Next Article in Journal
PsnWRKY70 Negatively Regulates NaHCO3 Tolerance in Populus
Next Article in Special Issue
Human Osteoblast-Conditioned Media Can Influence Staphylococcus aureus Biofilm Formation
Previous Article in Journal
Biological Cover Mitigates Disruption of the Dermal Structure in Mechanically Expanded Skin in a Porcine Model
Previous Article in Special Issue
Antibiofilm Properties of Antiseptic Agents Used on Pseudomonas aeruginosa Isolated from Diabetic Foot Ulcers
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 21
10.3390/ijms232113088
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of the Anti-Biofilm and Anti-Quorum Sensing Activities of the β-Adrenoreceptor Antagonist Atenolol against Gram-Negative Bacterial Pathogens

by
Simona Cavalu
1,*,
Samar S. Elbaramawi
2,
Ahmed G. Eissa
2,
Mohamed F. Radwan
3,
Tarek S. Ibrahim
3,
El-Sayed Khafagy
4,5,
Bruno Silvester Lopes
6,7,
Mohamed A. M. Ali
8,9,
Wael A. H. Hegazy
10,11 and
Mahmoud A. Elfaky
12,13,*
1
Faculty of Medicine and Pharmacy, University of Oradea, P-ta 1 Decembrie 10, 410087 Oradea, Romania
2
Medicinal Chemistry Department, Faculty of Pharmacy, Zagazig University, Zagazig 44519, Egypt
3
Department of Pharmaceutical Chemistry, Faculty of Pharmacy, King Abdulaziz University, Jeddah 21589, Saudi Arabia
4
Department of Pharmaceutics, College of Pharmacy, Prince Sattam Bin Abdulaziz University, Al-kharj 11942, Saudi Arabia
5
Department of Pharmaceutics and Industrial Pharmacy, Faculty of Pharmacy, Suez Canal University, Ismailia 41522, Egypt
6
School of Health and Life Sciences, Teesside University, Middlesbrough TS1 3BA, UK
7
National Horizons Centre, Teesside University, Darlington DL1 1HG, UK
8
Department of Biology, College of Science, Imam Mohammad Ibn Saud Islamic University, Riyadh 11432, Saudi Arabia
9
Department of Biochemistry, Faculty of Science, Ain Shams University, Abbassia, Cairo 11566, Egypt
10
Department of Microbiology and Immunology, Faculty of Pharmacy, Zagazig University, Zagazig 44519, Egypt
11
Pharmacy Program, Department of Pharmaceutical Sciences, Oman College of Health Sciences, Muscat 113, Oman
12
Department of Natural Products, Faculty of Pharmacy, King Abdulaziz University, Jeddah 21589, Saudi Arabia
13
Centre for Artificial Intelligence in Precision Medicines, King Abdulaziz University, Jeddah 21589, Saudi Arabia
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(21), 13088; https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232113088
Submission received: 2 October 2022 / Revised: 18 October 2022 / Accepted: 25 October 2022 / Published: 28 October 2022
(This article belongs to the Special Issue Microbial Biofilms and Antibiofilm Agents 3.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
The development of bacterial resistance to antibiotics is an increasing public health issue that worsens with the formation of biofilms. Quorum sensing (QS) orchestrates the bacterial virulence and controls the formation of biofilm. Targeting bacterial virulence is promising approach to overcome the resistance increment to antibiotics. In a previous detailed in silico study, the anti-QS activities of twenty-two β-adrenoreceptor blockers were screened supposing atenolol as a promising candidate. The current study aims to evaluate the anti-QS, anti-biofilm and anti-virulence activities of the β-adrenoreceptor blocker atenolol against Gram-negative bacteria Serratia marcescens, Pseudomonas aeruginosa, and Proteus mirabilis. An in silico study was conducted to evaluate the binding affinity of atenolol to S. marcescens SmaR QS receptor, P. aeruginosa QscR QS receptor, and P. mirabilis MrpH adhesin. The atenolol anti-virulence activity was evaluated against the tested strains in vitro and in vivo. The present finding shows considerable ability of atenolol to compete with QS proteins and significantly downregulated the expression of QS- and virulence-encoding genes. Atenolol showed significant reduction in the tested bacterial biofilm formation, virulence enzyme production, and motility. Furthermore, atenolol significantly diminished the bacterial capacity for killing and protected mice. In conclusion, atenolol has potential anti-QS and anti-virulence activities against S. marcescens, P. aeruginosa, and P. mirabilis and can be used as an adjuvant in treatment of aggressive bacterial infections.

1. Introduction

Quorum sensing (QS) is the chemical language that bacteria use to communicate with each other in populations to arrange their accommodation and invasion in host tissues [1,2,3,4]. It relies on diverse chemical signaling molecules called autoinducers (AIs), which are acyl-homoserine lactones (AHL) in Gram-negative pathogens or peptides in Gram-positive [1,5,6,7]. However, AHL can passively diffuse through the Gram-negative thin cell wall, the Gram-positive peptide autoinducers must be actively transported [2,5]. Once, autoinducers bind to their cognate receptors, the formed receptor-AI regulate the expression of genes involved in virulence, biofilm formation, conjugation, sporulation, bioluminescence, and competence [1]. Like languages between humans, these signals differ between species; some bacteria can interpret several signals, while others sense a select few [1,2,5,8,9]. For instance, most Enterobacteriaceae utilize mainly Lux-type QS receptors to sense a wide diversity of AIs [9,10,11,12]. Furthermore, there is QS communication between different bacterial species, some species cannot produce their own AIs, but have receptors for the AIs of others [1,2,13]. Interestingly, interference with the QS systems by hindering the involved QS receptors lead to significant diminishing of bacterial virulence [14,15,16]. Because of its crucial role in controlling the bacterial virulence, targeting QS was supposed as a promising approach to attenuate the bacterial pathogenesis to be easily eradicated without developing bacterial resistance [3,17].
Bacterial resistance constitutes a serious global health issue, as bacteria magnificently developed biochemical and genetic resistance to nearly all antibiotic classes [18,19]. This situation dictates finding out new antibiotics and developing newer approaches to conquer this resistance increment [18,20,21,22,23,24]. The bacterial resistance was observed tremendously among different species of Gram-negative bacteria which can share the resistance genes [20,25,26]. Furthermore, the bacterial ability to form biofilms worsens the situation and increase the resistance to almost all antibiotics [20,27,28]. In this context, alleviation of bacterial virulence was suggested as a promising approach [2,16,29,30]. This approach confers the attenuation of bacterial virulence to be easily cleared without stressing the bacteria to develop resistance since it does not affect bacterial growth [16,30,31]. QS controls bacterial virulence such as biofilm formation, motility, production of enzymes and other virulence factors [32,33,34,35]. Due to the key roles of QS, several studies screened the anti-QS activities of various chemical moieties [36,37,38], natural products [39,40], and approved safe drugs [41,42,43,44].
Drug repurposing merits have been approved and it is considered an important strategy to save efforts, time and costs [30,35,45,46]. In a previous study the anti-QS activities of twenty-two β-adrenoreceptor blockers were screened in silico, and they were considered as promising anti-virulence candidates. Furthermore, metoprolol showed anti-virulence activities in vitro and in vivo against Pseudomonas aeruginosa and Salmonella Typhimurium [42]. Almalki. et al., performed a detailed docking study of the tested twenty-two β-adrenoreceptor blockers on the main structurally different Lux-type QS receptors Agrobacterium tumefaciens (TraR; PDB entry: 1L3L), Pseudomonas aeruginosa (QscR; PDB entry: 3SZT), and Chromobacterium violaceum (CviR; PDB entry: 3QP5) analyzing the binding interactions of the receptor ligands. Furthermore, a molecular dynamics simulation was performed to support the docking study findings, and atenolol was shown as a promising anti-QS candidate [42]. Atenolol as well as metoprolol are used to treat the hypertension and related complications [47]. Furthermore, atenolol shares the metoprolol chemical moiety 1-[4-methylphenoxy]-3-(propan-2-ylamino) propan-2-ol, as shown in Figure 1, that encourages us to investigate the atenolol’s anti-QS and anti-virulence activities. The current study aims to evaluate the anti-QS activities of β-adrenoreceptor blocker atenolol against three of the most common Gram-negative nosocomial pathogens, Serratia marcescens, P. aeruginosa, and Proteus mirabilis. The atenolol binding affinity to different QS protein targets were examined in silico. Further, the anti-virulence activities of atenolol against the three bacteria were assessed in vitro and in vivo.

2. Results

2.1. In Silico Molecular Study

2.1.1. Screening of Atenolol Binding on Different QS Biotargets

A two-step docking protocol, consisting of a preliminary rigid receptor approach and a further induced-fit docking, was applied to explore the interactions of atenolol with quorum sensing pathway components. The interactions with three bacterial targets regulating virulence genes of three different bacteria were screened; the P. aeruginosa QS signal receptor QScR (PDB ID: 3SZT) and the P. mirabilis adhesin MrpH (PDB ID: 6Y4F), as well as a SWISS model for the S. marcescens SmaR (Uniprot entry: Q14RS3) characterized the targets for this in silico evaluation.
The binding pockets of the bio-targets were defined by matching the location of the co-crystallized ligand with the sites obtained from MOE Site Finder. Figure 2A–C shows the three-dimensional protein architecture and the putative binding pockets with the calculated Richards’ solvent accessible surface area (SA) and volume (V) of the three bio-targets as predictable using the Computed Atlas for Surface Topography of Proteins (CASTp).
The P. aeruginosa quorum-sensing transcription factor (QscR) was resolved as homodimer at resolution of 2.55 Å with N-3′oxo-octanoyl-L-homoserine lactone (3OC12-HSL) co-crystallized within the active site. The architecture of QscR showed the same α/β/α sandwich as E. coli SdiA. The Ligand-binding domain (LBD) and the DNA-binding domain (DBD) are also linked together by a 10 amino acid-short sequence of residues [9]. Figure 2D illustrates the main amino acid residues lining the surface of the binding pocket.
The P. mirabilis adhesin MrpH architecture shows seven β-strands and two α helices in the 1.75Å crystal structure. The structure of MrpH is characterised by the close proximity between the N-terminus and the C-terminus, a disulfide bond between Cys 128 and Cys 152, which is an integral part for the protein structure and function, and the presence of a Zn ion bound by His 72, His 74, His 117 and is tetrahedrally coordinated by binding to an external ligand [48,49]. Figure 2E illustrates the main amino acid residues lining the surface of the binding pocket.
A homology model for S. marcescens Quorum-sensing transcriptional regulator (SmaR) (Uniprot Entry: Q14RS3, www.uniprot.org (accessed on 28 May 2022)) was built depending upon Chromobacterium violaceum CviR transcriptional regulator (PDB code: 3QP5, 3.25 Å) as a template [3], using SWISS model (https://www.expasy.org/resources/swiss-model (accessed on 28 May 2022)) [50,51,52,53,54]. Moreover, CASTP was used to verify the binding pocket. Figure 2F illustrates the main amino acid residues lining the surface of the binding pocket. The active site of the model was identified by the Site Finder module in the MOE which matched with the co-crystallized ligand 4-(4-chlorophenoxy)-N-[(3S)-2-oxooxolan-3-yl]butanamide (HLC) binding site of the template.

