Receptor-Mediated Signaling: Interaction between Host and Viral Factors. Cell. Mol. Immunol. 2021, 18, 539–555. [Google Scholar] [CrossRef] [PubMed]
- Bruns, A.M.; Horvath, C.M. LGP2 Synergy with MDA5 in RLR-Mediated RNA Recognition and Antiviral Signaling. Cytokine 2015, 74, 198–206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- David, R.Y.S.; Combredet, C.; Najburg, V.; Millot, G.A.; Beauclair, G.; Schwikowski, B.; Léger, T.; Camadro, J.-M.; Jacob, Y.; Bellalou, J.; et al. LGP2 Binds to PACT to Regulate RIG-I– and MDA5-Mediated Antiviral Responses. Sci. Signal. 2019, 12. [Google Scholar] [CrossRef]
- Nasirudeen, A.M.A.; Wong, H.H.; Thien, P.; Xu, S.; Lam, K.-P.; Liu, D.X. RIG-I, MDA5 and TLR3 Synergistically Play an Important Role in Restriction of Dengue Virus Infection. PLoS Negl. Trop. Dis. 2011, 5, e926. [Google Scholar] [CrossRef]
- Sanchez David, R.Y.; Combredet, C.; Sismeiro, O.; Dillies, M.-A.; Jagla, B.; Coppée, J.-Y.; Mura, M.; Guerbois Galla, M.; Despres, P.; Tangy, F.; et al. Comparative Analysis of Viral RNA Signatures on Different RIG-I-like Receptors. eLife 2016, 5, e11275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anchisi, S.; Guerra, J.; Garcin, D. RIG-I ATPase Activity and Discrimination of Self-RNA versus Non-Self-RNA. mBio 2015, 6, e02349-14. [Google Scholar] [CrossRef]
- Goubau, D.; Schlee, M.; Deddouche, S.; Pruijssers, A.J.; Zillinger, T.; Goldeck, M.; Schuberth, C.; Van der Veen, A.G.; Fujimura, T.; Rehwinkel, J.; et al. Antiviral Immunity via RIG-I-Mediated Recognition of RNA Bearing 5’-Diphosphates. Nature 2014, 514, 372–375. [Google Scholar] [CrossRef] [Green Version]
- Ren, X.; Linehan, M.M.; Iwasaki, A.; Pyle, A.M. RIG-I Selectively Discriminates against 5′-Monophosphate RNA. Cell Rep. 2019, 26, 2019–2027.e4. [Google Scholar] [CrossRef] [Green Version]
- Dias Junior, A.G.; Sampaio, N.G.; Rehwinkel, J. A Balancing Act: MDA5 in Antiviral Immunity and Autoinflammation. Trends Microbiol. 2019, 27, 75–85. [Google Scholar] [CrossRef] [Green Version]
- Wu, B.; Peisley, A.; Richards, C.; Yao, H.; Zeng, X.; Lin, C.; Chu, F.; Walz, T.; Hur, S. Structural Basis for DsRNA Recognition, Filament Formation, and Antiviral Signal Activation by MDA5. Cell 2013, 152, 276–289. [Google Scholar] [CrossRef] [Green Version]
- Kabilova, T.O.; Meschaninova, M.I.; Venyaminova, A.G.; Nikolin, V.P.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Short Double-Stranded RNA with Immunostimulatory Activity: Sequence Dependence. Nucleic Acid Ther. 2012, 22, 196–204. [Google Scholar] [CrossRef]
- Vollmer, J.; Weeratna, R.; Payette, P.; Jurk, M.; Schetter, C.; Laucht, M.; Wader, T.; Tluk, S.; Liu, M.; Davis, H.L.; et al. Characterization of Three CpG Oligodeoxynucleotide Classes with Distinct Immunostimulatory Activities. Eur. J. Immunol. 2004, 34, 251–262. [Google Scholar] [CrossRef]
- Halpern, M.D.; Kurlander, R.J.; Pisetsky, D.S. Bacterial DNA Induces Murine Interferon-γ Production by Stimulation of Interleukin-12 and Tumor Necrosis Factor-α. Cell. Immunol. 1996, 167, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Krieg, A.M.; Yi, A.K.; Matson, S.; Waldschmidt, T.J.; Bishop, G.A.; Teasdale, R.; Koretzky, G.A.; Klinman, D.M. CpG Motifs in Bacterial DNA Trigger Direct B-Cell Activation. Nature 1995, 374, 546–549. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.E.; Borde, C.; Rocha, E.P.C.; Mériaux, V.; Maréchal, V.; Escoll, P.; Goyard, S.; Cavaillon, J.-M.; Manoury, B.; Doyen, N. TLR9 Activation Is Triggered by the Excess of Stimulatory versus Inhibitory Motifs Present in Trypanosomatidae DNA. PLoS Negl. Trop. Dis. 2014, 8, e3308. [Google Scholar] [CrossRef]
