Assessment of Microbiological Quality and Mycotoxin in Dried Chili by Morphological Identification, Molecular Detection, and Chromatography Analysis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Chemicals and Reagents
2.3. Fungal Occurrence in Chilis
2.4. Isolation and Identification of Fungi from Dried Chili and Chili Powder
2.5. Molecular Identification of AF and OTA-Producing Isolates
2.6. Mycotoxin Extraction from Dried Chili
2.7. Mycotoxin Determination by HPLC
2.8. Experimental Design and Data Analysis
3. Results
3.1. Microbiota of Dried and Powdered Chili
3.2. Identification of Aspergillus Spp. Fungi on Dried Chili and Chili Powder
3.3. Molecular Detection of Mycotoxin Production Genes
3.4. AF and OTA Concentration on Dried Chili and Chili Powder
4. Discussion
Is Indonesian Chili more Contaminated than in Other Countries?
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Eurostat. Available online: https://ec.europa.eu/eurostat (accessed on 10 September 2018).
- Rapid Alert System for Food and Feed. Available online: https://webgate.ec.europa.eu/rasff-window/portal/?event=searchForm&cleanSearch=1 (accessed on 10 September 2018).
- Eaton, D.L.; Gallagher, E.P. Mechanisms of Aflatoxin Carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 1994, 34, 135–172. [Google Scholar] [CrossRef] [PubMed]
- Sweeney, M.J.; Dobson, A.D.W. Mycotoxin production by Aspergillus, Fusarium and Penicilliium species. Int. J. Food Microbiol. 1998, 43, 141–158. [Google Scholar] [CrossRef]
- International Agency for Research on Cancer. Some Naturally Occurring Substances, Food Items and Constituents, Heterocyclic Aromatic Amines and Mycotoxins. In Proceedings of the IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans, Lyon, France, 9–16 June 1992. [Google Scholar]
- Bellí, N.; Ramos, A.J.; Sanchis, V.; Marín, S. Incubation time and water activity effects on ochratoxin a production by Aspergillus section Nigri strains isolated from grapes. Lett. Appl. Microbiol. 2004, 38, 72–77. [Google Scholar] [CrossRef] [PubMed]
- Ikoma, T.; Tsuchiya, Y.; Asai, T.; Okano, K.; Ito, N.; Endoh, K.; Yamamoto, M.; Nakamura, K. Ochratoxin A contamination of red chili peppers from Chile, Bolivia and Peru, countries with a high incidence of gallbladder cancer. Asian Pac. J. Cancer Prev. 2015, 16, 5987–5991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- European Commission Opinion of the Scientific Committee on Food on Ochratoxin A (Expressed on 17 September 1998). Available online: https://ec.europa.eu/food/sites/food/files/safety/docs/sci-com_scf_out14_en.pdf (accessed on 10 September 2017).
- Wagacha, J.M.; Muthomi, J.W. Mycotoxin problem in Africa: Current status, implications to food safety and health and possible management strategies. Int. J. Food Microbiol. 2008, 124, 1–12. [Google Scholar] [CrossRef]
- Bhat, R.V.; Vasanthi, S. Food Safety in Food Security and Food Trade, Mycotoxin Food Safety Risk in Developing Countries. Int. Food Policy Res. Institute Br. 2003, 10, 3–17. [Google Scholar] [CrossRef]
- Set, E.; Erkmen, O. Occurrence of aflatoxins in ground red chili pepper and pistachio nut. Int. J. Food Prop. 2014, 17, 2322–2331. [Google Scholar] [CrossRef]
- Iqbal, S.Z.; Paterson, R.R.M.; Bhatti, I.A.; Asi, M.R.; Sheikh, M.A.; Bhatti, H.N. Aflatoxin B1in chilies from the Punjab region, Pakistan. Mycotoxin Res. 2010, 26, 205–209. [Google Scholar] [CrossRef] [Green Version]
- Jalili, M.; Jinap, S. Natural occurrence of aflatoxins and ochratoxin A in commercial dried chili. Food Control 2012, 24, 160–164. [Google Scholar] [CrossRef]
- Roy, M.; Harris, J.; Afreen, S.; Deak, E.; Gade, L.; Balajee, S.A.; Park, B.; Chiller, T.; Luby, S. Aflatoxin contamination in food commodities in Bangladesh. Food Addit. Contam. Part B 2013, 6, 17–23. [Google Scholar] [CrossRef]
- Hammami, W.; Fiori, S.; Al Thani, R.; Ali Kali, N.; Balmas, V.; Migheli, Q.; Jaoua, S. Fungal and aflatoxin contamination of marketed spices. Food Control 2014, 37, 177–181. [Google Scholar] [CrossRef]
- Gherbawy, Y.A.; Shebany, Y.M.; Hussein, M.A.; Maghraby, T.A. Molecular detection of mycobiota and aflatoxin contamination of chili. Arch. Biol. Sci. 2015, 67, 223–234. [Google Scholar] [CrossRef]
- Food and Agriculture Organization. Available online: http://www.faostat.org/ (accessed on 5 May 2017).