2.1.2. Docking Simulations on P. aeruginosa QS Control Repressor

Docking of atenolol and the co-crystallized ligand (3OC12-HSL) with QScR showed comparable fitting in the binding pocket, as shown in Figure 3A. Both of them was able to fill the active site forming hydrophobic interactions with the main amino acids lining the pocket Ser38, Tyr52, Phe54, Tyr58, Tyr66, Val78 and Met127 Figure 3B. However, the dock score of the co-crystallized ligand was much better than atenolol (−10.1774 and −7.5851, respectively)
Atenolol oriented within the active site through H-bond and ionic bind interactions with the crucial amino acid residues Figure 3C. As, the secondary amino group and the hydroxyl group formed H-bond interactions with Gly40, with Tyr85, respectively. In addition, protonated amino group showed ionic bond interaction with acidic Asp75 (Figure 3C). The co-crystallized ligand (3OC12-HSL) showed different H-bond interactions with Tyr58, Trp62 and Asp75. Table 1.

2.1.3. Docking Simulations on P. mirabilis Adhesin MrpH

Virtually, atenolol acts as an external ligand for Zn+2 binding; crucial for biofilm formation Figure 4. As the amide group allowed atenolol to be oriented in the active site through interaction with zinc metal and formation of hydrogen bond with basic Arg118. Moreover, the phenyl ring interacted with Asn82 through Pi-H bond. Protonated amino group formed hydrogen bond with Ala84. This is in addition to the comparable hydrophobic interactions to glutamate (co-crystallized ligand) representing in Asn82, Ala84, Phe85, Thr115 Thr116, Arg118 and Ile140 residues (Figure 4).
Results of the docking process as summarized in Table 2 indicates that glutamate had a relatively lower docking energy score = −8.4332 Kcal/mol than that of atenolol −7.2011 Kcal/mol as glutamate has much smaller size; enabling the molecule to move and bind freely; than a much bigger molecule like atenolol, as shown by the superimposition of both ligands in the MrpH pocket in Figure 5.

2.1.4. Docking Simulations on S. marcescens SmaR

After the model was built Figure 6, docking of the ligand co-crystallized with the template was performed to both validate the process and compare to atenolol binding.
Generally, the docking results, summarized in Table 3, showed that the score for atenolol was higher than HLC; however, the various binding interactions resulted in moderate score and stabilization of the complex.
Anionic sidechain of the acidic Asp66 residue participated in polar interaction with the protonated amino group of atenolol as well as H-bond interaction. The atenolol structure showed several pi-interactions as the following: H-pi bond with Phe44, pi-pi bond with Tyr57 and cation-pi bond with Trp81. Beside these interactions, the ligand had several hydrophobic interactions with Phe44, Phe54, Tyr57, Asp66, Val68, Trp81 and Ile105 residues, participating in ligand stabilization within the pocket Figure 7.

2.2. Minimum Inhibitory Concentration (MIC) of Atenolol

Microtiter broth dilution was used to determine the atenolol MICs, atenolol inhibited the growth of S. marcescens, P. aeruginosa, and P. mirabilis at concentrations 4, 2, and 2 mg/mL, respectively.

2.3. Effect of Atenolol on Bacterial Growth

To avoid the atenolol effect on bacterial growth, the antivirulence activities were tested for atenolol at sub-MIC (1/5 MIC). Furthermore, the atenolol effect on bacterial growth was attested by comparing the optical densities and bacterial counts of control untreated bacterial cultures and atenolol-treated cultures. The experiment was conducted in triplicate there was no significant difference between the bacterial growth in the presence and absence of atenolol at sub-MIC (Figure 8).

2.4. In Vitro Antivirulence and Anti-QS Activities of Atenolol

2.4.1. Antibiofilm Activity

The bacterial adhesion and biofilm formation on inanimate object was quantified with the crystal violet method in the presence or absence of atenolol at sub-MIC. Atenolol significantly decreased the biofilm formation (Figure 9). A representative light microscope images were captured that show a marked decrease in the numbers of adhered biofilm forming bacterial cells (Figure 9A).

2.4.2. Diminishing of Bacterial Motility

The effect of atenolol at sub-MIC on the swarming motility of the tested bacterial strains were assessed. Atenolol significantly decreased the swarming motility in S. marcescens, P. aeruginosa, and P. mirabilis (Figure 10).

2.4.3. Decreasing Production of Virulence Enzymes

Protease and hemolysins play critical roles in establishing and spreading bacterial infections. The atenolol effect at sub-MIC on the production of extracellular enzymes was evaluated on the production of hemolysins and protease in S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol significantly decreased the production of hemolysins and protease by tested strains (Figure 11).

2.5. Atenolol Downregulation of Virulence and QS Genes

The expression of P. aeruginosa QS encoding genes were evaluated in the treated bacterial samples with atenolol at sub-MIC and compared to untreated controls. Atenolol significantly decreased the expression of the genes encoding autoinducer synthetase and their receptors lasI/R, rhlI/R, and pqsA/R. Furthermore, atenolol significantly upregulated the expression of the motility controlling system repressor rsmA in S. marcescens and in same time significantly downregulated the motility controlling genes rssB, and flagella encoding genes flhC, flhD. Atenolol also downregulated the expression of the fimbria encoding genes fimA, fimC, and bsmB. These results indicate the significant downregulation of QS encoding, motility, and adhesion genes in parallel to upregulation to the virulence genes repressor RsmA. (Figure 12).

2.6. In Vivo Antivirulence and Anti-QS Activities of Atenolol

Mice protection assay was used to evaluate the capability of atenolol at sub-MIC to mitigate the S. marcescens, P. aeruginosa, and P. mirabilis pathogenesis. Meanwhile, there were no deaths among mice in negative control groups, the death rates were 50%, 80%, and 60% in mice injected with untreated S. marcescens, P. aeruginosa, and P. mirabilis, respectively. Interestingly, the death rates were significantly decreased in mice groups injected with atenolol treated S. marcescens, P. aeruginosa, and P. mirabilis to 20%, 40% and 30%, respectively (log rank test for trend p = 0.0289, 0.0025, and 0.0111, respectively) (Figure 13).