- Zhang, Z.; Guo, K.; Schluesener, H.J. The Immunostimulatory Activity of CpG Oligonucleotides on Microglial N9 Cells Is Affected by a Polyguanosine Motif. J. Neuroimmunol. 2005, 161, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Rothenfusser, S.; Tuma, E.; Wagner, M.; Endres, S.; Hartmann, G. Recent Advances in Immunostimulatory CpG Oligonucleotides. Curr. Opin. Mol. Ther. 2003, 5, 98–106. [Google Scholar]
- Salem, A.K.; Weiner, G.J. CpG Oligonucleotides as Immunotherapeutic Adjuvants: Innovative Applications and Delivery Strategies. Adv. Drug Deliv. Rev. 2009, 61, 193–194. [Google Scholar] [CrossRef] [Green Version]
- Luo, Y.; Fu, X.; Ru, R.; Han, B.; Zhang, F.; Yuan, L.; Men, H.; Zhang, S.; Tian, S.; Dong, B.; et al. CpG Oligodeoxynucleotides Induces Apoptosis of Human Bladder Cancer Cells via Caspase-3-Bax/Bcl-2-P53 Axis. Arch. Med. Res. 2020, 51, 233–244. [Google Scholar] [CrossRef]
- Qi, X.-F.; Zheng, L.; Kim, C.-S.; Lee, K.-J.; Kim, D.-H.; Cai, D.-Q.; Qin, J.-W.; Yu, Y.-H.; Wu, Z.; Kim, S.-K. CpG Oligodeoxynucleotide Induces Apoptosis and Cell Cycle Arrest in A20 Lymphoma Cells via TLR9-Mediated Pathways. Mol. Immunol. 2013, 54, 327–337. [Google Scholar] [CrossRef]
- Largy, E.; Mergny, J.-L.; Gabelica, V. Role of Alkali Metal Ions in G-Quadruplex Nucleic Acid Structure and Stability. Met. Ions Life Sci. 2016, 16, 203–258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartmann, G.; Krieg, A.M. Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells. J. Immunol. Baltim. Md 1950 2000, 164, 944–953. [Google Scholar] [CrossRef]
- Hoshi, K.; Yamazaki, T.; Sugiyama, Y.; Tsukakoshi, K.; Tsugawa, W.; Sode, K.; Ikebukuro, K. G-Quadruplex Structure Improves the Immunostimulatory Effects of CpG Oligonucleotides. Nucleic Acid Ther. 2019, 29, 224–229. [Google Scholar] [CrossRef]
- Zamore, P.D.; Tuschl, T.; Sharp, P.A.; Bartel, D.P. RNAi: Double-Stranded RNA Directs the ATP-Dependent Cleavage of MRNA at 21 to 23 Nucleotide Intervals. Cell 2000, 101, 25–33. [Google Scholar] [CrossRef] [Green Version]
- Meng, Z.; Lu, M. RNA Interference-Induced Innate Immunity, Off-Target Effect, or Immune Adjuvant? Front. Immunol. 2017, 8, 331. [Google Scholar] [CrossRef] [Green Version]
- Robbins, M.; Judge, A.; Maclachlan, I. SiRNA and Innate Immunity. Oligonucleotides 2009, 19, 89–102. [Google Scholar] [CrossRef]
- Schlender, J.; Hornung, V.; Finke, S.; Günthner-Biller, M.; Marozin, S.; Brzózka, K.; Moghim, S.; Endres, S.; Hartmann, G.; Conzelmann, K.-K. Inhibition of Toll-like Receptor 7- and 9-Mediated Alpha/Beta Interferon Production in Human Plasmacytoid Dendritic Cells by Respiratory Syncytial Virus and Measles Virus. J. Virol. 2005, 79, 5507–5515. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Chen, M.; Cao, H.; Zhu, Y.; Zheng, J.; Zhou, H. Extraordinary GU-Rich Single-Strand RNA Identified from SARS Coronavirus Contributes an Excessive Innate Immune Response. Microbes Infect. 2013, 15, 88–95. [Google Scholar] [CrossRef]
- Poeck, H.; Besch, R.; Maihoefer, C.; Renn, M.; Tormo, D.; Morskaya, S.S.; Kirschnek, S.; Gaffal, E.; Landsberg, J.; Hellmuth, J.; et al. 5’-Triphosphate-SiRNA: Turning Gene Silencing and Rig-I Activation against Melanoma. Nat. Med. 2008, 14, 1256–1263. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Qian, Y.; Yan, F.; Tu, J.; Yang, X.; Xing, Y.; Chen, Z. 5’-Triphosphate-SiRNA Activates RIG-I-Dependent Type I Interferon Production and Enhances Inhibition of Hepatitis B Virus Replication in HepG2.2.15 Cells. Eur. J. Pharmacol. 2013, 721, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Species-Specific Recognition of Single-Stranded RNA via Toll-like Receptor 7 and 8. Science 2004, 303, 1526–1529. [Google Scholar] [CrossRef] [Green Version]
- Mansoori, B.; Mohammadi, A.; Shir Jang, S.; Baradaran, B. Mechanisms of Immune System Activation in Mammalians by Small Interfering RNA (SiRNA). Artif. Cells Nanomedicine Biotechnol. 2016, 44, 1589–1596. [Google Scholar] [CrossRef] [Green Version]
