Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Viral Stocks
2.3. Purification of CRCoV
2.4. Antibodies to CRCoV N Protein
2.5. Western Blot Analysis
2.6. Hemagglutination Assay
2.7. Virus Attachment
2.8. Confocal Microscopy
2.9. Flow Cytometry
2.10. Virus Replication
2.11. Reverse Transcription Quantitative PCR (RT-qPCR)
2.12. Resialylation
2.13. Data Analysis
2.14. Ethics Statement
3. Results
3.1. HCoV-OC43, BCoV, and CRCoV Use SAs to Attach to Target Cells
3.2. SAs Did Not Facilitate Entry of CRCoV, BCoV, and HCoV-OC43 VR-1558 to HRT-18G Cells
3.3. Restoration of SAs on the Cell Surface Rescues Attachment of CRCoV, BCoV, and HCoV-OC43 VR-1558
3.4. Interaction with HLA-I Molecules
3.5. Involvement of HS and Lectins
3.6. Attachment Receptors and Adaptation during Cell Culture
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- King, M.Q.A.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E.J. Virus Taxonomy Classification and Nomenclature of Viruses; Springer: Vienna, Austria, 2012. [Google Scholar]
- Burkard, C.; Verheije, M.H.; Wicht, O.; van Kasteren, S.I.; van Kuppeveld, F.J.; Haagmans, B.L.; Pelkmans, L.; Rottier, P.J.; Bosch, B.J.; de Haan, C.A. Coronavirus cell entry occurs through the endo-/lysosomal pathway in a proteolysis-dependent manner. PLoS Pathog. 2014, 10, e1004502. [Google Scholar] [CrossRef]
- Pyrc, K.; Berkhout, B.; van der Hoek, L. The novel human coronaviruses NL63 and HKU1. J. Virol. 2007, 81, 3051–3057. [Google Scholar] [CrossRef] [PubMed]
- Zaki, A.M.; van Boheemen, S.; Bestebroer, T.M.; Osterhaus, A.D.; Fouchier, R.A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 2012, 367, 1814–1820. [Google Scholar] [CrossRef]
- Mackay, I.M.; Arden, K.E. MERS coronavirus: Diagnostics, epidemiology and transmission. Virol. J. 2015, 12, 222. [Google Scholar] [CrossRef]
- Chan, J.F.; Lau, S.K.; To, K.K.; Cheng, V.C.; Woo, P.C.; Yuen, K.Y. Middle East respiratory syndrome coronavirus: Another zoonotic betacoronavirus causing SARS-like disease. Clin. Microbiol. Rev. 2015, 28, 465–522. [Google Scholar] [PubMed]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Vlasak, R.; Luytjes, W.; Spaan, W.; Palese, P. Human and bovine coronaviruses recognize sialic acid-containing receptors similar to those of influenza C viruses. Proc. Natl. Acad. Sci. USA 1988, 85, 4526–4529. [Google Scholar] [CrossRef] [PubMed]
- Schultze, B.; Gross, H.J.; Brossmer, R.; Herrler, G. The s protein of bovine coronavirus is a hemagglutinin recognizing 9-O-acetylated sialic acid as a receptor determinant. J. Virol. 1991, 65, 6232–6237. [Google Scholar] [PubMed]
- Schultze, B.; Herrler, G. Bovine coronavirus uses n-acetyl-9-o-acetylneuraminic acid as a receptor determinant to initiate the infection of cultured cells. J. Gen. Virol. 1992, 73 Pt 4, 901–906. [Google Scholar] [CrossRef]