3. Discussion

The impact of the development of bacterial resistance to antibiotics is in increase and constitutes a serious challenge to public health [20,35,55]. The shortage in the discovery of new efficient antibiotics worsens the situation against the renewed bacterial capability to develop resistance [23,35,46]. Despite the necessity of antibiotics, they may be insufficient, especially in aggressive resistant infections [56,57,58]. Adopting new approaches is required to diminish the development of bacterial resistance [19,22,30,59]. Targeting bacterial virulence is one of these approaches that attenuates the bacteria easing their eradication by immunity without stressing bacteria to develop resistance [60,61]. The crucial roles of bacterial QS systems in controlling the bacterial virulence are proven [3,18,62]. Additionally, hence, targeting QS is meaningful to diminish several bacterial virulence factors such as biofilm formation, enzyme production, virulence agents production, and motility [4,6,61,63]. Several chemical compounds and natural products have been screened for their anti-QS activities and anti-virulence activities in vitro and in vivo [17,64].
The high attrition rates for the discovery and development of new drugs including costs, and time-consuming make the repurposing of old clinically known drugs an attractive proposition [45,65]. Drug repurposing is the use of already approved safe drugs that guarantee to shorten the development timelines and lower the overall development costs. However, numerous data-driven and experimental approaches have been proposed for repurposing several drugs, there are several challenges that are needed to be overcome as reviewed [45]. One of the efficient approaches to evaluate the possibility of drugs to be repurposed is the detailed in silico investigation. This virtual in silico studies were used efficiently in evaluating the binding abilities of tested drugs to specific protein receptors [41,42,66,67]. In this context, the adrenoreceptor antagonists were docked to several bacterial targets to test their anti-virulence activities [41,42]. Atenolol showed considered binding abilities to structurally different QS receptors that indicate its possible anti-virulence activities [42]. The present study evaluates the anti-QS and anti-virulence activities of atenolol against three Gram-negative bacteria S. marcescens, P. aeruginosa, and P. mirabilis.
P. mirabilis is peritrichous Gram-negative bacterium known for its characterized swarming motility. P. mirabilis is causative agent of diverse serious infections such as burn, wound, urinary tract, diabetic foot, and other infections [7,49,68,69]. P. mirabilis ability to gain resistance via horizontal gene transfer explains the increased isolation of resistant isolates in clinics and labs [70,71,72]. P. mirabilis acquires considered diversity of virulence factors enabling it to invade and spread into host tissues such as urease, protease and hemolysins besides the motility [49,68,71]. In the current study, a clinical P. mirabilis isolate obtained from macerated diabetic foot wound was used [49]. In addition to virulence, the tested P. mirabilis was described as strong-biofilm forming and showed resistance to several antibiotic classes [69,72,73]. Furthermore, another clinical S. marcescens isolate obtained from endotracheal aspirate was used in this study [74]. The S. marcescens clinical importance is owed to its increased share in causing nosocomial infections. S. marcescens was documented the seventh and the tenth most common pathogen that causes nosocomial pneumonia and blood stream infections, respectively [75,76,77]. Moreover, there is an exaggerated S. marcescens resistance to fluoroquinolones, β-lactam, and aminoglycosides [75,76,78]. Additionally, P. aeruginosa was used to evaluate the atenolol anti-virulence activity. P. aeruginosa is known for its virulence and resistance to antibiotics and disinfectants [24,79,80]. P. aeruginosa arsenal of virulence factors enables it to cause a wide range of serious infections in nearly all tissues [79,81]. Although the three selected Gram-negative bacteria for this study share their clinical importance, they acquire different virulence behavior and utilize different QS systems.
The bacterial virulence is mainly regulated by QS communication system. Bacteria can sense the adrenergic hormones and eavesdrops on the host cells to establish their infection [82,83,84]. Adrenergic hormones were shown to enhance the bacterial virulence [85,86,87,88]. This makes β-adrenoreceptor blockers a promising option to stop bacterial espionage on our cells and inhibit bacterial QS systems. A previous leader study evaluating the affinities of β-blockers towards different QS receptors from three bacteria namely, Chromobacterium violaceum, Pseudomonas aeruginosa and Salmonella Typhimurium, pointed towards the ability of atenolol, esmolol and metoprolol to decrease the production of QS-controlled C. violaceum and biofilm formation by P. aeruginosa and S. Typhimurium along with QS encoding genes downregulation [42]. To further expand on these findings and provide evidence for the β-blockers ability of combating QS in Gram-bacteria, computational and biological evaluation of atenolol against previously studied P. aeruginosa, as a linking point of comparison and verification of the here-in findings, and expanding to S. marcescens and P. mirabilis were performed using three different QS targets from the three bacteria for the in silico studies and various array of biological experimentation to indicate the numerous possibilities and the detrimental effect of atenolol as one of the most promising β-blocker examples against bacterial virulence factors. These findings supported by the wealth of evidence of the benefits of drug repurposing of approved drugs in saving time and cost could indeed revolutionize the way of combating infections and upgrade the available machinery towards Gram-negative infections.
Consequently, a detailed molecular docking study was conducted to evaluate the atenolol ability to compete on essential QS proteins in the tested bacterial strains. Gram-negative QS systems are generally LuxI/R type; S. marcescens SmaR is a LuxR family member that controls its virulence such as swarming motility, biofilm production, hemolytic activity, and production of enzymes [74,84,89]. P. aeruginosa employs two LuxI/R QS systems namely LasI/R and RhlI/R besides non-Lux type PQS system [81]. In addition, P. aeruginosa hires a Lux analogues QscR system to sense lasI autoinducers [40,81]. The Mannose Resistant Proteus like fimbriae (MRP) is Zn-dependent receptor-binding domain encoded by operon mrpABCDEFGHJ [72,90]. MRP fimbriae are essential for P. mirabilis aggregation and biofilm formation; where MrpH is one of the key involved fimbrial proteins [48,49]. Our findings showed a marked atenolol binding ability to S. marcescens SmaR, P. aeruginosa QscR, and P. mirabilis MrpH that point to possible anti-QS and anti-Virulence activities. It is worthy to mention that our previous study showed atenolol ability to compete on other different Lux-QS receptors Agrobacterium tumefaciens TraR and Chromobacterium violaceum CviR.
The underlying assumption toward an effective implementation of a successful QS interference is inhibition of virulence factors does not affect bacterial growth [91]. To evaluate the atenolol anti-virulence, it must be tested at sub-MIC to avoid any effect on bacterial growth. For assurance, the effect of atenolol at sub-MIC on the growth of tested strains was evaluated. There was no significant effect of atenolol at sub-MIC on bacterial growth. For attesting the atenolol anti-QS activity, the expressions of P. aeruginosa LasI/R, RhlI/R, and PqsA/R QS encoding genes were evaluated in the presence of atenolol at sub-MIC. Interestingly, atenolol significantly downregulated the expression of QS-encoding genes. These findings beside docking results indicate anti-QS activities of atenolol.
QS controls the regulation of several virulence factors such as motility, biofilm formation, and production of enzymes as protease, hemolysins, urease, elastase, and other virulence factors [5]. CsrA (carbon storage regulator) homologue RsmA is important component of the global regulatory Csr system in Escherichia coli that represses a variety of stationary-phase genes [71]. RsmA showed high sequence similarity to E coli CsrA and RsmA of S. marcescens, Erwinia carotovora, Haemophilus influenzae and Bacillus subtilis [71,92]. Importantly, RsmA regulates gene expression by affecting the stability of mRNA, and inhibited virulence-gene expression in a complex regulatory network [71,92]. It was shown that transformation of RsmA encoding plasmid to P. mirabilis diminished the swarming motility and decreased the production of protease, hemolysins and urease [71]. Interestingly, atenolol significantly upregulated the rsmA expression in S. marcescens. That is in agreement with the in vitro findings which showed the atenolol significant reduction effect on the production of protease and hemolysins in the three tested bacterial strains. While atenolol significantly increased the rsmA expression, it decreased the expression of rssB encoding two-component system RssAB that is essential for swarming motility regulation S. marcescens [92,93]. The flagellar master regulator operon flhDC controls the expression of flagellar proteins [49]. Atenolol downregulated the flagellar transcriptional regulators encoding genes flhC and flhD in S. marcescens. That is in compliance with the current findings that atenolol at sub-MIC significantly crippled the swarming motility of S. marcescens, P. aeruginosa, and P. mirabilis.
The biofilm formation is an additional obstacle against the efficient antibiotic treatment, and is associated with resistance increment [20]. Atenolol significantly diminished the adhesion biofilm formation in S. marcescens, P. aeruginosa, and P. mirabilis. That may be interpreted by atenolol downregulation to the fimbria encoding genes fimA and fimC in S. marcescens. The transcriptional factors as BsmA and BsmB are required to increase the expression of type I pilus [74,94]. Atenolol significantly reduced the expression of bsmB gene in S. marcescens. Finally, the in vivo anti-virulence activity of atenolol was evaluated against S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol showed significant ability to protect mice from killing. To sum up all the above results, atenolol acquires potent anti-QS and anti-virulence activity and is good candidate to be used in addition of antibiotics in treatment of aggressive infections.

4. Materials and Methods

4.1. In Silico Study

4.1.1. Ligand Preparation

Canonical SMILES of atenolol was retrieved from PubChem database (https://pubchem.ncbi.nlm.nih.gov/) (accessed on 24 May 2022). The 3D structure of the compound was built from the 2D structure of the compound, and energy minimized using EHT forcefield at 0.1 Kcal/mol/Å2 gradient RMS on Molecular Operating Environment (MOE 2019.012, Chemical Computing Group ULC, Montreal, QC, Canada). Atenolol 3D Structure was protonated using Protonate 3D module on MOE at physiological pH 7.4. Molecular properties of atenolol were obtained using SWISSADME tool (https://www.expasy.org/resources/swissadme (accessed on 24 May 2022)).

4.1.2. Protein Preparation

In silico molecular docking and visualization were performed for atenolol with the bacterial QS proteins using Molecular Operating Environment (MOE) 2019.0102. The crystal structures of the target proteins (PDB ID:, 3SZT and 6Y4F for P. aeruginosa quorum-sensing control repressor, and P. mirabilis adhesin MrpH, respectively) were downloaded from the RCSB Protein Data Bank (https://www.rcsb.org/ (accessed on 4 May 2022)). S. marcescens QS transcriptional regulator (SmaR) (Uniprot Entry: Q14RS3) has no resolved crystal structure, therefore a SWISS MODEL (https://www.expasy.org/resources/swiss-model, accessed on 28 May 2022) was utilised and active site architecture analyzed for its validation.
The QuickPrep panel was used to prepare the protein structures for the docking process. Preparation involves energy minimization, protonation, fixing and tethering atoms, deleting unnecessary water molecules and initial refinement at gradient RMS of 0.1 Kcal/mol/Å2.
Docking for the ligands in the active site was performed using Alpha triangle placement with Amber10: EHT forcefield, refinement with forcefield and scored using the Affinity dG scoring system. Re-docking of the co-crystallized ligand was performed to validate the use of the protein in structure-based drug design.
The binding pocket of each target was defined by the geometrical approach of MOE Site Finder, along with the position of the co-crystallized ligand within the crystal structure of protein. The Computed Atlas for Surface Topography of Proteins (CASTp; http://sts.bioe.uic.edu/castp/index.html, accessed on 28 May 2022) was used to calculate the pocket area/volume across the five QSs proteins [95].

4.2. Bacterial Strains, and Chemicals

The clinical isolates Proteus mirabilis [49] and Serratia marcescens [74] were fully identified previously, in addition to Pseudomonas aeruginosa PAO1 (ATCC BAA-47-B1) were used in this study. Proteus mirabilis isolate was isolated from macerated diabetic foot infection, and it was recognized as strong biofilm forming [49,67,96]. Serratia marcescens was a clinical isolate obtained from endotracheal aspiration [64,97], and was considered a strong biofilm forming [64,98]. Pseudomonas aeruginosa PAO1 is known as a strong biofilm forming and used in particular to assess the antibiofilm and anti-QS activities [99,100]. The media were ordered from Oxoid (Hampshire, UK), and the chemicals used were of pharmaceutical grade. Atenolol (CAS numbers: 29122-68-7) were obtained from Sigma-Aldrich (St. Louis, MO, USA).

4.3. Effect on Bacterial Growth

The atenolol MICs against the tested strains were detected using the broth microdilution method according to the Clinical Laboratory and Standards Institute Guidelines (CLSI, 2020).
The atenolol effect at sub-MIC (1/5 MIC) on bacterial growth was evaluated, as formerly described [43,44]. Briefly, the viable counts and optical densities of bacterial cultures provided or not with atenolol at 1/5 MIC were detected.

4.4. Adhesion and Biofilm Formation

The tested strains S. marcescens [97,98], P. aeruginosa [40,44], and P. mirabilis [49,96], were recognized as strong biofilm forming and employed in this study to evaluate the atenolol antibiofilm activity. The crystal violet method was used to assess the antibiofilm activity and adhesion photometrically at 600 nm [44,101]. Briefly, the suspension of tested strains was prepared from overnight cultures and the optical densities was adjusted to OD600 of 0.4 (1 × 108 CFU/mL). Ten μL aliquots of the prepared suspensions were added to 1 mL amounts of fresh tryptone soya broth (TSB) provided or not with atenolol at sub-MIC. Aliquots of 100 μL were transferred into the wells of 96 wells microtiter plates. After 1 h for adhesion assay or overnight incubation for biofilm assay, the planktonic non-adhered cells were aspirated, and the attached cells were fixed with methanol for 20 min and stained with crystal violet (1%) for 30 min. After washing out the excess dye, the attached dye was eluted by glacial acetic acid (33%), and the absorbances were measured at 590.
The atenolol antibiofilm activity was visualized by growing the bacterial strains on cover slips to form biofilms in the presence or absence of atenolol, as formerly detailed [36]. Briefly, the biofilms of different strains in the presence or absence of atenolol at sub-MIC were allowed to be formed on cover slips on 24 well polystyrene plates. After overnight incubation, the excess media and non-adherent cells were washed out and the cover slips were stained with crystal violet and examined.