- Goncharova, E.P.; Sen‘kova, A.V.; Savin, I.A.; Kabilova, T.O.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Immunostimulating RNA Delivered by P1500 PEGylated Cationic Liposomes Limits Influenza Infection in C57Bl/6 Mice. Pharmaceutics 2020, 12, 875. [Google Scholar] [CrossRef] [PubMed]
- Sen, G.; Flora, M.; Chattopadhyay, G.; Klinman, D.M.; Lees, A.; Mond, J.J.; Snapper, C.M. The Critical DNA Flanking Sequences of a CpG Oligodeoxynucleotide, but Not the 6 Base CpG Motif, Can Be Replaced with RNA without Quantitative or Qualitative Changes in Toll-like Receptor 9-Mediated Activity. Cell. Immunol. 2004, 232, 64–74. [Google Scholar] [CrossRef] [PubMed]
- Barnaby, S.N.; Perelman, G.A.; Kohlstedt, K.L.; Chinen, A.B.; Schatz, G.C.; Mirkin, C.A. Design Considerations for RNA Spherical Nucleic Acids (SNAs). Bioconjug. Chem. 2016, 27, 2124–2131. [Google Scholar] [CrossRef]
- Guan, C.; Chernyak, N.; Dominguez, D.; Cole, L.; Zhang, B.; Mirkin, C.A. RNA-Based Immunostimulatory Liposomal Spherical Nucleic Acids as Potent TLR7/8 Modulators. Small Weinh. Bergstr. Ger. 2018, 14, e1803284. [Google Scholar] [CrossRef]
- Radovic-Moreno, A.F.; Chernyak, N.; Mader, C.C.; Nallagatla, S.; Kang, R.S.; Hao, L.; Walker, D.A.; Halo, T.L.; Merkel, T.J.; Rische, C.H.; et al. Immunomodulatory Spherical Nucleic Acids. Proc. Natl. Acad. Sci. USA 2015, 112, 3892–3897. [Google Scholar] [CrossRef] [Green Version]
- Choi, C.H.J.; Hao, L.; Narayan, S.P.; Auyeung, E.; Mirkin, C.A. Mechanism for the Endocytosis of Spherical Nucleic Acid Nanoparticle Conjugates. Proc. Natl. Acad. Sci. USA 2013, 110, 7625–7630. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kortylewski, M.; Swiderski, P.; Herrmann, A.; Wang, L.; Kowolik, C.; Kujawski, M.; Lee, H.; Scuto, A.; Liu, Y.; Yang, C.; et al. In Vivo Delivery of SiRNA to Immune Cells by Conjugation to a TLR9 Agonist Enhances Antitumor Immune Responses. Nat. Biotechnol. 2009, 27, 925–932. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rampersad, S.; Tennant, P. Replication and Expression Strategies of Viruses. Viruses 2018, 55–82. [Google Scholar] [CrossRef]
- Fortier, M.-E.; Kent, S.; Ashdown, H.; Poole, S.; Boksa, P.; Luheshi, G.N. The Viral Mimic, Polyinosinic:Polycytidylic Acid, Induces Fever in Rats via an Interleukin-1-Dependent Mechanism. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2004, 287, R759–R766. [Google Scholar] [CrossRef] [Green Version]
- Mitchell, W.M. Efficacy of Rintatolimod in the Treatment of Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME). Expert Rev. Clin. Pharmacol. 2016, 9, 755–770. [Google Scholar] [CrossRef] [Green Version]
- Jin, B.; Sun, T.; Yu, X.-H.; Liu, C.-Q.; Yang, Y.-X.; Lu, P.; Fu, S.-F.; Qiu, H.-B.; Yeo, A.E.T. Immunomodulatory Effects of DsRNA and Its Potential as Vaccine Adjuvant. J. Biomed. Biotechnol. 2010, 2010, e690438. [Google Scholar] [CrossRef] [PubMed]
- Akimov, I.A.; Kabilova, T.O.; Vlassov, V.V.; Chernolovskaya, E.L. Inhibition of Human Cancer-Cell Proliferation by Long Double-Stranded RNAs. Oligonucleotides 2009, 19, 31–40. [Google Scholar] [CrossRef]
- Silin, D.S.; Lyubomska, O.V.; Ershov, F.I.; Frolov, V.M.; Kutsyna, G.A. Synthetic and Natural Immunomodulators Acting as Interferon Inducers. Curr. Pharm. Des. 2009, 15, 1238–1247. [Google Scholar] [CrossRef] [PubMed]
- Schlee, M.; Roth, A.; Hornung, V.; Hagmann, C.A.; Wimmenauer, V.; Barchet, W.; Coch, C.; Janke, M.; Mihailovic, A.; Wardle, G.; et al. Recognition of 5′ Triphosphate by RIG-I Helicase Requires Short Blunt Double-Stranded RNA as Contained in Panhandle of Negative-Strand Virus. Immunity 2009, 31, 25–34. [Google Scholar] [CrossRef] [Green Version]