- Schwegmann-Wessels, C.; Herrler, G. Sialic acids as receptor determinants for coronaviruses. Glycoconj. J. 2006, 23, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Dong, W.; Milewska, A.; Golda, A.; Qi, Y.; Zhu, Q.K.; Marasco, W.A.; Baric, R.S.; Sims, A.C.; Pyrc, K.; et al. Human coronavirus HKU1 spike protein uses O-acetylated sialic acid as an attachment receptor determinant and employs hemagglutinin-esterase protein as a receptor-destroying enzyme. J. Virol. 2015, 89, 7202–7213. [Google Scholar]
- Strasser, P.; Unger, U.; Strobl, B.; Vilas, U.; Vlasak, R. Recombinant viral sialate-O-acetylesterases. Glycoconj. J. 2004, 20, 551–561. [Google Scholar] [PubMed]
- Collins, A.R. Human coronavirus OC43 interacts with major histocompatibility complex class I molecules at the cell surface to establish infection. Immunol. Investig. 1994, 23, 313–321. [Google Scholar] [CrossRef]
- Collins, A.R. HLA class I antigen serves as a receptor for human coronavirus OC43. Immunol. Investig. 1993, 22, 95–103. [Google Scholar]
- Chan, C.M.; Lau, S.K.; Woo, P.C.; Tse, H.; Zheng, B.J.; Chen, L.; Huang, J.D.; Yuen, K.Y. Identification of major histocompatibility complex class I C molecule as an attachment factor that facilitates coronavirus HKU1 spike-mediated infection. J. Virol. 2009, 83, 1026–1035. [Google Scholar] [CrossRef] [PubMed]
- Vijgen, L.; Keyaerts, E.; Moes, E.; Thoelen, I.; Wollants, E.; Lemey, P.; Vandamme, A.M.; Van Ranst, M. Complete genomic sequence of human coronavirus OC43: Molecular clock analysis suggests a relatively recent zoonotic coronavirus transmission event. J. Virol. 2005, 79, 1595–1604. [Google Scholar] [CrossRef]
- Kin, N.; Miszczak, F.; Diancourt, L.; Caro, V.; Moutou, F.; Vabret, A.; Ar Gouilh, M. Comparative molecular epidemiology of two closely related coronaviruses, bovine coronavirus (BCoV) and human coronavirus OC43 (HCoV-OC43), reveals a different evolutionary pattern. Infect. Genet. Evol. 2016, 40, 186–191. [Google Scholar] [CrossRef]
- Lim, Y.X.; Ng, Y.L.; Tam, J.P.; Liu, D.X. Human coronaviruses: A review of virus-host interactions. Diseases 2016, 4, 26. [Google Scholar]
- Decaro, N.; Buonavoglia, C. An update on canine coronaviruses: Viral evolution and pathobiology. Vet. Microbiol. 2008, 132, 221–234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Priestnall, S.L.; Brownlie, J.; Dubovi, E.J.; Erles, K. Serological prevalence of canine respiratory coronavirus. Vet. Microbiol. 2006, 115, 43–53. [Google Scholar] [CrossRef] [PubMed]
- Erles, K.; Shiu, K.B.; Brownlie, J. Isolation and sequence analysis of canine respiratory coronavirus. Virus Res. 2007, 124, 78–87. [Google Scholar] [PubMed]
- Bok, M.; Mino, S.; Rodriguez, D.; Badaracco, A.; Nunes, I.; Souza, S.P.; Bilbao, G.; Louge Uriarte, E.; Galarza, R.; Vega, C.; et al. Molecular and antigenic characterization of bovine coronavirus circulating in argentinean cattle during 1994–2010. Vet. Microbiol. 2015, 181, 221–229. [Google Scholar] [PubMed]
- Bidokhti, M.R.; Traven, M.; Krishna, N.K.; Munir, M.; Belak, S.; Alenius, S.; Cortey, M. Evolutionary dynamics of bovine coronaviruses: Natural selection pattern of the spike gene implies adaptive evolution of the strains. J. Gen. Virol. 2013, 94, 2036–2049. [Google Scholar] [CrossRef] [PubMed]