4.5. Bacterial Motility

The bacterial swarming motility was evaluated in the presence of atenolol at sub-MIC in comparison to untreated controls as described previously [49,74]. Briefly, 5 µL of tested bacterial strains were centrally spotted on agar plates provided or not with atenolol at sub-MIC. The swarming zones were measured in mm.

4.6. Protease Production

The effect of atenolol on the production of protease was evaluated by using the skim milk agar method as formerly described [74]. Briefly, the supernatants were collected from bacterial cultures provided or not with atenolol at sub-MIC. The supernatants containing protease were added to the pre-made wells in 5% skim milk agar plates and incubated overnight at 37 °C, and the clear zones diameters were measured in mm.

4.7. Hemolysins Production

The atenolol anti-hemolytic activity was quantified as earlier described [44]. Briefly, the supernatants were collected from bacterial cultures grown in the presence or absence of atenolol at sub-MIC. Fresh blood (2%) suspensions were mixed in equal volume to the supernatants for 2 h at 37 °C. After the centrifugation, the absorbances were measured at 540 nm. Negative un-hemolyzed blood control and positive completely hemolyzed control were used.

4.8. RT-PCR

The RNA of treated or untreated S. marcescens or P. aeruginosa with atenolol at sub-MIC was extracted as described before [42]. The primers used to amplify the tested genes were listed in Table 4 indicated previously. The extracted RNA was used to synthesis cDNA, and the relative expression of the tested genes was calculated by the comparative threshold cycle (ΔΔCt) method [102].

4.9. Mice Survival Assay

The mice survival model was employed to assess the in vivo anti-virulence activity of atenolol as formerly mentioned [42,105]. Briefly, overnight cultures in LB broth provided or not with atenolol at sub-MIC (1 × 106 CFU/mL) in PBS. Four mice groups, each was composed of 10 three-weeks old female Mus musculus mice. Two negative control groups were kept uninfected or intraperitoneally (ip) injected with PBS. The third group was ip injected with untreated bacterial strains as positive control group. The last group was ip injected with atenolol treated bacterial strains. The mice survival was recorded over 5 days using Kaplan–Meier method.

4.10. Statistical Analysis

The tests were done in triplicate, and the data are presented as the means ± standard error. The student’s t-test was employed to assure the statistical significance (unless mentioned), where p value < 0.05 is considered significant (GraphPad Prism Software, v.8, San Diego, CA, USA).

5. Conclusions

In the continuous increment of bacterial resistance to antibiotics, alternative strategies could be helpful to conquer the resistance development. Among the most promising approaches, targeting bacterial virulence confers the bacterial attenuation to be easily eradicated by host immunity. This approach does not affect the bacterial growth and hence did not stress bacteria to develop resistance. Due to the known roles of QS in regulation of virulence, anti-QS agents could guarantee significant diminishing of bacterial virulence. Wide diverse chemical moieties were screened for their anti-QS activities; however, the repurposing of the drugs is an advantageous strategy. In the current study, the β-adrenoreceptor antagonist atenolol anti-QS and anti-virulence activities have been studied in silico, in vitro, and in vivo against three Gram-negative bacteria namely S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol showed significant anti-QS, anti-biofilm activities, diminished the production of virulence factors and downregulated the QS and virulence encoding genes. The present findings document the potent anti-QS activities of atenolol and its possible use in addition as adjuvant to traditional antibiotics in treatment of aggressive virulent infections. Taking in consideration that further pharmacological and toxicological studies to ensure their safe use for new application.

Author Contributions

Conceptualization, W.A.H.H.; S.C. and M.A.E.; methodology, A.G.E., S.S.E. and W.A.H.H.; software, M.A.M.A.; T.S.I.; validation, B.S.L.; M.F.R.; formal analysis, T.S.I. and E.-S.K.; investigation, A.G.E., S.S.E. and W.A.H.H.; resources, S.C. and M.A.E.; data curation, M.F.R. and E.-S.K.; writing—original draft preparation, A.G.E., S.S.E. and W.A.H.H.; writing—review and editing, S.C. and M.A.E.; visualization, T.S.I. and M.F.R.; supervision, S.C. and M.A.E.; project administration, S.C. and M.A.E.; funding acquisition, S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research work was funded by Institutional Fund Projects under grant no. (IFPDP-201-22).