- Hornung, V.; Ellegast, J.; Kim, S.; Brzózka, K.; Jung, A.; Kato, H.; Poeck, H.; Akira, S.; Conzelmann, K.-K.; Schlee, M.; et al. 5’-Triphosphate RNA Is the Ligand for RIG-I. Science 2006, 314, 994–997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kato, H.; Takeuchi, O.; Mikamo-Satoh, E.; Hirai, R.; Kawai, T.; Matsushita, K.; Hiiragi, A.; Dermody, T.S.; Fujita, T.; Akira, S. Length-Dependent Recognition of Double-Stranded Ribonucleic Acids by Retinoic Acid-Inducible Gene-I and Melanoma Differentiation-Associated Gene 5. J. Exp. Med. 2008, 205, 1601–1610. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Fujita, T. Cytoplasmic Viral RNA Sensors: RIG-I-Like Receptors. Encycl. Immunobiol. 2016, 352–359. [Google Scholar] [CrossRef]
- Kobayashi, T.; Chappell, J.D.; Danthi, P.; Dermody, T.S. Gene-Specific Inhibition of Reovirus Replication by RNA Interference. J. Virol. 2006, 80, 9053–9063. [Google Scholar] [CrossRef] [Green Version]
- Venkataraman, T.; Valdes, M.; Elsby, R.; Kakuta, S.; Caceres, G.; Saijo, S.; Iwakura, Y.; Barber, G.N. Loss of DExD/H Box RNA Helicase LGP2 Manifests Disparate Antiviral Responses. J. Immunol. 2007, 178, 6444–6455. [Google Scholar] [CrossRef]
- Saito, T.; Gale, M. Differential Recognition of Double-Stranded RNA by RIG-I–like Receptors in Antiviral Immunity. J. Exp. Med. 2008, 205, 1523–1527. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.G.; Chen, R.; Ahmad, S.; Verma, R.; Kasturi, S.; Amaya, L.; Broughton, J.P.; Kim, J.; Cadena, C.; Pulendran, B.; et al. N6-Methyladenosine Modification Controls Circular RNA Immunity. Mol. Cell 2019, 76, 96–109.e9. [Google Scholar] [CrossRef] [PubMed]
- Takaoka, A.; Wang, Z.; Choi, M.K.; Yanai, H.; Negishi, H.; Ban, T.; Lu, Y.; Miyagishi, M.; Kodama, T.; Honda, K.; et al. DAI (DLM-1/ZBP1) Is a Cytosolic DNA Sensor and an Activator of Innate Immune Response. Nature 2007, 448, 501–505. [Google Scholar] [CrossRef]
- Bürckstümmer, T.; Baumann, C.; Blüml, S.; Dixit, E.; Dürnberger, G.; Jahn, H.; Planyavsky, M.; Bilban, M.; Colinge, J.; Bennett, K.L.; et al. An Orthogonal Proteomic-Genomic Screen Identifies AIM2 as a Cytoplasmic DNA Sensor for the Inflammasome. Nat. Immunol. 2009, 10, 266–272. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, B.J.; Mansur, D.S.; Peters, N.E.; Ren, H.; Smith, G.L. DNA-PK Is a DNA Sensor for IRF-3-Dependent Innate Immunity. eLife 2012, 1, e00047. [Google Scholar] [CrossRef]
- Li, K.; Qu, S.; Chen, X.; Wu, Q.; Shi, M. Promising Targets for Cancer Immunotherapy: TLRs, RLRs, and STING-Mediated Innate Immune Pathways. Int. J. Mol. Sci. 2017, 18, 404. [Google Scholar] [CrossRef]
- Simpson, S.R.; Hemphill, W.O.; Hudson, T.; Perrino, F.W. TREX1—Apex Predator of Cytosolic DNA Metabolism. DNA Repair 2020, 94, 102894. [Google Scholar] [CrossRef]
- Ahn, J.; Ruiz, P.; Barber, G.N. Intrinsic Self-DNA Triggers Inflammatory Disease Dependent on STING. J. Immunol. 2014, 193, 4634–4642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahn, J.; Xia, T.; Capote, A.R.; Betancourt, D.; Barber, G.N. Extrinsic Phagocyte-Dependent STING-Signaling Dictates the Immunogenicity of Dying Cells. Cancer Cell 2018, 33, 862–873.e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dhanwani, R.; Takahashi, M.; Sharma, S. Cytosolic Sensing of Immuno-Stimulatory DNA, the Enemy Within. Curr. Opin. Immunol. 2018, 50, 82–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burdette, D.L.; Vance, R.E. STING and the Innate Immune Response to Nucleic Acids in the Cytosol. Nat. Immunol. 2013, 14, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Sun, L.; Chen, Z.J. Regulation and Function of the CGAS–STING Pathway of Cytosolic DNA Sensing. Nat. Immunol. 2016, 17, 1142–1149. [Google Scholar] [CrossRef]