- Hick, P.M.; Read, A.J.; Lugton, I.; Busfield, F.; Dawood, K.E.; Gabor, L.; Hornitzky, M.; Kirkland, P.D. Coronavirus infection in intensively managed cattle with respiratory disease. Aust. Vet. J. 2012, 90, 381–386. [Google Scholar] [PubMed]
- Erles, K.; Toomey, C.; Brooks, H.W.; Brownlie, J. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease. Virology 2003, 310, 216–223. [Google Scholar] [CrossRef] [Green Version]
- Kaneshima, T.; Hohdatsu, T.; Hagino, R.; Hosoya, S.; Nojiri, Y.; Murata, M.; Takano, T.; Tanabe, M.; Tsunemitsu, H.; Koyama, H. The infectivity and pathogenicity of a group 2 bovine coronavirus in pups. J. Vet. Med. Sci. 2007, 69, 301–303. [Google Scholar] [CrossRef]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar]
- Milewska, A.; Kaminski, K.; Ciejka, J.; Kosowicz, K.; Zeglen, S.; Wojarski, J.; Nowakowska, M.; Szczubialka, K.; Pyrc, K. HTCC: Broad range inhibitor of coronavirus entry. PLoS ONE 2016, 11, e0156552. [Google Scholar] [CrossRef]
- Peters, J.H.; Baumgarten, H. Monoclonal Antibodies; Springer: Berlin/Heidelberg, Germany, 1992. [Google Scholar]
- Kumari, K.; Gulati, S.; Smith, D.F.; Gulati, U.; Cummings, R.D.; Air, G.M. Receptor binding specificity of recent human H3N2 influenza viruses. Virol. J. 2007, 4, 42. [Google Scholar]
- Milewska, A.; Zarebski, M.; Nowak, P.; Stozek, K.; Potempa, J.; Pyrc, K. Human coronavirus NL63 utilizes heparan sulfate proteoglycans for attachment to target cells. J. Virol. 2014, 88, 13221–13230. [Google Scholar] [CrossRef] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Van der Hoek, L.; Pyrc, K.; Jebbink, M.F.; Vermeulen-Oost, W.; Berkhout, R.J.; Wolthers, K.C.; Wertheim-van Dillen, P.M.; Kaandorp, J.; Spaargaren, J.; Berkhout, B. Identification of a new human coronavirus. Nat. Med. 2004, 10, 368–373. [Google Scholar]
- Allen, J.D.; Ross, T.M. H3N2 influenza viruses in humans: Viral mechanisms, evolution, and evaluation. Hum. Vaccines Immunother. 2018, 14, 1840–1847. [Google Scholar] [CrossRef] [PubMed]
- Krempl, C.; Schultze, B.; Herrler, G. Analysis of cellular receptors for human coronavirus OC43. Adv. Exp. Med. Biol. 1995, 380, 371–374. [Google Scholar]
- Owczarek, K.; Szczepanski, A.; Microbiology Department, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland. Sugar moieties and their role in infectio. Material not intended for publication. 2018. [Google Scholar]
- Shirato, K.; Kawase, M.; Matsuyama, S. Wild-type human coronaviruses prefer cell-surface TMPRSS2 to endosomal cathepsins for cell entry. Virology 2017, 517, 9–15. [Google Scholar]
- Li, W.; Moore, M.J.; Vasilieva, N.; Sui, J.; Wong, S.K.; Berne, M.A.; Somasundaran, M.; Sullivan, J.L.; Luzuriaga, K.; Greenough, T.C.; et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 2003, 426, 450–454. [Google Scholar] [CrossRef]