- Rahayu, E.S.; Sardjono, S.; Samson, R.A. Jamur Benang (Mold) Pada Bahan Pangan; PT Kanisius: Yogyakarta, Indonesia, 2014. [Google Scholar]
- Samson, R.; Houbraken, J.; Thrane, U.; Frisvad, J.C.; Andersen, B. Food and Indoor Fungi; CBS-KNAW Fungal Biodiversity Centre: Utrecht, The Netherlands, 2010. [Google Scholar]
- Klich, M.A.; Pit, J.I. A Laboratory Guide to Common Aspergillus Species and Teir Teleomorphs; CSIRO Division of Food Science and Technology, North Ryde: Sydney, NSW, Australia, 1988. [Google Scholar]
- Samson, R.; Hoekstra, E.; Frisvad, J.C.; Filtenborg, O. Introduction to Food and Airborne Fungi, 7th ed.; Centraalbureau voor Schimmelcultures: Utrecht, The Netherlands, 2004. [Google Scholar]
- Mohana, D.C.; Thippeswamy, S.; Abhishek, R.U.; Shobha, B.; Mamatha, M.G. Studies on seed-borne mycoflora and aflatoxin B1 contaminations in food based seed samples: Molecular detection of mycotoxigenic Aspergillus flavus and their management. Int. Food Res. J. 2016, 23, 2689–2694. [Google Scholar]
- Geisen, R. Multiplex Polymerase Chain Reaction for the Detection of Potential Aflatoxin and Sterigmatocystin Producing Fungi. Syst. Appl. Microbiol. 1996, 19, 388–392. [Google Scholar] [CrossRef]
- Scherm, B.; Palomba, M.; Serra, D.; Marcello, A.; Migheli, Q. Detection of transcripts of aflatoxin genes aflD, aflO, and aflP by reverse transcription-polymerase chain reaction allows differentiation of aflatoxin-producing and non- producing isolates of Aspergillus flavus and Aspergillus parasiticus. Int. J. Food Microbiol. 2005, 98, 201–210. [Google Scholar] [CrossRef]
- Bokhari, F.M. Spices Mycobiota and Mycotoxins Available in Saudi Arabia and Their Abilities to Inhibit Growth of Some Toxigenic Fungi. Mycobiology 2007, 35, 47. [Google Scholar] [CrossRef] [Green Version]
- Santos, L.; Marín, S.; Mateo, E.M.; Gil-Serna, J.; Valle-Algarra, F.M.; Patiño, B.; Ramos, A.J. Mycobiota and co-occurrence of mycotoxins in Capsicum powder. Int. J. Food Microbiol. 2011, 151, 270–276. [Google Scholar] [CrossRef]
- Salari, R.; Najafi, M.B.H.; Boroushaki, M.T.; Mortazavi, S.A.; Najafi, M.F. Assessment of the microbiological quality and mycotoxin contamination of iranian red pepper spice. J. Agric. Sci. Technol. 2012, 14, 1511–1521. [Google Scholar]
- Ham, H.; Kim, S.; Kim, M.H.; Lee, S.; Hong, S.K.; Ryu, J.G.; Lee, T. Mycobiota of ground red pepper and their aflatoxigenic potential. J. Microbiol. 2016, 54, 832–837. [Google Scholar] [CrossRef]
- Mandeel, Q.A. Fungal contamination of some imported spices. Mycopathologia 2005, 159, 291–298. [Google Scholar] [CrossRef]
- Sardiñas, N.; Gil-Serna, J.; Santos, L.; Ramos, A.J.; González-Jaén, M.T.; Patiño, B.; Vázquez, C. Detection of potentially mycotoxigenic Aspergillus species in Capsicum powder by a highly sensitive PCR-based detection method. Food Control 2011, 22, 1363–1366. [Google Scholar] [CrossRef]