- West, A.P.; Khoury-Hanold, W.; Staron, M.; Tal, M.C.; Pineda, C.M.; Lang, S.M.; Bestwick, M.; Duguay, B.A.; Raimundo, N.; MacDuff, D.A.; et al. Mitochondrial DNA Stress Primes the Antiviral Innate Immune Response. Nature 2015, 520, 553–557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diebold, S.S.; Kaisho, T.; Hemmi, H.; Akira, S.; Reis e Sousa, C. Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA. Science 2004, 303, 1529–1531. [Google Scholar] [CrossRef]
- Hoebe, K.; Janssen, E.M.; Kim, S.O.; Alexopoulou, L.; Flavell, R.A.; Han, J.; Beutler, B. Upregulation of Costimulatory Molecules Induced by Lipopolysaccharide and Double-Stranded RNA Occurs by Trif-Dependent and Trif-Independent Pathways. Nat. Immunol. 2003, 4, 1223–1229. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. The Role of Pattern-Recognition Receptors in Innate Immunity: Update on Toll-like Receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Kawasaki, T.; Kawai, T. Toll-Like Receptor Signaling Pathways. Front. Immunol. 2014, 5, 461. [Google Scholar] [CrossRef] [Green Version]
- Takeda, K.; Akira, S. TLR Signaling Pathways. Semin. Immunol. 2004, 16, 3–9. [Google Scholar] [CrossRef]
- DeFranco, A.L. Signaling Pathways Downstream of TLRs and IL-1 Family Receptors. In Encyclopedia of Immunobiology; Ratcliffe, M.J.H., Ed.; Academic Press: Oxford, UK, 2016; pp. 106–114. ISBN 978-0-08-092152-5. [Google Scholar]
- Zhang, J.; Clark, K.; Lawrence, T.; Peggie, M.W.; Cohen, P. An Unexpected Twist to the Activation of IKKβ: TAK1 Primes IKKβ for Activation by Autophosphorylation. Biochem. J. 2014, 461, 531–537. [Google Scholar] [CrossRef] [Green Version]
- Matsumiya, T.; Stafforini, D.M. Function and Regulation of Retinoic Acid-Inducible Gene-I. Crit. Rev. Immunol. 2010, 30, 489–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barber, G.N. STING: Infection, Inflammation and Cancer. Nat. Rev. Immunol. 2015, 15, 760–770. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Wu, J.; Du, F.; Xu, H.; Sun, L.; Chen, Z.; Brautigam, C.A.; Zhang, X.; Chen, Z.J. The Cytosolic DNA Sensor CGAS Forms An Oligomeric Complex with DNA and Undergoes Switch-like Conformational Changes in the Activation Loop. Cell Rep. 2014, 6, 421–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, J.; Sun, L.; Chen, X.; Du, F.; Shi, H.; Chen, C.; Chen, Z.J. Cyclic-GMP-AMP Is An Endogenous Second Messenger in Innate Immune Signaling by Cytosolic DNA. Science 2013, 339, 10.1126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishikawa, H.; Barber, G.N. STING Is an Endoplasmic Reticulum Adaptor That Facilitates Innate Immune Signalling. Nature 2008, 455, 674–678. [Google Scholar] [CrossRef] [PubMed]
- Ablasser, A.; Goldeck, M.; Cavlar, T.; Deimling, T.; Witte, G.; Röhl, I.; Hopfner, K.-P.; Ludwig, J.; Hornung, V. CGAS Produces a 2′-5′-Linked Cyclic Dinucleotide Second Messenger That Activates STING. Nature 2013, 498, 380–384. [Google Scholar] [CrossRef] [Green Version]
- Zhong, B.; Yang, Y.; Li, S.; Wang, Y.-Y.; Li, Y.; Diao, F.; Lei, C.; He, X.; Zhang, L.; Tien, P.; et al. The Adaptor Protein MITA Links Virus-Sensing Receptors to IRF3 Transcription Factor Activation. Immunity 2008, 29, 538–550. [Google Scholar] [CrossRef] [Green Version]
- Sun, W.; Li, Y.; Chen, L.; Chen, H.; You, F.; Zhou, X.; Zhou, Y.; Zhai, Z.; Chen, D.; Jiang, Z. ERIS, an Endoplasmic Reticulum IFN Stimulator, Activates Innate Immune Signaling through Dimerization. Proc. Natl. Acad. Sci. USA 2009, 106, 8653–8658. [Google Scholar] [CrossRef] [Green Version]
- Ishikawa, H.; Ma, Z.; Barber, G.N. STING Regulates Intracellular DNA-Mediated, Type I Interferon-Dependent Innate Immunity. Nature 2009, 461, 788–792. [Google Scholar] [CrossRef] [Green Version]
- Barber, G.N. STING-Dependent Cytosolic DNA Sensing Pathways. Trends Immunol. 2014, 35, 88–93. [Google Scholar] [CrossRef]