- Kuba, K.; Imai, Y.; Rao, S.; Gao, H.; Guo, F.; Guan, B.; Huan, Y.; Yang, P.; Zhang, Y.; Deng, W.; et al. A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury. Nat. Med. 2005, 11, 875–879. [Google Scholar] [CrossRef]
- To, K.F.; Lo, A.W. Exploring the pathogenesis of severe acute respiratory syndrome (SARS): The tissue distribution of the coronavirus (SARS-COV) and its putative receptor, angiotensin-converting enzyme 2 (ACE2). J. Pathol. 2004, 203, 740–743. [Google Scholar]
- Marzi, A.; Gramberg, T.; Simmons, G.; Moller, P.; Rennekamp, A.J.; Krumbiegel, M.; Geier, M.; Eisemann, J.; Turza, N.; Saunier, B.; et al. DC-SIGN and DC-SIGNR interact with the glycoprotein of Marburg virus and the S protein of severe acute respiratory syndrome coronavirus. J. Virol. 2004, 78, 12090–12095. [Google Scholar] [CrossRef]
- Yang, Z.Y.; Huang, Y.; Ganesh, L.; Leung, K.; Kong, W.P.; Schwartz, O.; Subbarao, K.; Nabel, G.J. PH-dependent entry of severe acute respiratory syndrome coronavirus is mediated by the spike glycoprotein and enhanced by dendritic cell transfer through DC-sign. J. Virol. 2004, 78, 5642–5650. [Google Scholar] [CrossRef]
- Chan, V.S.; Chan, K.Y.; Chen, Y.; Poon, L.L.; Cheung, A.N.; Zheng, B.; Chan, K.H.; Mak, W.; Ngan, H.Y.; Xu, X.; et al. Homozygous L-SIGN (CLEC4M) plays a protective role in SARS coronavirus infection. Nat. Genet. 2006, 38, 38–46. [Google Scholar] [CrossRef]
- Han, D.P.; Lohani, M.; Cho, M.W. Specific asparagine-linked glycosylation sites are critical for DC-SIGN- and L-SIGN-mediated severe acute respiratory syndrome coronavirus entry. J. Virol. 2007, 81, 12029–12039. [Google Scholar] [CrossRef]
- Yu, Y.T.; Chien, S.C.; Chen, I.Y.; Lai, C.T.; Tsay, Y.G.; Chang, S.C.; Chang, M.F. Surface vimentin is critical for the cell entry of SARS-CoV. J. Biomed. Sci. 2016, 23, 14. [Google Scholar] [CrossRef]
- Wang, N.; Shi, X.; Jiang, L.; Zhang, S.; Wang, D.; Tong, P.; Guo, D.; Fu, L.; Cui, Y.; Liu, X.; et al. Structure of MERS-CoV spike receptor-binding domain complexed with human receptor DPP4. Cell Res. 2013, 23, 986–993. [Google Scholar] [CrossRef] [Green Version]
- Gao, W.; He, W.; Zhao, K.; Lu, H.; Ren, W.; Du, C.; Chen, K.; Lan, Y.; Song, D.; Gao, F. Identification of NCAM that interacts with the PHE-CoV spike protein. Virol. J. 2010, 7, 254. [Google Scholar] [CrossRef]
- Qian, Z.; Ou, X.; Goes, L.G.; Osborne, C.; Castano, A.; Holmes, K.V.; Dominguez, S.R. Identification of the receptor-binding domain of the spike glycoprotein of human betacoronavirus HKU1. J. Virol. 2015, 89, 8816–8827. [Google Scholar] [CrossRef]
- Mwangi, D.W.; Bansal, D.D. Evidence of free radical participation in n-glycolylneuraminic acid generation in liver of chicken treated with Gallotannic acid. Indian J. Biochem. Biophys. 2004, 41, 20–28. [Google Scholar]
- Hashimoto, Y.; Yamakawa, T.; Tanabe, Y. Further studies on the red cell glycolipids of various breeds of dogs. A possible assumption about the origin of Japanese dogs. J. Biochem. 1984, 96, 1777–1782. [Google Scholar] [CrossRef]