- Yu, J.; Cleveland, T.E. Aspergillus flavus Genomics for Discovering Genes Involved in Aflatoxin Biosynthesis. In Polyketides; ACS Symposium Series; American Chemical Society: Washington, DC, USA, 2007; Volume 955, pp. 17–246. ISBN 0-8412-3978-9. [Google Scholar]
- Tami, M.D.; Hammond, T.; Noordermee, D.; Zhang, Y.Q.; Keller, N. The Sterigmatocystin Cluster Revisited: Lesson from a Genetic Model. In Aflatoxin and Safety; CRC Press: New York, NY, USA, 2005. [Google Scholar]
- Woloshuk, C.P.; Foutz, K.R.; Brewer, J.F.; Bhatnagar, D.; Cleveland, T.E.; Payne, G.A. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Appl. Environ. Microbiol. 1994, 60, 2408–2414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, P.K.; Yu, J.; Bhatnagar, D.; Cleveland, T.E. Repressor-AFLR interaction modulates aflatoxin biosynthesis in Aspergillus parasiticus. Mycopathologia 1999, 147, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Xu, H.-L.; Show, K.-Y.; Tay, J.-H. Anaerobic granulation technology for wastewater treatment. World J. Microbiol. Biotechnol. 2002, 18, 99–113. [Google Scholar] [CrossRef]
- Diao, E.; Dong, H.; Hou, H.; Zhang, Z.; Ji, N.; Ma, W. Factors influencing aflatoxin contamination in before and after harvest peanuts: A review. J. Food Res. 2015, 4, 148–154. [Google Scholar] [CrossRef]
- Alborch, L.; Bragulat, M.R.; Castellá, G.; Abarca, M.L.; Cabañes, F.J. Mycobiota and mycotoxin contamination of maize flours and popcorn kernels for human consumption commercialized in Spain. Food Microbiol. 2012, 32, 97–103. [Google Scholar] [CrossRef]
- Marín, S.; Colom, C.; Sanchis, V.; Ramos, A.J. Modelling of growth of aflatoxigenic A. flavus isolates from red chilli powder as a function of water availability. Int. J. Food Microbiol. 2009, 128, 491–496. [Google Scholar] [CrossRef]
- Khan, M.A.; Asghar, M.A.; Iqbal, J.; Ahmed, A.; Shamsuddin, Z.A. Aflatoxins contamination and prevention in red chillies (Capsicum annuum L.) in Pakistan. Food Addit. Contam. Part B 2014, 7, 1–6. [Google Scholar] [CrossRef]
- United States Food and Drug Administration Guidance for Industry: Action Levels for Poisonous or Deleterious Substances in Human Food and Animal Feed. Available online: https://www.fda.gov/food/guidanceregulation/guidancedocumentsregulatoryinformation/chemicalcontaminantsmetalsnaturaltoxinspesticides/ucm077969.htm (accessed on 15 May 2017).
- Turkish Food Codex. Regulation No. 2011/28157, the Maximum Allowed Level of Food Contaminants; Official Gazette of Publication: Ankara, Turkey, 2011. [Google Scholar]
- European Commission (EC). Regulation No: 165/2010 of 26 February 2010 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union 2010, L 50/8-12.