- Tanaka, Y.; Chen, Z.J. STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway. Sci. Signal. 2012, 5, ra20. [Google Scholar] [CrossRef] [Green Version]
- Sun, W.; Shi, Q.; Zhang, H.; Yang, K.; Ke, Y.; Wang, Y.; Qiao, L. Advances in the Techniques and Methodologies of Cancer Gene Therapy. Discov. Med. 2019, 27, 45–55. [Google Scholar]
- Hager, S.; Fittler, F.J.; Wagner, E.; Bros, M. Nucleic Acid-Based Approaches for Tumor Therapy. Cells 2020, 9, 2061. [Google Scholar] [CrossRef] [PubMed]
- Shah, N.N.; Fry, T.J. Mechanisms of Resistance to CAR T Cell Therapy. Nat. Rev. Clin. Oncol. 2019, 16, 372–385. [Google Scholar] [CrossRef]
- Ginn, S.L.; Amaya, A.K.; Alexander, I.E.; Edelstein, M.; Abedi, M.R. Gene Therapy Clinical Trials Worldwide to 2017: An Update. J. Gene Med. 2018, 20, e3015. [Google Scholar] [CrossRef] [PubMed]
- Dunn, G.P.; Bruce, A.T.; Ikeda, H.; Old, L.J.; Schreiber, R.D. Cancer Immunoediting: From Immunosurveillance to Tumor Escape. Nat. Immunol. 2002, 3, 991–998. [Google Scholar] [CrossRef]
- Kraehenbuehl, L.; Weng, C.-H.; Eghbali, S.; Wolchok, J.D.; Merghoub, T. Enhancing Immunotherapy in Cancer by Targeting Emerging Immunomodulatory Pathways. Nat. Rev. Clin. Oncol. 2021, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Smith, M.; García-Martínez, E.; Pitter, M.R.; Fucikova, J.; Spisek, R.; Zitvogel, L.; Kroemer, G.; Galluzzi, L. Trial Watch: Toll-like Receptor Agonists in Cancer Immunotherapy. Oncoimmunology 2018, 7, e1526250. [Google Scholar] [CrossRef]
- Majer, O.; Liu, B.; Barton, G.M. Nucleic Acid-Sensing TLRs: Trafficking and Regulation. Curr. Opin. Immunol. 2017, 44, 26–33. [Google Scholar] [CrossRef] [Green Version]
- Liao, W.; Tan, M.; Kusamori, K.; Takakura, Y.; Nishikawa, M. Construction of Monomeric and Dimeric G-Quadruplex-Structured CpG Oligodeoxynucleotides for Enhanced Uptake and Activation in TLR9-Positive Macrophages. Nucleic Acid Ther. 2020, 30, 299–311. [Google Scholar] [CrossRef]
- Martínez-Campos, C.; Burguete-García, A.I.; Madrid-Marina, V. Role of TLR9 in Oncogenic Virus-Produced Cancer. Viral Immunol. 2017, 30, 98–105. [Google Scholar] [CrossRef]
- Adamus, T.; Kortylewski, M. The Revival of CpG Oligonucleotide-Based Cancer Immunotherapies. Contemp. Oncol. Poznan Pol. 2018, 22, 56–60. [Google Scholar] [CrossRef] [PubMed]
- Frank-Bertoncelj, M.; Pisetsky, D.S.; Kolling, C.; Michel, B.A.; Gay, R.E.; Jüngel, A.; Gay, S. TLR3 Ligand Poly(I:C) Exerts Distinct Actions in Synovial Fibroblasts When Delivered by Extracellular Vesicles. Front. Immunol. 2018, 9, 28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bianchi, F.; Pretto, S.; Tagliabue, E.; Balsari, A.; Sfondrini, L. Exploiting Poly(I:C) to Induce Cancer Cell Apoptosis. Cancer Biol. Ther. 2017, 18, 747–756. [Google Scholar] [CrossRef] [Green Version]
- Levine, A.S.; Sivulich, M.; Wiernik, P.H.; Levy, H.B. Initial Clinical Trials in Cancer Patients of Polyriboinosinic-Polyribocytidylic Acid Stabilized with Poly-L-Lysine, in Carboxymethylcellulose [Poly(ICLC)], a Highly Effective Interferon Inducer. Cancer Res. 1979, 39, 1645–1650. [Google Scholar] [PubMed]
- Patchett, A.L.; Tovar, C.; Corcoran, L.M.; Lyons, A.B.; Woods, G.M. The Toll-like Receptor Ligands Hiltonol® (PolyICLC) and Imiquimod Effectively Activate Antigen-Specific Immune Responses in Tasmanian Devils (Sarcophilus Harrisii). Dev. Comp. Immunol. 2017, 76, 352–360. [Google Scholar] [CrossRef]
- Khairuddin, N.; Gantier, M.P.; Blake, S.J.; Wu, S.Y.; Behlke, M.A.; Williams, B.R.; McMillan, N.A. SiRNA-Induced Immunostimulation through TLR7 Promotes Antitumoral Activity against HPV-Driven Tumors in Vivo. Immunol. Cell Biol. 2012, 90, 187–196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zharkov, M.I.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Molecular Mechanism of the Antiproliferative Activity of Short Immunostimulating DsRNA. Front. Oncol. 2019, 9, 1454. [Google Scholar] [CrossRef] [Green Version]