- Davies, L.R.; Varki, A. Why is N-glycolylneuraminic acid rare in the vertebrate brain? Top. Curr. Chem. 2015, 366, 31–54. [Google Scholar]
- Yasue, S.; Handa, S.; Miyagawa, S.; Inoue, J.; Hasegawa, A.; Yamakawa, T. Difference in form of sialic acid in red blood cell glycolipids of different breeds of dogs. J. Biochem. 1978, 83, 1101–1107. [Google Scholar] [CrossRef] [PubMed]
- Corfield, A.P.; Donapaty, S.R.; Carrington, S.D.; Hicks, S.J.; Schauer, R.; Kohla, G. Identification of 9-O-acetyl-N-acetylneuraminic acid in normal canine pre-ocular tear film secreted mucins and its depletion in keratoconjunctivitis sicca. Glycoconj. J. 2005, 22, 409–416. [Google Scholar] [CrossRef] [PubMed]
- Kumlin, U.; Olofsson, S.; Dimock, K.; Arnberg, N. Sialic acid tissue distribution and influenza virus tropism. Influenza Other Respir. Viruses 2008, 2, 147–154. [Google Scholar] [PubMed] [Green Version]
- Matrosovich, M.N.; Matrosovich, T.Y.; Gray, T.; Roberts, N.A.; Klenk, H.D. Human and avian influenza viruses target different cell types in cultures of human airway epithelium. Proc. Natl. Acad. Sci. USA 2004, 101, 4620–4624. [Google Scholar] [CrossRef] [Green Version]
- Bakkers, M.J.; Lang, Y.; Feitsma, L.J.; Hulswit, R.J.; de Poot, S.A.; van Vliet, A.L.; Margine, I.; de Groot-Mijnes, J.D.; van Kuppeveld, F.J.; Langereis, M.A.; et al. Betacoronavirus adaptation to humans involved progressive loss of hemagglutinin-esterase lectin activity. Cell Host Microbe 2017, 21, 356–366. [Google Scholar] [CrossRef]
- Tan, C.W.; Sam, I.C.; Lee, V.S.; Wong, H.V.; Chan, Y.F. VP1 residues around the five-fold axis of enterovirus A71 mediate heparan sulfate interaction. Virology 2017, 501, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Chamberlain, K.; Fowler, V.L.; Barnett, P.V.; Gold, S.; Wadsworth, J.; Knowles, N.J.; Jackson, T. Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus. J. Gen. Virol. 2015, 96, 2684–2692. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.Y.; Guo, A.Z.; Peng, B.; Zhang, M.F.; Guo, H.Y.; Chen, H.C. Infection of HeLa cells by avian infectious bronchitis virus is dependent on cell status. Avian Pathol. 2007, 36, 269–274. [Google Scholar] [CrossRef] [Green Version]
- Benfield, D.A.; Saif, L.J. Cell culture propagation of a coronavirus isolated from cows with winter dysentery. J. Clin. Microbiol. 1990, 28, 1454–1457. [Google Scholar]
- Collins, A.R. Interferon gamma potentiates human coronavirus OC43 infection of neuronal cells by modulation of HLA class I expression. Immunol. Investig. 1995, 24, 977–986. [Google Scholar] [CrossRef]
- Pyrc, K.; Sims, A.C.; Dijkman, R.; Jebbink, M.; Long, C.; Deming, D.; Donaldson, E.; Vabret, A.; Baric, R.; van der Hoek, L.; et al. Culturing the unculturable: Human coronavirus HKU1 infects, replicates, and produces progeny virions in human ciliated airway epithelial cell cultures. J. Virol. 2010, 84, 11255–11263. [Google Scholar] [CrossRef] [PubMed]
- Hassan, I.; Ahmad, F. Structural diversity of class I MHC-like molecules and its implications in binding specificities. Adv. Protein Chem. Struct. Biol. 2011, 83, 223–270. [Google Scholar] [PubMed]