Institutional Review Board Statement

The study was conducted according to guidelines of the declaration of Helsinki. The experimental protocol gets approved from the ethics committee at Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia (Code # PH-1442-13).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors gratefully acknowledge technical and financial support from Ministry of Education and Deanship of Scientific Research (DSR), King Abdulaziz University (KAU), Jeddah, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Winzer, K.; Williams, P. Quorum sensing and the regulation of virulence gene expression in pathogenic bacteria. Int. J. Med. Microbiol. 2001, 291, 131–143. [Google Scholar] [CrossRef] [PubMed]
  2. Abisado, R.G.; Benomar, S.; Klaus, J.R.; Dandekar, A.A.; Chandler, J.R. Bacterial Quorum Sensing and Microbial Community Interactions. mBio 2018, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Chen, G.; Swem, L.R.; Swem, D.L.; Stauff, D.L.; O’Loughlin, C.T.; Jeffrey, P.D.; Bassler, B.L.; Hughson, F.M. A strategy for antagonizing quorum sensing. Mol. Cell 2011, 42, 199–209. [Google Scholar] [CrossRef] [Green Version]
  4. Dong, Y.H.; Wang, L.H.; Xu, J.L.; Zhang, H.B.; Zhang, X.F.; Zhang, L.H. Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 2001, 411, 813–817. [Google Scholar] [CrossRef] [PubMed]
  5. Rutherford, S.T.; Bassler, B.L. Bacterial quorum sensing: Its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2012, 2, e02331-17. [Google Scholar] [CrossRef] [PubMed]
  6. Bottomley, M.J.; Muraglia, E.; Bazzo, R.; Carfi, A. Molecular insights into quorum sensing in the human pathogen Pseudomonas aeruginosa from the structure of the virulence regulator LasR bound to its autoinducer. J. Biol. Chem. 2007, 282, 13592–13600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Schneider, R.; Lockatell, C.V.; Johnson, D.; Belas, R. Detection and mutation of a luxS-encoded autoinducer in Proteus mirabilis. Microbiology 2002, 148, 773–782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. LaSarre, B.; Federle, M.J. Exploiting quorum sensing to confuse bacterial pathogens. Microbiol. Mol. Biol. Rev. 2013, 77, 73–111. [Google Scholar] [CrossRef] [Green Version]
  9. Lintz, M.J.; Oinuma, K.; Wysoczynski, C.L.; Greenberg, E.P.; Churchill, M.E. Crystal structure of QscR, a Pseudomonas aeruginosa quorum sensing signal receptor. Proc. Natl. Acad. Sci. USA 2011, 108, 15763–15768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Pawar, S.; Ashraf, M.I.; Mujawar, S.; Mishra, R.; Lahiri, C. In silico Identification of the Indispensable Quorum Sensing Proteins of Multidrug Resistant Proteus mirabilis. Front. Cell. Infect. Microbiol. 2018, 8, 269. [Google Scholar] [CrossRef] [PubMed]
  11. Pena, R.T.; Blasco, L.; Ambroa, A.; Gonzalez-Pedrajo, B.; Fernandez-Garcia, L.; Lopez, M.; Bleriot, I.; Bou, G.; Garcia-Contreras, R.; Wood, T.K.; et al. Relationship Between Quorum Sensing and Secretion Systems. Front. Microbiol. 2019, 10, 1100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Alandiyjany, M.N.; Abdelaziz, A.S.; Abdelfattah-Hassan, A.; Hegazy, W.A.H.; Hassan, A.A.; Elazab, S.T.; Mohamed, E.A.A.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A.; et al. Novel In Vivo Assessment of Antimicrobial Efficacy of Ciprofloxacin Loaded Mesoporous Silica Nanoparticles against Salmonella typhimurium Infection. Pharmaceuticals 2022, 15, 357. [Google Scholar] [CrossRef] [PubMed]
  13. Askoura, M.; Almalki, A.J.; Lila, A.S.A.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Alteration of Salmonella enterica Virulence and Host Pathogenesis through Targeting sdiA by Using the CRISPR-Cas9 System. Microorganisms 2021, 9, 2564. [Google Scholar] [CrossRef] [PubMed]
  14. Li, G.; Yan, C.; Xu, Y.; Feng, Y.; Wu, Q.; Lv, X.; Yang, B.; Wang, X.; Xia, X. Punicalagin inhibits Salmonella virulence factors and has anti-quorum-sensing potential. Appl. Environ. Microbiol. 2014, 80, 6204–6211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Mattmann, M.E.; Blackwell, H.E. Small molecules that modulate quorum sensing and control virulence in Pseudomonas aeruginosa. J. Org. Chem. 2010, 75, 6737–6746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Rasmussen, T.B.; Givskov, M. Quorum-sensing inhibitors as anti-pathogenic drugs. Int. J. Med. Microbiol. 2006, 296, 149–161. [Google Scholar] [CrossRef] [PubMed]
  17. Choo, J.H.; Rukayadi, Y.; Hwang, J.K. Inhibition of bacterial quorum sensing by vanilla extract. Lett. Appl. Microbiol. 2006, 42, 637–641. [Google Scholar] [CrossRef]
  18. Brackman, G.; Cos, P.; Maes, L.; Nelis, H.J.; Coenye, T. Quorum sensing inhibitors increase the susceptibility of bacterial biofilms to antibiotics in vitro and in vivo. Antimicrob. Agents Chemother. 2011, 55, 2655–2661. [Google Scholar] [CrossRef] [Green Version]
  19. Hegazy, W.A.H.; Rajab, A.A.H.; Abu Lila, A.S.; Abbas, H.A. Anti-diabetics and antimicrobials: Harmony of mutual interplay. World J. Diabetes 2021, 12, 1832–1855. [Google Scholar] [CrossRef]
  20. Hoiby, N.; Bjarnsholt, T.; Givskov, M.; Molin, S.; Ciofu, O. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 2010, 35, 322–332. [Google Scholar] [CrossRef]
  21. Rasko, D.A.; Moreira, C.G.; de Li, R.; Reading, N.C.; Ritchie, J.M.; Waldor, M.K.; Williams, N.; Taussig, R.; Wei, S.; Roth, M.; et al. Targeting QseC signaling and virulence for antibiotic development. Science 2008, 321, 1078–1080. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Rasko, D.A.; Sperandio, V. Anti-virulence strategies to combat bacteria-mediated disease. Nat. Rev. Drug. Discov. 2010, 9, 117–128. [Google Scholar] [CrossRef] [PubMed]
  23. Lister, P.D.; Wolter, D.J.; Hanson, N.D. Antibacterial-resistant Pseudomonas aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009, 22, 582–610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef] [Green Version]
  25. Blair, J.M.; Webber, M.A.; Baylay, A.J.; Ogbolu, D.O.; Piddock, L.J. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 2015, 13, 42–51. [Google Scholar] [CrossRef]
  26. Garcia-Contreras, R.; Nunez-Lopez, L.; Jasso-Chavez, R.; Kwan, B.W.; Belmont, J.A.; Rangel-Vega, A.; Maeda, T.; Wood, T.K. Quorum sensing enhancement of the stress response promotes resistance to quorum quenching and prevents social cheating. ISME J. 2015, 9, 115–125. [Google Scholar] [CrossRef] [Green Version]
  27. Huang, C.T.; Shih, P.C. Effects of quorum sensing signal molecules on the hydrogen peroxide resistance against planktonic Pseudomonas aeruginosa. J. Microbiol. Immunol. Infect. 2000, 33, 154–158. [Google Scholar]
  28. Abd El-Hamid, M.I.; Sewid, A.H.; Samir, M.; Hegazy, W.A.H.; Bahnass, M.M.; Mosbah, R.A.; Ghaith, D.M.; Khalifa, E.; Ramadan, H.; Alshareef, W.A.; et al. Clonal Diversity and Epidemiological Characteristics of ST239-MRSA Strains. Front. Cell. Infect. Microbiol. 2022, 12, 241. [Google Scholar] [CrossRef]
  29. Srinivasan, R.; Mohankumar, R.; Kannappan, A.; Karthick Raja, V.; Archunan, G.; Karutha Pandian, S.; Ruckmani, K.; Veera Ravi, A. Exploring the Anti-quorum Sensing and Antibiofilm Efficacy of Phytol against Serratia marcescens Associated Acute Pyelonephritis Infection in Wistar Rats. Front. Cell. Infect. Microbiol. 2017, 7, 498. [Google Scholar] [CrossRef] [Green Version]
  30. Muhlen, S.; Dersch, P. Anti-virulence Strategies to Target Bacterial Infections. Curr. Top. Microbiol. Immunol. 2016, 398, 147–183. [Google Scholar] [CrossRef]
  31. Hentzer, M.; Wu, H.; Andersen, J.B.; Riedel, K.; Rasmussen, T.B.; Bagge, N.; Kumar, N.; Schembri, M.A.; Song, Z.; Kristoffersen, P.; et al. Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. EMBO J. 2003, 22, 3803–3815. [Google Scholar] [CrossRef] [PubMed]
  32. Jiang, Q.; Chen, J.; Yang, C.; Yin, Y.; Yao, K. Quorum Sensing: A Prospective Therapeutic Target for Bacterial Diseases. BioMed Res. Int. 2019, 2019, 2015978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Jiang, T.; Li, M. Quorum sensing inhibitors: A patent review. Expert Opin. Ther. Pat. 2013, 23, 867–894. [Google Scholar] [CrossRef] [PubMed]
  34. Papenfort, K.; Bassler, B.L. Quorum sensing signal-response systems in Gram-negative bacteria. Nat. Rev. Microbiol. 2016, 14, 576–588. [Google Scholar] [CrossRef] [Green Version]
  35. Livermore, D.M.; Blaser, M.; Carrs, O.; Cassell, G.; Fishman, N.; Guidos, R.; Levy, S.; Powers, J.; Norrby, R.; Tillotson, G.; et al. Discovery research: The scientific challenge of finding new antibiotics. J. Antimicrob. Chemother. 2011, 66, 1941–1944. [Google Scholar] [CrossRef] [Green Version]
  36. Almalki, A.J.; Ibrahim, T.S.; Taher, E.S.; Mohamed, M.F.A.; Youns, M.; Hegazy, W.A.H.; Al-Mahmoudy, A.M.M. Synthesis, Antimicrobial, Anti-Virulence and Anticancer Evaluation of New 5(4H)-Oxazolone-Based Sulfonamides. Molecules 2022, 27, 671. [Google Scholar] [CrossRef]
  37. Agha, K.A.; Abo-Dya, N.E.; Ibrahim, T.S.; Abdel-Aal, E.H.; Hegazy, W.A. Benzotriazole-Mediated Synthesis and Antibacterial Activity of Novel N-Acylcephalexins. Sci. Pharm. 2016, 84, 484–496. [Google Scholar] [CrossRef] [Green Version]
  38. Ma, D.L.; Chan, D.S.; Leung, C.H. Drug repositioning by structure-based virtual screening. Chem. Soc. Rev. 2013, 42, 2130–2141. [Google Scholar] [CrossRef]
  39. Khayat, M.T.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Shaldam, M.A.; Mohammad, K.A.; Khafagy, E.-S.; El-damasy, D.A.; Hegazy, W.A.H.; Abbas, H.A. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms 2022, 10, 1046. [Google Scholar] [CrossRef]
  40. Aldawsari, M.F.; Khafagy, E.S.; Saqr, A.A.; Alalaiwe, A.; Abbas, H.A.; Shaldam, M.A.; Hegazy, W.A.H.; Goda, R.M. Tackling Virulence of Pseudomonas aeruginosa by the Natural Furanone Sotolon. Antibiotics 2021, 10, 871. [Google Scholar] [CrossRef]