- Duman, A.D. Storage of red chili pepper under hermetically sealed or vacuum conditions for preservation of its quality and prevention of mycotoxin occurrence. J. Stored Prod. Res. 2010, 46, 155–160. [Google Scholar] [CrossRef]
Genes | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
---|---|---|
AflR | CGCGCTCCCAGTCCCCTTGATT | CTTGTTCCCGATGACCA |
Nor-1 | ACCGCTCCGGCACTCTCGGCA | GTTGGCCGCCAGCTTCGACACAGC |
OmtB | GCCTTGACATGGAAACCATC | CCAAGATGGCCTGCTCTTTA |
AcPKS | GCAGCGGGAGTCAATGTAAT | GCGTCGTACAAAGCCTCTT |
AnPKS | ACGGTAAACGTCCTGGATGA | CGTGCTGTTGAAGCCACTT |
Genes | Cycle | Denaturation | Annealing | Extension | Final Extension |
---|---|---|---|---|---|
aflR | 35 | 94 °C, 60 s | 62 °C, 60 s | 72 °C, 120 s | 72 °C, 600 s |
nor-1 | 30 | 95 °C, 60 s | 65 °C, 120 s | 72 °C, 240 s | 72 °C, 600 s |
omtB | 35 | 94 °C, 60 s | 55 °C, 60 s | 72 °C, 60 s | 72 °C, 600 s |
AnPKS | 35 | 95 °C, 10 s | 52 °C, 10 s | 72 °C, 15 s | 72 °C, 300 s |
AcPKS | 35 | 95 °C, 10 s | 62 °C, 10 s | 72 °C, 15 s | 72 °C, 300 s |
No. | Form, Type of Market | A. flavus | A. parasiticus | A. carbonarius | A. niger | A. japonicus |
---|---|---|---|---|---|---|
1 | Powder, traditional | 0 | 1 | 1 | 0 | 0 |
2 | Powder, traditional | 0 | 1 | 0 | 1 | 0 |
3 | Whole, traditional | 0 | 1 | 1 | 0 | 0 |
4 | Whole, traditional | 0 | 1 | 0 | 0 | 0 |
5 | Whole, traditional | 0 | 0 | 0 | 0 | 0 |
6 | Whole, traditional | 0 | 1 | 1 | 0 | 0 |
7 | Whole, traditional | 1 | 0 | 0 | 0 | 0 |
8 | Whole, traditional | 0 | 1 | 0 | 0 | 1 |
9 | Powder, modern | 0 | 0 | 0 | 0 | 0 |
10 | Powder, modern | 1 | 0 | 1 | 0 | 0 |
11 | Powder, modern | 1 | 1 | 0 | 0 | 1 |
12 | Ground, modern | 0 | 0 | 1 | 0 | 0 |
13 | Powder, modern | 1 | 0 | 1 | 0 | 1 |
14 | Powder, modern | 0 | 0 | 0 | 0 | 0 |
15 | Powder, modern | 4 | 1 | 0 | 0 | 0 |
Total | 8 | 8 | 6 | 1 | 3 | |
Frequency (%), n = 26 | 30.77 | 30.77 | 23.08 | 3.85 | 11.54 |
No | Isolates | Species | aflR | OmtB | Nor-1 | AnPKS | AcPKS |
---|---|---|---|---|---|---|---|
2 | 2B1 | Aspergillus niger | + | - | + | - | - |
11 | 11G1 | Aspergillus flavus | + | + | + | n.d | n.d. |
11G2 | Aspergillus parasiticus | + | - | + | n.d | n.d. | |
11B1 | Aspergillus japonicus | + | + | - | n.d | n.d. | |
12 | 12B1 | Aspergillus carbonarius | + | - | - | - | + |
15 | 15G5 | Aspergillus flavus | + | + | + | n.d | n.d. |
Sample | AFs (µg/kg) | OTA (µg/kg) | ||
---|---|---|---|---|
B1 | B2 | G1 + G2 | ||
2 | 139.5 ± 0.7 | 12.8 ± 0.5 | n.d. * | n.d. |
3 | n.d. | n.d. | n.d. | 26.3 ± 0.7 |
6 | n.d. | n.d. | n.d. | n.d. |
8 | n.d. | n.d. | n.d. | n.d. |
12 | 39.3 ± 0.7 | 2.6 ± 0.5 | n.d. | 23.7 ± 0.7 |
15 | 100.1 ± 0.7 | 33.3 ± 0.5 | n.d. | 84.6 ± 0.7 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wikandari, R.; Mayningsih, I.C.; Sari, M.D.P.; Purwandari, F.A.; Setyaningsih, W.; Rahayu, E.S.; Taherzadeh, M.J. Assessment of Microbiological Quality and Mycotoxin in Dried Chili by Morphological Identification, Molecular Detection, and Chromatography Analysis. Int. J. Environ. Res. Public Health 2020, 17, 1847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17061847
Wikandari R, Mayningsih IC, Sari MDP, Purwandari FA, Setyaningsih W, Rahayu ES, Taherzadeh MJ. Assessment of Microbiological Quality and Mycotoxin in Dried Chili by Morphological Identification, Molecular Detection, and Chromatography Analysis. International Journal of Environmental Research and Public Health. 2020; 17(6):1847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17061847
Chicago/Turabian StyleWikandari, Rachma, Inggrid Chrisanti Mayningsih, Maura Dania Permata Sari, Fiametta Ayu Purwandari, Widiastuti Setyaningsih, Endang Sutriswati Rahayu, and Mohammad J. Taherzadeh. 2020. "Assessment of Microbiological Quality and Mycotoxin in Dried Chili by Morphological Identification, Molecular Detection, and Chromatography Analysis" International Journal of Environmental Research and Public Health 17, no. 6: 1847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17061847