- Patrono, L.V.; Samuni, L.; Corman, V.M.; Nourifar, L.; Rothemeier, C.; Wittig, R.M.; Drosten, C.; Calvignac-Spencer, S.; Leendertz, F.H. Human coronavirus OC43 outbreak in wild chimpanzees, Cote d’ivoire, 2016. Emerg. Microbes Infect. 2018, 7, 118. [Google Scholar]
- Alekseev, K.P.; Vlasova, A.N.; Jung, K.; Hasoksuz, M.; Zhang, X.; Halpin, R.; Wang, S.; Ghedin, E.; Spiro, D.; Saif, L.J. Bovine-like coronaviruses isolated from four species of captive wild ruminants are homologous to bovine coronaviruses, based on complete genomic sequences. J. Virol. 2008, 82, 12422–12431. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.; Wang, Y.; Chen, Y.; Wu, B.; Qin, K.; Zhao, J.; Lou, Y.; Tan, W. Discovery of a novel canine respiratory coronavirus support genetic recombination among betacoronavirus1. Virus Res. 2017, 237, 7–13. [Google Scholar] [PubMed]
- Lau, S.K.; Lee, P.; Tsang, A.K.; Yip, C.C.; Tse, H.; Lee, R.A.; So, L.Y.; Lau, Y.L.; Chan, K.H.; Woo, P.C.; et al. Molecular epidemiology of human coronavirus OC43 reveals evolution of different genotypes over time and recent emergence of a novel genotype due to natural recombination. J. Virol. 2011, 85, 11325–11337. [Google Scholar] [CrossRef]
Virus | Probe Sequence | Fluorescent Dyes | Forward Primer Sequence (5’→3’) | Reverse Primer Sequence (5’ → 3’) | Amplification Program | PCR Product Sequence |
---|---|---|---|---|---|---|
HCoV-OC43 | TGACATTGTCGATCGGGACCCAAGTA | FAM (6- carboxyfluorescein) and TAMRA (6- carboxytetramethyl-rhodamine) | AGCAACCAGGCTGATGTCAATACC | AGCAGACCTTCCTGAGCCTTCAAT | 50 °C for 2 min, 92 °C for 10 min, 40 cycles of 92 °C for 15 s and 60 °C for 1 min | AGCAACCAGGCTGATGTCAATACCCCGGCTGACATTGTCGATCGGGACCCAAGTAGCGATGAGGCTATTCCGACTAGGTTTCCGCCTGGCACGGTACTCCCTCAGGGTTACTATATTGAAGGCTCAGGAAGGTCTGCT |
CRCoV and BCoV | AGATCTACTTCACGCGCATCCAGT | FAM and TAMRA | CAGGAAGGTCTGCTCCTAATTC | GTTGCCAGAATTGGCTCTACTA | 95 °C for 5 min, 30 cycles of 95 °C for 15 s and 60 °C for 30 s | CAGGAAGGTCTGCTCCTAATTCCAGATCTACTTCACGCGCATCCAGTAGAGCCTCTAGTGCAGGATCGCGTAGTAGAGCCAATTCTGGCAAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szczepanski, A.; Owczarek, K.; Bzowska, M.; Gula, K.; Drebot, I.; Ochman, M.; Maksym, B.; Rajfur, Z.; Mitchell, J.A.; Pyrc, K. Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors. Viruses 2019, 11, 328. https://0-doi-org.brum.beds.ac.uk/10.3390/v11040328
Szczepanski A, Owczarek K, Bzowska M, Gula K, Drebot I, Ochman M, Maksym B, Rajfur Z, Mitchell JA, Pyrc K. Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors. Viruses. 2019; 11(4):328. https://0-doi-org.brum.beds.ac.uk/10.3390/v11040328
Chicago/Turabian StyleSzczepanski, Artur, Katarzyna Owczarek, Monika Bzowska, Katarzyna Gula, Inga Drebot, Marek Ochman, Beata Maksym, Zenon Rajfur, Judy A Mitchell, and Krzysztof Pyrc. 2019. "Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors" Viruses 11, no. 4: 328. https://0-doi-org.brum.beds.ac.uk/10.3390/v11040328