- Anz, D.; Koelzer, V.H.; Moder, S.; Thaler, R.; Schwerd, T.; Lahl, K.; Sparwasser, T.; Besch, R.; Poeck, H.; Hornung, V.; et al. Immunostimulatory RNA Blocks Suppression by Regulatory T Cells. J. Immunol. 2010, 184, 939–946. [Google Scholar] [CrossRef]
- Stewart, C.R.; Karpala, A.J.; Lowther, S.; Lowenthal, J.W.; Bean, A.G. Immunostimulatory Motifs Enhance Antiviral SiRNAs Targeting Highly Pathogenic Avian Influenza H5N1. PLoS ONE 2011, 6, e21552. [Google Scholar] [CrossRef] [PubMed]
- Kabilova, T.O.; Kovtonyuk, L.V.; Zonov, E.V.; Ryabchikova, E.I.; Popova, N.A.; Nikolin, V.P.; Kaledin, V.I.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Immunotherapy of Hepatocellular Carcinoma with Small Double-Stranded RNA. BMC Cancer 2014, 14, 338. [Google Scholar] [CrossRef] [Green Version]
- Manetti, R.; Annunziato, F.; Tomasevic, L.; Giannò, V.; Parronchi, P.; Romagnani, S.; Maggi, E. Polyinosinic Acid: Polycytidylic Acid Promotes T Helper Type 1-Specific Immune Responses by Stimulating Macrophage Production of Interferon-Alpha and Interleukin-12. Eur. J. Immunol. 1995, 25, 2656–2660. [Google Scholar] [CrossRef]
- Anisman, H.; Zaharia, M.D.; Meaney, M.J.; Merali, Z. Do Early-Life Events Permanently Alter Behavioral and Hormonal Responses to Stressors? Int. J. Dev. Neurosci. Off. J. Int. Soc. Dev. Neurosci. 1998, 16, 149–164. [Google Scholar] [CrossRef]
- Dinarello, C.A. Thermoregulation and the Pathogenesis of Fever. Infect. Dis. Clin. N. Am. 1996, 10, 433–449. [Google Scholar] [CrossRef]
- Evans, S.S.; Repasky, E.A.; Fisher, D.T. Fever and the Thermal Regulation of Immunity: The Immune System Feels the Heat. Nat. Rev. Immunol. 2015, 15, 335–349. [Google Scholar] [CrossRef] [PubMed]
- Kozak, W.; Wrotek, S.; Kozak, A. Pyrogenicity of CpG-DNA in Mice: Role of Interleukin-6, Cyclooxygenases, and Nuclear Factor-KappaB. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 290, R871–880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Homan, E.R.; Zendzian, R.P.; Schott, L.D.; Levy, H.B.; Adamson, R.H. Studies on Poly I:C Toxicity in Experimental Animals. Toxicol. Appl. Pharmacol. 1972, 23, 579–588. [Google Scholar] [CrossRef]
- Wynn, T.A.; Ramalingam, T.R. Mechanisms of Fibrosis: Therapeutic Translation for Fibrotic Disease. Nat. Med. 2012, 18, 1028–1040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katoh, M. Multi-layered Prevention and Treatment of Chronic Inflammation, Organ Fibrosis and Cancer Associated with Canonical WNT/Β-catenin Signaling Activation (Review). Int. J. Mol. Med. 2018, 42, 713–725. [Google Scholar] [CrossRef]
- Jain, S.; Suklabaidya, S.; Das, B.; Raghav, S.K.; Batra, S.K.; Senapati, S. TLR4 Activation by Lipopolysaccharide Confers Survival Advantage to Growth Factor Deprived Prostate Cancer Cells. Prostate 2015, 75, 1020–1033. [Google Scholar] [CrossRef]
- Wu, Y.; Zhou, B.P. Inflammation: A Driving Force Speeds Cancer Metastasis. Cell Cycle Georget. Tex 2009, 8, 3267–3273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bastola, R.; Noh, G.; Keum, T.; Bashyal, S.; Seo, J.-E.; Choi, J.; Oh, Y.; Cho, Y.; Lee, S. Vaccine Adjuvants: Smart Components to Boost the Immune System. Arch. Pharm. Res. 2017, 40, 1238–1248. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Xia, F.; Chen, H.; Cui, B.; Feng, Y.; Zhang, P.; Chen, J.; Luo, M. A Guide to Nucleic Acid Vaccines in the Prevention and Treatment of Infectious Diseases and Cancers: From Basic Principles to Current Applications. Front. Cell Dev. Biol. 2021, 9, 830. [Google Scholar] [CrossRef] [PubMed]
- Pulendran, B.S. Arunachalam, P.; O’Hagan, D.T. Emerging Concepts in the Science of Vaccine Adjuvants. Nat. Rev. Drug Discov. 2021, 20, 454–475. [Google Scholar] [CrossRef]