  41. Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Darwish, K.M.; Hegazy, W.A.H. Repurposing α-Adrenoreceptor Blockers as Promising Anti-Virulence Agents in Gram-Negative Bacteria. Antibiotics 2022, 11, 178. [Google Scholar] [CrossRef] [PubMed]
  42. Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Hegazy, W.A.H.; Darwish, K.M. Computational and Biological Evaluation of β-Adrenoreceptor Blockers as Promising Bacterial Anti-Virulence Agents. Pharmaceuticals 2022, 15, 110. [Google Scholar] [CrossRef] [PubMed]
  43. Hegazy, W.A.H.; Salem, I.M.; Alotaibi, H.F.; Khafagy, E.-S.; Ibrahim, D. Terazosin Interferes with Quorum Sensing and Type Three Secretion System and Diminishes the Bacterial Espionage to Mitigate the Salmonella Typhimurium Pathogenesis. Antibiotics 2022, 11, 465. [Google Scholar] [CrossRef] [PubMed]
  44. Saqr, A.A.; Aldawsari, M.F.; Khafagy, E.-S.; Shaldam, M.A.; Hegazy, W.A.H.; Abbas, H.A. A Novel Use of Allopurinol as A Quorum-Sensing Inhibitor in Pseudomonas aeruginosa. Antibiotics 2021, 10, 1385. [Google Scholar] [CrossRef] [PubMed]
  45. Pushpakom, S.; Iorio, F.; Eyers, P.A.; Escott, K.J.; Hopper, S.; Wells, A.; Doig, A.; Guilliams, T.; Latimer, J.; McNamee, C.; et al. Drug repurposing: Progress, challenges and recommendations. Nat. Rev. Drug. Discov. 2019, 18, 41–58. [Google Scholar] [CrossRef] [PubMed]
  46. Mohr, K.I. History of Antibiotics Research. Curr. Top. Microbiol. Immunol. 2016, 398, 237–272. [Google Scholar] [CrossRef] [PubMed]
  47. Aykac, A.; Sehirli, A.O.; Goren, M.Z. Evaluation of the Effect of Prazosin Treatment on alpha-2c Adrenoceptor and Apoptosis Protein Levels in the Predator Scent-Induced Rat Model of Post-Traumatic Stress Disorder. J. Mol. Neurosci. 2020, 70, 1120–1129. [Google Scholar] [CrossRef] [PubMed]
  48. Jiang, W.; Ubhayasekera, W.; Breed, M.C.; Norsworthy, A.N.; Serr, N.; Mobley, H.L.T.; Pearson, M.M.; Knight, S.D. MrpH, a new class of metal-binding adhesin, requires zinc to mediate biofilm formation. PLoS Pathog. 2020, 16, e1008707. [Google Scholar] [CrossRef]
  49. Khayyat, A.N.; Abbas, H.A.; Mohamed, M.F.A.; Asfour, H.Z.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Khafagy, E.-S.; Abu Lila, A.S.; Safo, M.K.; et al. Not Only Antimicrobial: Metronidazole Mitigates the Virulence of Proteus mirabilis Isolated from Macerated Diabetic Foot Ulcer. Appl. Sci. 2021, 11, 6847. [Google Scholar] [CrossRef]
  50. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Green Version]
  51. Bienert, S.; Waterhouse, A.; de Beer, T.A.; Tauriello, G.; Studer, G.; Bordoli, L.; Schwede, T. The SWISS-MODEL Repository-new features and functionality. Nucleic Acids Res. 2017, 45, D313–D319. [Google Scholar] [CrossRef] [PubMed]
  52. Studer, G.; Rempfer, C.; Waterhouse, A.M.; Gumienny, R.; Haas, J.; Schwede, T. QMEANDisCo-distance constraints applied on model quality estimation. Bioinformatics 2020, 36, 2647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Studer, G.; Tauriello, G.; Bienert, S.; Biasini, M.; Johner, N.; Schwede, T. ProMod3-A versatile homology modelling toolbox. PLoS Comput. Biol. 2021, 17, e1008667. [Google Scholar] [CrossRef]
  54. Bertoni, M.; Kiefer, F.; Biasini, M.; Bordoli, L.; Schwede, T. Modeling protein quaternary structure of homo- and hetero-oligomers beyond binary interactions by homology. Sci. Rep. 2017, 7, 10480. [Google Scholar] [CrossRef] [Green Version]
  55. Issac Abraham, S.V.; Palani, A.; Ramaswamy, B.R.; Shunmugiah, K.P.; Arumugam, V.R. Antiquorum sensing and antibiofilm potential of Capparis spinosa. Arch. Med. Res. 2011, 42, 658–668. [Google Scholar] [CrossRef]
  56. Gaynes, R.; Edwards, J.R.; National Nosocomial Infections Surveillance, S. Overview of nosocomial infections caused by gram-negative bacilli. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2005, 41, 848–854. [Google Scholar] [CrossRef]
  57. Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.J.; Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef]
  58. Skindersoe, M.E.; Alhede, M.; Phipps, R.; Yang, L.; Jensen, P.O.; Rasmussen, T.B.; Bjarnsholt, T.; Tolker-Nielsen, T.; Hoiby, N.; Givskov, M. Effects of antibiotics on quorum sensing in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2008, 52, 3648–3663. [Google Scholar] [CrossRef] [Green Version]
  59. Kamaruzzaman, N.F.; Kendall, S.; Good, L. Targeting the hard to reach: Challenges and novel strategies in the treatment of intracellular bacterial infections. Br. J. Pharmacol. 2017, 174, 2225–2236. [Google Scholar] [CrossRef] [Green Version]
  60. Cegelski, L.; Marshall, G.R.; Eldridge, G.R.; Hultgren, S.J. The biology and future prospects of antivirulence therapies. Nat. Rev. Microbiol. 2008, 6, 17–27. [Google Scholar] [CrossRef]
  61. Hema, M.; Vasudevan, S.; Balamurugan, P.; Adline Princy, S. Modulating the Global Response Regulator, LuxO of V. cholerae Quorum Sensing System Using a Pyrazine Dicarboxylic Acid Derivative (PDCA(py)): An Antivirulence Approach. Front. Cell. Infect. Microbiol. 2017, 7, 441. [Google Scholar] [CrossRef] [PubMed]
  62. Burt, S.A.; Ojo-Fakunle, V.T.; Woertman, J.; Veldhuizen, E.J. The natural antimicrobial carvacrol inhibits quorum sensing in Chromobacterium violaceum and reduces bacterial biofilm formation at sub-lethal concentrations. PLoS ONE 2014, 9, e93414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Diggle, S.P.; Matthijs, S.; Wright, V.J.; Fletcher, M.P.; Chhabra, S.R.; Lamont, I.L.; Kong, X.; Hider, R.C.; Cornelis, P.; Camara, M.; et al. The Pseudomonas aeruginosa 4-quinolone signal molecules HHQ and PQS play multifunctional roles in quorum sensing and iron entrapment. Chem. Biol. 2007, 14, 87–96. [Google Scholar] [CrossRef] [Green Version]
  64. Hegazy, W.A.H.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Mosbah, R.; Soliman, W.E. Repurposing of antidiabetics as Serratia marcescens virulence inhibitors. Braz. J. Microbiol. 2021, 52, 627–638. [Google Scholar] [CrossRef]
  65. Hegazy, W.A.H.; Khayat, M.T.; Ibrahim, T.S.; Nassar, M.S.; Bakhrebah, M.A.; Abdulaal, W.H.; Alhakamy, N.A.; Bendary, M.M. Repurposing Anti-diabetic Drugs to Cripple Quorum Sensing in Pseudomonas aeruginosa. Microorganisms 2020, 8, 1285. [Google Scholar] [CrossRef] [PubMed]
  66. Khayat, M.T.; Abbas, H.A.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Darwish, K.M.; Elhady, S.S.; Khafagy, E.-S.; Safo, M.K.; Hegazy, W.A.H. Anti-Quorum Sensing Activities of Gliptins against Pseudomonas aeruginosa and Staphylococcus aureus. Biomedicines 2022, 10, 1169. [Google Scholar] [CrossRef]
  67. Thabit, A.K.; Eljaaly, K.; Zawawi, A.; Ibrahim, T.S.; Eissa, A.G.; Elbaramawi, S.S.; Hegazy, W.A.H.; Elfaky, M.A. Muting Bacterial Communication: Evaluation of Prazosin Anti-Quorum Sensing Activities against Gram-Negative Bacteria Pseudomonas aeruginosa, Proteus mirabilis, and Serratia marcescens. Biology 2022, 11, 1349. [Google Scholar] [CrossRef] [PubMed]
  68. Rather, P.N. Swarmer cell differentiation in Proteus mirabilis. Environ. Microbiol. 2005, 7, 1065–1073. [Google Scholar] [CrossRef]
  69. Rozalski, A.; Sidorczyk, Z.; Kotelko, K. Potential virulence factors of Proteus bacilli. Microbiol. Mol. Biol. Rev. 1997, 61, 65–89. [Google Scholar] [CrossRef]
  70. Girlich, D.; Bonnin, R.A.; Dortet, L.; Naas, T. Genetics of Acquired Antibiotic Resistance Genes in Proteus spp. Front. Microbiol. 2020, 11, 256. [Google Scholar] [CrossRef] [Green Version]
  71. Liaw, S.J.; Lai, H.C.; Ho, S.W.; Luh, K.T.; Wang, W.B. Role of RsmA in the regulation of swarming motility and virulence factor expression in Proteus mirabilis. J. Med. Microbiol. 2003, 52, 19–28. [Google Scholar] [CrossRef] [PubMed]
  72. Schaffer, J.N.; Norsworthy, A.N.; Sun, T.T.; Pearson, M.M. Proteus mirabilis fimbriae- and urease-dependent clusters assemble in an extracellular niche to initiate bladder stone formation. Proc. Natl. Acad. Sci. USA 2016, 113, 4494–4499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Armbruster, C.E.; Mobley, H.L. Merging mythology and morphology: The multifaceted lifestyle of Proteus mirabilis. Nat. Rev. Microbiol. 2012, 10, 743–754. [Google Scholar] [CrossRef] [PubMed]
  74. Khayyat, A.N.; Abbas, H.A.; Khayat, M.T.; Shaldam, M.A.; Askoura, M.; Asfour, H.Z.; Khafagy, E.-S.; Abu Lila, A.S.; Allam, A.N.; Hegazy, W.A.H. Secnidazole Is a Promising Imidazole Mitigator of Serratia marcescens Virulence. Microorganisms 2021, 9, 2333. [Google Scholar] [CrossRef]
  75. Stock, I.; Burak, S.; Sherwood, K.J.; Gruger, T.; Wiedemann, B. Natural antimicrobial susceptibilities of strains of ’unusual’ Serratia species: S. ficaria, S. fonticola, S. odorifera, S. plymuthica and S. rubidaea. J. Antimicrob. Chemother. 2003, 51, 865–885. [Google Scholar] [CrossRef] [Green Version]
  76. Matsuyama, T.; Kaneda, K.; Nakagawa, Y.; Isa, K.; Hara-Hotta, H.; Yano, I. A novel extracellular cyclic lipopeptide which promotes flagellum-dependent and -independent spreading growth of Serratia marcescens. J. Bacteriol. 1992, 174, 1769–1776. [Google Scholar] [CrossRef] [Green Version]
  77. Salini, R.; Pandian, S.K. Interference of quorum sensing in urinary pathogen Serratia marcescens by Anethum graveolens. Pathog. Dis. 2015, 73, ftv038. [Google Scholar] [CrossRef] [Green Version]
  78. Slater, H.; Crow, M.; Everson, L.; Salmond, G.P. Phosphate availability regulates biosynthesis of two antibiotics, prodigiosin and carbapenem, in Serratia via both quorum-sensing-dependent and -independent pathways. Mol. Microbiol. 2003, 47, 303–320. [Google Scholar] [CrossRef]
  79. Oliver, A.; Mulet, X.; Lopez-Causape, C.; Juan, C. The increasing threat of Pseudomonas aeruginosa high-risk clones. Drug Resist. Updates Rev. Comment. Antimicrob. Anticancer. Chemother. 2015, 21–22, 41–59. [Google Scholar] [CrossRef]