- Weide, B.; Pascolo, S.; Scheel, B.; Derhovanessian, E.; Pflugfelder, A.; Eigentler, T.K.; Pawelec, G.; Hoerr, I.; Rammensee, H.-G.; Garbe, C. Direct Injection of Protamine-Protected MRNA: Results of a Phase 1/2 Vaccination Trial in Metastatic Melanoma Patients. J. Immunother. Hagerstown Md. 1997 2009, 32, 498–507. [Google Scholar] [CrossRef]
No. | Interventions | Conditions | Phase | Status | NCT Number |
---|---|---|---|---|---|
1 | CpG-STAT3 siRNA CAS3/SS3 radiation therapy | Recurrent non-Hodgkin’s lymphoma | Phase 1 | Recruiting | NCT04995536 |
2 | Anti-OX40 antibody BMS 986,178 TLR9 agonist SD-101 | Solid neoplasms | Phase 1 | Active | NCT03831295 |
3 | Peptide vaccine GM-CSF TLR9 agonist PF3512676 | Stage III–IV melanoma | Phase 1 | Completed | NCT00471471 |
4 | Synthetic immunostimulatory DNA conjugated to ragweed allergen | Seasonal allergic rhinitis | Phase 2 | Completed | NCT00346086 |
5 | CpG-ODN in situ release of tumor antigen by interventional ablation or drug-eluting beads | Lung cancer, hepatocellular carcinoma, solid tumors | Phase 1 | Recruiting | NCT04952272 |
6 | TLR9 agonist MGN1703 | HIV | Phase 1 Phase 2 | Completed | NCT02443935 |
7 | TLR9 agonist GNKG168 | Leukemia | Phase 1 | Terminated | NCT01035216 |
8 | CpG-ODN | Glioblastoma | Phase 2 | Completed | NCT00190424 |
9 | Na-GST-1/Alhydrogel® CpG 10104 | Hookworm disease | Phase 1 | Completed | NCT02143518 |
10 | 1018 ISS (CpG ODN) irinotecan cetuximab | Colorectal neoplasms | Phase 1 | Terminated | NCT00403052 |
11 | 1018 ISS (CpG ODN) Hepatitis B vaccine (recombinant) | Hepatitis B | Phase 1 | Completed | NCT00426712 |
12 | IMO-2055 (CpG ODN) | Renal cell carcinoma | Phase 2 | Completed | NCT00729053 |
No. | Intervention | Condition | Phase | Status | NCT Number |
---|---|---|---|---|---|
1 | Viral Vector Vaccine Encoding Avian Influenza H5N1 Hemagglutinin Protein and dsRNA Adjuvan (ND1.1) | Avian influenza | Phase 1 | Completed | NCT01335347 |
2 | Adenoviral-Vector Based Seasonal Influenza A Vaccine and dsRNA Adjuvant (VXA-A1.1) | Influenza | Phase 1 Phase 1 Phase 2 | Completed Completed Completed | NCT01688297 NCT03121339 NCT02918006 |
3 | Adenoviral-Vector Based Norovirus Vaccine Expressing GI.1 VP1 and dsRNA Adjuvant (VXA-G1.1-NN) | Norovirus gastroenteritis | Phase 1 Phase 1 (high dose) | Completed Completed | NCT03125473 NCT02868073 |
4 | Adenoviral-Vector Based RSV F Protein Vaccine and dsRNA Adjuvant (VXA-RSV-f) | Respiratory syncytial virus (RSV) | Phase 1 | Completed | NCT02830932 |
5 | Adenoviral-Vector Based Vaccine Expressing a SARS-CoV-2 Antigen and dsRNA Adjuvant (VXA-CoV2-1) | COVID-19 | Phase 1 Phase 2 Phase 2 (w/Isotretinoin) Phase 3 (w/Isotretinoin) | Active Recruiting Not yet recruiting Not yet recruiting | NCT04563702 NCT05067933 NCT04577378 NCT04353180 |
6 | Hiltonol (poly ICLC—Poly(I:C) stabilized with polylysine and carboxymethylcellulose) | Healthy volunteers | Phase 1 | Completed | NCT01012700 |
7 | NY-ESO-1 protein; poly-ICLC; montanide | Melanoma | Phase 1 Phase 2 | Completed Active | NCT01079741 NCT02334735 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bishani, A.; Chernolovskaya, E.L. Activation of Innate Immunity by Therapeutic Nucleic Acids. Int. J. Mol. Sci. 2021, 22, 13360. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413360
Bishani A, Chernolovskaya EL. Activation of Innate Immunity by Therapeutic Nucleic Acids. International Journal of Molecular Sciences. 2021; 22(24):13360. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413360
Chicago/Turabian StyleBishani, Ali, and Elena L. Chernolovskaya. 2021. "Activation of Innate Immunity by Therapeutic Nucleic Acids" International Journal of Molecular Sciences 22, no. 24: 13360. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413360