  80. Horcajada, J.P.; Montero, M.; Oliver, A.; Sorli, L.; Luque, S.; Gomez-Zorrilla, S.; Benito, N.; Grau, S. Epidemiology and Treatment of Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa Infections. Clin. Microbiol. Rev. 2019, 32. [Google Scholar] [CrossRef]
  81. Venturi, V. Regulation of quorum sensing in Pseudomonas. FEMS Microbiol. Rev. 2006, 30, 274–291. [Google Scholar] [CrossRef] [PubMed]
  82. Moreira, C.G.; Sperandio, V. Interplay between the QseC and QseE bacterial adrenergic sensor kinases in Salmonella enterica serovar Typhimurium pathogenesis. Infect. Immun. 2012, 80, 4344–4353. [Google Scholar] [CrossRef] [Green Version]
  83. Withers, H.; Swift, S.; Williams, P. Quorum sensing as an integral component of gene regulatory networks in Gram-negative bacteria. Curr. Opin. Microbiol. 2001, 4, 186–193. [Google Scholar] [CrossRef]
  84. Yu, Z.; Hu, Z.; Xu, Q.; Zhang, M.; Yuan, N.; Liu, J.; Meng, Q.; Yin, J. The LuxI/LuxR-Type Quorum Sensing System Regulates Degradation of Polycyclic Aromatic Hydrocarbons via Two Mechanisms. Int. J. Mol. Sci. 2020, 21, 5548. [Google Scholar] [CrossRef] [PubMed]
  85. Moreira, C.G.; Russell, R.; Mishra, A.A.; Narayanan, S.; Ritchie, J.M.; Waldor, M.K.; Curtis, M.M.; Winter, S.E.; Weinshenker, D.; Sperandio, V. Bacterial Adrenergic Sensors Regulate Virulence of Enteric Pathogens in the Gut. mBio 2016, 7. [Google Scholar] [CrossRef] [Green Version]
  86. Flierl, M.A.; Rittirsch, D.; Nadeau, B.A.; Sarma, J.V.; Day, D.E.; Lentsch, A.B.; Huber-Lang, M.S.; Ward, P.A. Upregulation of phagocyte-derived catecholamines augments the acute inflammatory response. PLoS ONE 2009, 4, e4414. [Google Scholar] [CrossRef] [Green Version]
  87. Methner, U.; Rabsch, W.; Reissbrodt, R.; Williams, P.H. Effect of norepinephrine on colonisation and systemic spread of Salmonella enterica in infected animals: Role of catecholate siderophore precursors and degradation products. Int. J. Med. Microbiol. 2008, 298, 429–439. [Google Scholar] [CrossRef]
  88. Sandrini, S.M.; Shergill, R.; Woodward, J.; Muralikuttan, R.; Haigh, R.D.; Lyte, M.; Freestone, P.P. Elucidation of the mechanism by which catecholamine stress hormones liberate iron from the innate immune defense proteins transferrin and lactoferrin. J. Bacteriol. 2010, 192, 587–594. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  89. Stevens, A.M.; Dolan, K.M.; Greenberg, E.P. Synergistic binding of the Vibrio fischeri LuxR transcriptional activator domain and RNA polymerase to the lux promoter region. Proc. Natl. Acad. Sci. USA 1994, 91, 12619–12623. [Google Scholar] [CrossRef] [Green Version]
  90. Bode, N.J.; Debnath, I.; Kuan, L.; Schulfer, A.; Ty, M.; Pearson, M.M. Transcriptional analysis of the MrpJ network: Modulation of diverse virulence-associated genes and direct regulation of mrp fimbrial and flhDC flagellar operons in Proteus mirabilis. Infect. Immun. 2015, 83, 2542–2556. [Google Scholar] [CrossRef] [Green Version]
  91. Garcia-Contreras, R. Is Quorum Sensing Interference a Viable Alternative to Treat Pseudomonas aeruginosa Infections? Front. Microbiol. 2016, 7, 1454. [Google Scholar] [CrossRef] [PubMed]
  92. Ang, S.; Horng, Y.T.; Shu, J.C.; Soo, P.C.; Liu, J.H.; Yi, W.C.; Lai, H.C.; Luh, K.T.; Ho, S.W.; Swift, S. The role of RsmA in the regulation of swarming motility in Serratia marcescens. J. Biomed. Sci. 2001, 8, 160–169. [Google Scholar] [CrossRef] [PubMed]
  93. Lin, C.S.; Tsai, Y.H.; Chang, C.J.; Tseng, S.F.; Wu, T.R.; Lu, C.C.; Wu, T.S.; Lu, J.J.; Horng, J.T.; Martel, J.; et al. An iron detection system determines bacterial swarming initiation and biofilm formation. Sci. Rep. 2016, 6, 36747. [Google Scholar] [CrossRef] [PubMed]
  94. Ramanathan, S.; Ravindran, D.; Arunachalam, K.; Arumugam, V.R. Inhibition of quorum sensing-dependent biofilm and virulence genes expression in environmental pathogen Serratia marcescens by petroselinic acid. Antonie Van Leeuwenhoek 2018, 111, 501–515. [Google Scholar] [CrossRef]
  95. Tian, W.; Chen, C.; Lei, X.; Zhao, J.; Liang, J. CASTp 3.0: Computed atlas of surface topography of proteins. Nucleic Acids Res. 2018, 46, W363–W367. [Google Scholar] [CrossRef] [Green Version]
  96. Hegazy, W.A.H. Diclofenac inhibits virulence of Proteus mirabilis isolated from diabetic foot ulcer. Afr. J. Microbiol. Res. 2016, 10, 733–743. [Google Scholar]
  97. Abbas, H.A.; Hegazy, W.A.H. Targeting the virulence factors of Serratia marcescens by ambroxol. Roum. Arch. Microbiol. Immunol. 2017, 76, 27–32. [Google Scholar]
  98. Abbas, H.A.; Hegazy, W.A.H. Repurposing anti-diabetic drug “Sitagliptin” as a novel virulence attenuating agent in Serratia marcescens. PLoS ONE 2020, 15, e0231625. [Google Scholar] [CrossRef] [Green Version]
  99. Mavrodi, D.V.; Bonsall, R.F.; Delaney, S.M.; Soule, M.J.; Phillips, G.; Thomashow, L.S. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 2001, 183, 6454–6465. [Google Scholar] [CrossRef] [Green Version]
  100. Nalca, Y.; Jansch, L.; Bredenbruch, F.; Geffers, R.; Buer, J.; Haussler, S. Quorum-sensing antagonistic activities of azithromycin in Pseudomonas aeruginosa PAO1: A global approach. Antimicrob. Agents Chemother. 2006, 50, 1680–1688. [Google Scholar] [CrossRef] [Green Version]
  101. Hegazy, W.A.H.; Abbas, H.A. Evaluation of the role of SsaV ‘Salmonella pathogenicity island-2 dependent type III secretion system components on the virulence behavior of Salmonella enterica serovar Typhimurium. Afr. J. Biotechnol. 2017, 16, 718–726. [Google Scholar] [CrossRef] [Green Version]
  102. Youns, M.; Askoura, M.; Abbas, H.A.; Attia, G.H.; Khayyat, A.N.; Goda, R.M.; Almalki, A.J.; Khafagy, E.S.; Hegazy, W.A.H. Celastrol Modulates Multiple Signaling Pathways to Inhibit Proliferation of Pancreatic Cancer via DDIT3 and ATF3 Up-Regulation and RRM2 and MCM4 Down-Regulation. Onco. Targets. Ther. 2021, 14, 3849–3860. [Google Scholar] [CrossRef] [PubMed]
  103. Parai, D.; Banerjee, M.; Dey, P.; Chakraborty, A.; Islam, E.; Mukherjee, S.K. Effect of reserpine on Pseudomonas aeruginosa quorum sensing mediated virulence factors and biofilm formation. Biofouling 2018, 34, 320–334. [Google Scholar] [CrossRef]
  104. Gruber, J.D.; Chen, W.; Parnham, S.; Beauchesne, K.; Moeller, P.; Flume, P.A.; Zhang, Y.M. The role of 2,4-dihydroxyquinoline (DHQ) in Pseudomonas aeruginosa pathogenicity. PeerJ 2016, 4, e1495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  105. Kim, H.S.; Lee, S.H.; Byun, Y.; Park, H.D. 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Sci. Rep. 2015, 5, 8656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Ijms 23 13088 g001 550
Figure 1. Atenolol shares metoprolol chemical moiety.
Figure 1. Atenolol shares metoprolol chemical moiety.
Ijms 23 13088 g001
Ijms 23 13088 g002 550
Figure 2. (A–C): Blue-Ribbon representation of the three bio-targets, Putative pockets; white color, SA and V were calculated via the online Computed Atlas of Surface Topography of proteins (CASTp; http://sts.bioe.uic.edu/castp/index.html (accessed on 28 May 2022)), (D–F): 3D view of the active site indicating the main amino acid residues lining the pocket.
Figure 2. (A–C): Blue-Ribbon representation of the three bio-targets, Putative pockets; white color, SA and V were calculated via the online Computed Atlas of Surface Topography of proteins (CASTp; http://sts.bioe.uic.edu/castp/index.html (accessed on 28 May 2022)), (D–F): 3D view of the active site indicating the main amino acid residues lining the pocket.
Ijms 23 13088 g002
Ijms 23 13088 g003 550
Figure 3. (A) 3D alignment of Atenolol (Purple) and 3OC12-HSL (Green) in the binding pocket of QScR, (B) Binding interactions of Atenolol (Purple) with key residues of QScR (Green). (C); 2D ligand interactions of atenolol with key residues of QScR.
Figure 3. (A) 3D alignment of Atenolol (Purple) and 3OC12-HSL (Green) in the binding pocket of QScR, (B) Binding interactions of Atenolol (Purple) with key residues of QScR (Green). (C); 2D ligand interactions of atenolol with key residues of QScR.
Ijms 23 13088 g003
Ijms 23 13088 g004 550
Figure 4. 3D binding of Atenolol (Purple) with MrpH active site showing the key amino acid interactions along with the crucial Zn+2 binding (Turquoise).
Figure 4. 3D binding of Atenolol (Purple) with MrpH active site showing the key amino acid interactions along with the crucial Zn+2 binding (Turquoise).
Ijms 23 13088 g004
Ijms 23 13088 g005 550
Figure 5. 3D alignment of Atenolol (Purple) and Glutamate (Green) in the binding pocket of MrpH showing the significant size difference.
Figure 5. 3D alignment of Atenolol (Purple) and Glutamate (Green) in the binding pocket of MrpH showing the significant size difference.
Ijms 23 13088 g005
Ijms 23 13088 g006 550
Figure 6. (A); 3D model of S. marcescens SmaR, HLC is in thick yellow balls indicating the binding pocket, (B); 3D representation of HLC (yellow sticks) in the active site showing interactions with key amino acids (green), H-bond is presented as green dots.
Figure 6. (A); 3D model of S. marcescens SmaR, HLC is in thick yellow balls indicating the binding pocket, (B); 3D representation of HLC (yellow sticks) in the active site showing interactions with key amino acids (green), H-bond is presented as green dots.
Ijms 23 13088 g006
Ijms 23 13088 g007 550
Figure 7. (A) 3D Atenolol-S. marcescens SmaR model interaction diagram, Atenolol is in purple thick sticks within the molecular surface of the active site, amino acid residues of the active site are shown as green thin sticks. H-bond is presented as green dots. Pi-bond is presented as turquoise dots, (B) 2D ligand interactions between atenolol and the key amino acid residues.
Figure 7. (A) 3D Atenolol-S. marcescens SmaR model interaction diagram, Atenolol is in purple thick sticks within the molecular surface of the active site, amino acid residues of the active site are shown as green thin sticks. H-bond is presented as green dots. Pi-bond is presented as turquoise dots, (B) 2D ligand interactions between atenolol and the key amino acid residues.
Ijms 23 13088 g007
Ijms 23 13088 g008 550
Figure 8. Effect of atenolol at sub-MIC on the bacterial growth. (A) The optical densities of the bacterial cultures after overnight growth in the presence or absence of atenolol at sub-MIC (B) The bacterial viable counts in the presence and absence of atenolol at sub-MIC. There was no significant difference between the viable counts and optical densities of untreated controls and atenolol-treated cultures. ns: nonsignificant (p > 0.5).
Figure 8. Effect of atenolol at sub-MIC on the bacterial growth. (A) The optical densities of the bacterial cultures after overnight growth in the presence or absence of atenolol at sub-MIC (B) The bacterial viable counts in the presence and absence of atenolol at sub-MIC. There was no significant difference between the viable counts and optical densities of untreated controls and atenolol-treated cultures. ns: nonsignificant (p > 0.5).
Ijms 23 13088 g008
Ijms 23 13088 g009a 550Ijms 23 13088 g009b 550
Figure 9. Atenolol decreased the bacterial adhesion and biofilm formation. (A) Light microscope images show the marked ability of atenolol to decrease the numbers of adhered bacterial cells to cover slips. (B) The absorbances of crystal violet-stained adhered S. marcescens, P. aeruginosa, and P. mirabilis. (C) The absorbances of crystal violet-stained biofilm forming S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol significantly decreased the adhesion and biofilm formation (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Figure 9. Atenolol decreased the bacterial adhesion and biofilm formation. (A) Light microscope images show the marked ability of atenolol to decrease the numbers of adhered bacterial cells to cover slips. (B) The absorbances of crystal violet-stained adhered S. marcescens, P. aeruginosa, and P. mirabilis. (C) The absorbances of crystal violet-stained biofilm forming S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol significantly decreased the adhesion and biofilm formation (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Ijms 23 13088 g009aIjms 23 13088 g009b
Ijms 23 13088 g010 550
Figure 10. Atenolol crippled S. marcescens, P. aeruginosa, and P. mirabilis. The effects of atenolol on swarming motilities of tested strains were evaluated. Significantly, atenolol diminished the motility of tested bacterial strains (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Figure 10. Atenolol crippled S. marcescens, P. aeruginosa, and P. mirabilis. The effects of atenolol on swarming motilities of tested strains were evaluated. Significantly, atenolol diminished the motility of tested bacterial strains (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Ijms 23 13088 g010
Ijms 23 13088 g011 550
Figure 11. Atenolol decreased the production of (A) Hemolysins, and (B) Protease production in S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol at sub-MIC significantly reduced the production of hemolysins and protease (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Figure 11. Atenolol decreased the production of (A) Hemolysins, and (B) Protease production in S. marcescens, P. aeruginosa, and P. mirabilis. Atenolol at sub-MIC significantly reduced the production of hemolysins and protease (***: p ≤ 0.001). The data are presented as percentage change from untreated controls.
Ijms 23 13088 g011
Ijms 23 13088 g012 550
Figure 12. Atenolol reduced the expression of virulence and QS genes. The expression of S. marcescens motility and adhesion, and P. aeruginosa QS genes were evaluated in the presence of atenolol at sub–MIC. The expression of the tested genes was normalized to the expression of housekeeping genes rplU and rpoD in S. marcescens and P. aeruginosa, respectively (***: p ≤ 0.001).
Figure 12. Atenolol reduced the expression of virulence and QS genes. The expression of S. marcescens motility and adhesion, and P. aeruginosa QS genes were evaluated in the presence of atenolol at sub–MIC. The expression of the tested genes was normalized to the expression of housekeeping genes rplU and rpoD in S. marcescens and P. aeruginosa, respectively (***: p ≤ 0.001).
Ijms 23 13088 g012
Ijms 23 13088 g013 550
Figure 13. Atenolol protected mice from (A) S. marcescens, (B) P. aeruginosa, and (C) P. mirabilis. Atenolol at sub-MIC showed a significant capacity to protect mice from S. marcescens, P. aeruginosa, and P. mirabilis pathogenesis (log rank test for trend p = 0.0289, 0.0025, and 0.0111, respectively). (* p < 0.05, ** p < 0.01).
Figure 13. Atenolol protected mice from (A) S. marcescens, (B) P. aeruginosa, and (C) P. mirabilis. Atenolol at sub-MIC showed a significant capacity to protect mice from S. marcescens, P. aeruginosa, and P. mirabilis pathogenesis (log rank test for trend p = 0.0289, 0.0025, and 0.0111, respectively). (* p < 0.05, ** p < 0.01).
Ijms 23 13088 g013
Table
Table 1. Docking results for both 3OC12-HSL and atenolol with P. aeruginosa quorum-sensing control repressor.
Table 1. Docking results for both 3OC12-HSL and atenolol with P. aeruginosa quorum-sensing control repressor.
LigandRigid Receptor ProtocolInduced-Fit ProtocolH-Bond InteractionsHydrophobic InteractionsIonic-Bond Interactions
S Score Kcal/molRMSDS Score Kcal/molRMSD
Atenolol−7.46141.4216−7.58511.0032Tyr58 and Gly40Ser38, Phe54, Tyr52, Tyr58, Tyr66, Val78 and Met127Asp75
3OC12-HSL−10.42561.2495−10.17741.1676Tyr58, Trp62 and Asp75Ser38, Tyr52, Phe54, Tyr58, Tyr66, Val78 and Met127-
Table
Table 2. Docking results for both glutamate and atenolol with P. mirabilis adhesin MrpH.
Table 2. Docking results for both glutamate and atenolol with P. mirabilis adhesin MrpH.
LigandRigid Receptor ProtocolInduced-Fit ProtocolH-Bond InteractionsHydrophobic Interactionspi-Interactions
S Score Kcal/molRMSDS Score Kcal/molRMSD
Atenolol−6.39371.5832−7.20111.1977Ala84 and Arg118.
In addition to ionic bond with zinc metal		Asn82, Ala84, Phe85, Thr115 Thr116, Arg118 and Ile140Asn82
(pi-H)
Glutamate−8.23830.9710−8.43321.4964Asn 82, Thr116, His117 and Arg118.
In addition to ionic bond with zinc metal		Asn 82, Thr116, Arg118 and Ile140-
Table
Table 3. Docking results for both HLC and atenolol with S. marcescens SmaR.
Table 3. Docking results for both HLC and atenolol with S. marcescens SmaR.
LigandRigid Receptor ProtocolInduced-Fit ProtocolInteractions
S Score Kcal/molRMSDS Score Kcal/molRMSDH-Bond Hydrophobic IonicPi
Atenolol−5.99271.2627−5.76531.0260Asp66Phe44, Phe54, Tyr57, Asp66, Val68, Trp81 and Ile105 Asp66Phe44,
Tyr57 and Trp81
HLC−6.94841.3639−7.17611.3923Trp53Ala32, Phe44, Tyr57, Trp81, Ile105, Val122 and Ser124--
Table
Table 4. The primers used in this study.
Table 4. The primers used in this study.
Target GeneSequence (5′–3′)Gene SignificanceReference
lasIFor: CTACAGCCTGCAGAACGACA
Rev: ATCTGGGTCTTGGCATTGAG		P. aeruginosa QS autoinducer synthetase[103]
lasRFor: ACGCTCAAGTGGAAAATTGG
Rev: GTAGATGGACGGTTCCCAGA		P. aeruginosa QS receptor[103]
rhlIFor: CTCTCTGAATCGCTGGAAGG
Rev: GACGTCCTTGAGCAGGTAGG		P. aeruginosa QS autoinducer synthetase[103]
rhlRFor: AGGAATGACGGAGGCTTTTT
Rev: CCCGTAGTTCTGCATCTGGT		P. aeruginosa QS receptor[103]
pqsAFor: TTCTGTTCCGCCTCGATTTC
Rev: AGTCGTTCAACGCCAGCAC		P. aeruginosa QS autoinducer synthetase[104]
pqsRFor: AACCTGGAAATCGACCTGTG
Rev: TGAAATCGTCGAGCAGTACG		P. aeruginosa QS receptor[103]
rpoDFor: GGGCGAAGAAGGAAATGGTC
Rev: CAGGTGGCGTAGGTGGAGAAC		Housekeeping for P. aeruginosa genes[104]
fimAFor: ACTACACCCTGCGTTTCGAC
Rev: GCGTTAGAGTTTGCCTGACC		S. marcescens fimbria[77]
fimCFor: AAGATCGCACCGTACAAACC
Rev: TTTGCACCGCATAGTTCAAG		S. marcescens fimbria[77]
flhcFor: AAGAAGCCAAGGACATTCAG
Rev: TTCCCAGGTCATAAACCAGT		S. marcescens flagella[29]
flhDFor: TGTCGGGATGGGGAATATGG
Rev: CGATAGCTCTTGCAGTAAATGG		S. marcescens flagella[29]
bsmBFor:CCGCCTGCAAGAAAGAACTT
Rev: AGAGATCGACGGTCAGTTCC		S. marcescens type I pilus[29]
rsmAFor: TTGGTGAAACCCTCATGATT
Rev: GCTTCGGAATCAGTAAGTCG		S. marcescens motility[29]
rssBFor:TAACGAACTGCTGATGCTGT
Rev: GATCTTGCGCCGTAAATTAT		S. marcescens motility[29]
rplUFor: GCTTGGAAAAGCTGGACATC
Rev: TACGGTGGTGTTTACGACGA		Housekeeping for S. marcescens genes[29]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Cavalu, S.; Elbaramawi, S.S.; Eissa, A.G.; Radwan, M.F.; S. Ibrahim, T.; Khafagy, E.-S.; Lopes, B.S.; Ali, M.A.M.; Hegazy, W.A.H.; Elfaky, M.A. Characterization of the Anti-Biofilm and Anti-Quorum Sensing Activities of the β-Adrenoreceptor Antagonist Atenolol against Gram-Negative Bacterial Pathogens. Int. J. Mol. Sci. 2022, 23, 13088. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232113088

AMA Style

Cavalu S, Elbaramawi SS, Eissa AG, Radwan MF, S. Ibrahim T, Khafagy E-S, Lopes BS, Ali MAM, Hegazy WAH, Elfaky MA. Characterization of the Anti-Biofilm and Anti-Quorum Sensing Activities of the β-Adrenoreceptor Antagonist Atenolol against Gram-Negative Bacterial Pathogens. International Journal of Molecular Sciences. 2022; 23(21):13088. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232113088

Chicago/Turabian Style

Cavalu, Simona, Samar S. Elbaramawi, Ahmed G. Eissa, Mohamed F. Radwan, Tarek S. Ibrahim, El-Sayed Khafagy, Bruno Silvester Lopes, Mohamed A. M. Ali, Wael A. H. Hegazy, and Mahmoud A. Elfaky. 2022. "Characterization of the Anti-Biofilm and Anti-Quorum Sensing Activities of the β-Adrenoreceptor Antagonist Atenolol against Gram-Negative Bacterial Pathogens" International Journal of Molecular Sciences 23, no. 21: 13088. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232113088

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop