Selected Instrumental Techniques Applied in Food and Feed: Quality, Safety and Adulteration Analysis
Abstract
:1. Introduction
2. Selected Instrumental Techniques and Their Applications
2.1. Nuclear Magnetic Resonance Spectroscopy (NMR)
2.1.1. Advantages and Limitations of the Application
2.1.2. Applications of NMR in Dairy/Milk Metabolomics and Chemical Fingerprinting
2.1.3. Selected Applications for NMR
2.2. Real-Time/Quantitative Polymerase Chain Reaction (PCR/qPCR)
2.2.1. Advantages and Limitations of the Application
2.2.2. Detection of Animal Products in Feeds (Prohibited Animal Proteins or Products/PAPs)
2.2.3. Salmonella spp. in Feeds
2.2.4. Detection of Genetically Modified Organisms/GMOs
2.2.5. Allergens
2.2.6. Beer Spoilage Bacteria
2.3. Microwave Plasma-Atomic Emission Spectrometry (MP-AES)
2.3.1. Advantages and Limitations of the Application
2.3.2. Selected Applications of MP-AES
2.4. Inductively Coupled Plasma/ICP-MS for Determination Minerals in Honey
2.4.1. Advantages and Limitations of the Application
2.4.2. Selected Applications for ICP-MS
2.5. Isotope Ratio Mass Spectrometry (IRMS)
2.5.1. Advantages and Limitations of the Application
2.5.2. Geographical Origin of Coffee, and Honey and Coconut Water Authenticity
2.6. Vibrational Spectrometric (NIR, MIR, FT-IR (Near-, Mid- and Fourier Transform), ATR (Attenuated Total Reflection), Raman Spectroscopy)
2.6.1. Advantages and Limitations of the Application
2.6.2. Detection of Adulterants in Meat and Juices
2.6.3. Feedstuff Analysis Using NIR
2.7. Accelerated Oxidation
2.7.1. Advantages and Limitations of the Application
2.7.2. Selected Applications for OXITEST®
2.8. Gas Chromatography, Coupled with Mass Spectrometry Detection (GC/MS)
2.8.1. Advantages and Limitations of the Application
2.8.2. Organic Species of Mercury in Water and Marine Biota Tissue
2.8.3. Volatile Compounds/Pyrazines (Py) in Cocoa
2.9. Liquid Chromatography with Mass Spectrometry Detection (LC/MSn)
2.9.1. Advantages and Limitations of the Application
2.9.2. Acrylamide
2.9.3. Biogenic Amines
2.9.4. Allergens
2.9.5. Vanillin
3. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Cifuentes, A. Food Analysis: Present, Future, and Foodomics. ISRN Anal. Chem. 2012, 2012. [Google Scholar] [CrossRef] [Green Version]
- Maringer, M.; van’t Veer, P.; Klepacz, N.; Verain, M.C.D.; Normann, A.; Ekman, S.; Timotijevic, L.; Raats, M.M.; Geelen, A. User-documented food consumption data from publicly available apps: An analysis of opportunities and challenges for nutrition research. Nutr. J. 2018, 17, 59. [Google Scholar] [CrossRef]
- Llanaj, E.; Ádány, R.; Lachat, C.; D’Haese, M. Examining food intake and eating out of home patterns among university students. PLoS ONE 2018, 13, e0207549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, S.-H.; Lin, H.-C. Effects of food environments and eating environments on consumers’ food consumption volume. J. Food Qual. 2019, 2019. [Google Scholar] [CrossRef]
- Wahl, D.R.; Villinger, K.; König, L.M.; Ziesemer, K.; Schupp, H.T.; Renner, B. Healthy food choices are happy food choices: Evidence from a real life sample using smartphone based assessment. Sci. Rep. 2017, 7, 17069. [Google Scholar] [CrossRef] [Green Version]
- Román, S.; Sánchez-Siles, L.M.; Siegrist, M. The importance of food naturalness for consumers: Results of a systematic review. Trends Food Sci. Technol. 2017, 67, 44–57. [Google Scholar] [CrossRef]
- Thé Maia de Arruda Falcão, R.C.; de Oliveira Lyra, C.; Medeiros de Morais, C.M.; Bacurau Pinheiro, L.G.; Campos Pedrosa, L.F.; Vieira Cunha Lima, S.C.; Sena-Evangelista, K.C.M. Processed and ultra-processed foods are associated with high prevalence of inadequate selenium intake and low prevalence of vitamin B1 and zinc inadequacy in adolescents from public schools in an urban area of northeastern Brazil. PLoS ONE 2019, 14, e0224984. [Google Scholar]
- Botelho, A.M.; de Camargo, A.M.; Medeiros, K.J.; Irmão, G.B.; Dean, M.; Rataichesck Fiates, G.M. Supermarket circulars promoting the sales of ‘healthy’ foods: Analysis based on degree of processing. Nutrients 2020, 12, 2877. [Google Scholar] [CrossRef]
- Kowalska, A. Unfair information practices related to meat and meat products in Poland. In Proceedings of the 2018 International Scientific Conference ‘Economic Sciences for Agribusiness and Rural Economy’, 2nd ed.; Gołębiewski, J., Ed.; Warsaw University of Life Sciences Press: Warsaw, Poland, 2018; pp. 37–44. [Google Scholar]
- Wilde, A.S. Detection of Food Fraud in High Value Products—Exemplary Authentication Studies on Vanilla, Black Pepper, and Bergamot Oil. Ph.D. Thesis, Technical University of Denmark, Kongens Lyngby, Denmark, 2019. [Google Scholar]
- Wilde, A.S.; Smedsgaard, J.; Fromberg, A.; Duedahl-Olesen, L.; Fauhl-Hassek, C.; Larsen, L.B. Proof of Food Authenticity by Chemical Methods. Ph.D. Thesis, Technical University of Denmark, Kongens Lyngby, Denmark, 17 September 2019. [Google Scholar]
- Bryła, P. Who reads food labels? Selected predictors of consumer interest in front–of–package and back–of –package labels during and after the purchase. Nutrients 2020, 12, 2605. [Google Scholar] [CrossRef] [PubMed]
- Breen, M.; James, H.; Rangan, A.; Gemming, L. Prevalence of products claims and marketing buzzwords found on health food snack products does not relate to nutrient profile. Nutrients 2020, 12, 1513. [Google Scholar] [CrossRef]
- Dall’Asta, M.; Angelino, D.; Pellegrini, N.; Martini, D. The nutritional quality of organic and conventional food products sold in Italy: Results from the food labelling of Italian products (FLIP) study. Nutrients 2020, 12, 1273. [Google Scholar] [CrossRef]
- Menozzi, D.; Nguyen, T.T.; Sogari, G.; Taskov, D.; Lucas, S.; Castro-Rial, J.L.S.; Mora, C. Consumers’ preferences and willingness to pay for fish products with health and environmental labels: Evidence from five European countries. Nutrients 2020, 12, 2650. [Google Scholar] [CrossRef]
- Ontiveros, N.; Aristeo-López, G.; Arámbulo-Gálvez, J.G.; Beltrán-Cárdenas, C.E.; Figueroa-Salcido, O.G.; Mora-Melgem, J.A.; Granda-Restrepo, D.M.; Rodríguez-Bellegarrique, C.I.; Vergara-Jiménez, M.J.; Cárdenas-Torres, F.I.; et al. Characteristics of allergen labelling and precautionary allergen labelling in packaged food products available in Latin America. Nutrients 2020, 12, 2698. [Google Scholar] [CrossRef]
- Fałkowsky, J.; Ménard, C.; Sexton, R.J.; Swinner, J.; Vandevelde, S. Unfair trading practices in the food supply chain. In Joint Research Centre Technical Reports, 1st ed.; Di Marcantonio, F., Ciaian, P., Eds.; Publications Office of the European Union: Luxembourg, 2017; pp. 1–85. [Google Scholar]
- Smulders, F.J.M.; Rietjens, I.M.C.M.; Rose, M.D. Chemical hazards in foods of animal origin and the associated risks for public health: Elementary considerations. In Chemical Hazards in Foods of Animal Origin, 1st ed.; Smulders, F.J.M., Rietjens, I.M.C.M., Rose, M.D., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2019; pp. 21–47. [Google Scholar]
- Otles, S.; Ozyurt, V.H. Instrumental Food Analysis. In Handbook of Food Chemistry, 1st ed.; Cheung, P., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 1–19. [Google Scholar]
- Lidukis, Z.; Sdrali, D.; Costarelli, V.; Apostolopoulos, C. Consumers’ intention to buy Protected Designation of Origin and Protected Geographical Indication foodstuffs: The case of Greece. Int. JCS 2016, 40, 283–289. [Google Scholar]
- Dias, C.; Mendes, L. Protected designation of origin (PDO), protected geographical indication (PGI) and traditional speciality guaranteed (TSG): A bibliometric analysis. Food Res. Int. 2018, 103, 491–508. [Google Scholar] [CrossRef]
- Albuquerque, T.G.; Costa, H.S.; Oliveira, M.B.P.P. An overview of Portuguese olive oils and table olives with protected designation of origin. Eur. J. Lipid Sci. Technol. 2019, 121, 1800129. [Google Scholar] [CrossRef]
- Moreno-Miranda, C.; Jordán, J.; Moreno, R.; Moreno, P.; Solis, J. Protected designation of origin and sustainability characterization: The case of PDO Cocoa Arriba. Agriculture 2019, 9, 229. [Google Scholar] [CrossRef] [Green Version]
- Lora, I.; Zidi, A.; Magrin, L.; Prevedello, P.; Cozzi, G. An insight into the dairy chain of a protected designation of origin cheese: The case study of Asiago cheese. J. Dairy Sci. 2020, 103, 9116–9123. [Google Scholar] [CrossRef]
- Ebihara, K.; Omura, M. Value and protection of geographical indications by the Japanese wine law. BIO Web. Conf. 2019, 15, 03004. [Google Scholar] [CrossRef]
- Degrandi-Hoffman, G.; Graham, H.; Ahumada, F.; Smart, M.; Ziolkowski, N. The economics of honey bee (Hymenoptera: Apidae) management and overwintering strategies for colonies used to pollinate almonds. J. Econ. Enthomol. 2019, 112, 2524–2533. [Google Scholar] [CrossRef]
- Dine Tariq Bouhlali, E.; Bammou, M.; Sellam, K.; El Midaoui, A.; Bourkhis, B.; Ennassir, J.; Alem, C.; Filali-Zegzouti, Y. Physicochemical properties of eleven monofloral honey samples produced in Morocco. Arab. J. Basic Appl. Sci. 2019, 26, 476–487. [Google Scholar] [CrossRef] [Green Version]
- Banti, M. Food Adulteration and Some Methods of Detection, Review. Int. J. Nutr. Food Sci. 2020, 9, 86–94. [Google Scholar] [CrossRef]
- Bansal, S.; Singh, A.; Mangal, M.; Mangal, A.K.; Kumar, S. Food adulteration: Sources, health risks, and detection methods. Crit. Rev. Food Sci. Nutr. 2017, 57, 1174–1189. [Google Scholar] [CrossRef] [PubMed]
- Gizaw, Z. Public health risks related to food safety issues in the food market: A systematic literature review. Environ. Health Prev. Med. 2019, 24, 68. [Google Scholar] [CrossRef] [Green Version]
- Erban, A.; Fehrle, I.; Martinez-Seidel, F.; Brigante, F.; Más, A.L.; Baroni, V.; Wunderlin, D.; Kopka, J. Discovery of food identity markers by metabolomics and machine learning technology. Sci. Rep. 2019, 9, 9697. [Google Scholar] [CrossRef] [Green Version]
- Bettenhausen, C. Bruker installs world’s first 1.2 GHz NMR. C&EN 2020, 98, 12. [Google Scholar]
- Hatzakis, E. Nuclear Magnetic Resonance (NMR) Spectroscopy in Food Science: A comprehensive review. Compr. Rev. Food Sci. 2019, 18, 189–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuballa, T.; Brunner, T.S.; Thongpanchang, T.; Walch, S.G.; Lachenmeier, D.W. Applications of NMR for authentication of honey, beer and spices. Curr. Opin. Food Sci. 2018, 19, 57–62. [Google Scholar] [CrossRef]
- Sobolev, A.P.; Thomas, F.; Donarski, J.; Ingallina, C.; Circi, S.; Marincola, F.C.; Capitani, D.; Mannina, L. Use of NMR applications to tackle future food fraud issues. Trends Food Sci. Technol. 2019, 91, 347–353. [Google Scholar] [CrossRef] [Green Version]
- Garcia, C.; Lutz, N.W.; Confort-Gouny, S.; Cozzone, P.J.; Armand, M.; Bernard, M. Phospholipid fingerprints of milk from different mammalians determined by 31P NMR: Towards specific interest in human health. Food Chem. 2012, 135, 1777–1783. [Google Scholar] [CrossRef] [Green Version]
- Boiani, M.; McLoughlin, P.; Auty, M.A.E.; FitzGerald, R.J.; Kelly, P.M. Effects of depleting ionic strength on 31P nuclear magnetic resonance spectra of micellar casein during membrane separation and diafiltration of skim milk. J. Dairy Sci. 2016, 100, 6949–6961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Yu, Z.; Zhu, D.; Meng, X.; Pang, X.; Liu, Y.; Frew, R.; Chen, H.; Chen, G. The application of NMR-based milk metabolite analysis in milk authenticity identification. J. Sci. Food Agric. 2017, 97, 2875–2882. [Google Scholar] [CrossRef]
- Palma, M.; Hernández-Castellano, L.E.; Castro, N.; Argüello, A.; Capote, J.; Matzapetakis, M.; de Almeida, A.M. NMR-metabolomics profiling of mammary gland secretory tissue and milk serum in two goat breeds with different levels of tolerance to seasonal weight loss. Mol. Biosyst. 2016, 12, 2094–2174. [Google Scholar] [CrossRef]
- Martins Nascimento, P.A.; Barsanelli, P.L. Time-Domain Nuclear Magnetic Resonance (TD-NMR) and chemometrics for determination of fat content in commercial products of milk powder. J. AOAC Int. 2017, 100, 330–334. [Google Scholar] [CrossRef] [PubMed]
- Mazzei, P.; Piccolo, A. NMR-based metabolomics of water-buffalo milk after conventional or biological feeding. Chem. Biol. Technol. Agric. 2018, 5, 3. [Google Scholar] [CrossRef]
- Sacchi, R.; Paduano, A.; Caporaso, N.; Picariello, G.; Romano, R.; Addeo, F. Assessment of milk content in fat blends by 13C NMR spectroscopy analysis of butyrate. Food Control 2018, 91, 231–236. [Google Scholar] [CrossRef]
- Tomassini, A.; Curone, G.; Solè, M.; Capuani, G.; Sciubba, F.; Conta, G.; Miccheli, A.; Vigo, D. NMR-based metabolomics to evaluate the milk composition from Fresian and autochthonous cows of Northern Italy at different lactation times. Nat. Prod. Res. 2019, 33, 1085–1091. [Google Scholar] [CrossRef]
- Basoglu, A.; Baspinar, N.; Tenori, L.; Licari, C.; Gulersoy, E. Nuclear Magnetic Resonance (NMR)-based metabolome profile evaluation in dairy cows with and without displaced abomasum. Vet. Q. 2020, 40, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Corbu, S.; Pintus, R.; Dessi, A.; Puddu, M.; Marincola, F.C.; Fanos, V. NMR-based metabolomics analysis of organic and conventionally produced formula milk: Preliminary results. JPNIM 2019, 8, e080228. [Google Scholar]
- Foroutan, A.; Guo, A.C.; Vazquez-Fresno, R.; Lipfert, M.; Zhang, L.; Zheng, J.; Badran, H.; Budinski, Z.; Mandal, R.; Ametaj, B.N.; et al. Chemical composition of commercial cow’s milk. J. Agric. Food Chem. 2019, 67, 4897–4914. [Google Scholar] [CrossRef]
- Zhu, D.; Hayman, A.; Kebede, B.; Stewart, I.; Chen, G.; Frew, R. 31P NMR-based phospholipid fingerprinting of powdered infant formula. J. Agric. Food Chem. 2019, 67, 10265–10272. [Google Scholar] [CrossRef]
- Salama, A.A.K.; Contreras-Jodar, A.; Love, S.; Mehaba, N.; Such, X.; Caja, G. Milk yield, milk composition, and milk metabolomics of dairy goats intramammary-challenged with lipopolysaccharide under heat stress conditions. Sci. Rep. 2020, 10, 5055. [Google Scholar] [CrossRef] [Green Version]
- Monakhova, Y.B.; Kuballa, T.; Lachenmeier, D.W. Nontargeted NMR analysis to rapidly detect hazardous substances in alcoholic beverages. Appl. Magn. Reson. 2012, 42, 343–352. [Google Scholar] [CrossRef]
- Da Silva Grandizoli, C.W.P.; Ramos Campos, F.; Simonelli, F.; Barison, A. Grape juice quality control by means of 1H NMR spectroscopy and chemometric analyses. Quim. Nova 2014, 37, 1227–1234. [Google Scholar]
- Isaac-Lam, M.F. Determination of alcohol content in alcoholic beverages using 45 MHz Benchtop NMR Spectrometer. Int. J. Spectrosc. 2016. [Google Scholar] [CrossRef]
- Richardson, P.I.C.; Muhamadali, H.; Lei, Y.; Golovanov, A.P.; Ellis, D.I.; Goodacre, R. Detection of the adulteration of fresh coconut water via NMR spectroscopy and chemometrics. Analyst 2019, 4, 1401–1408. [Google Scholar] [CrossRef]
- Whei Miaw, C.S.; Santos, P.M.; Carolino Sales Silva, A.R.; Gozzi, A.; Castanheira Guimarães, N.C.; Callao, M.P.; Ruisánchez, I.; Martins Sena, M.; Carvalho de Souza, S.V. Comparison of different multivariate classification methods for the detection of adulterations in grape nectars by low-field nuclear magnetic resonance. Food Anal. Methods 2020, 13, 108–118. [Google Scholar] [CrossRef]
- De Moura Ribeiro, M.V.; Boralle, N.; Pezza, H.R.; Pezza, L.; Toci, A.T. Authenticity of raosted coffee using 1H NMR spectroscopy. J Food Comp. Anal. 2017, 57, 24–30. [Google Scholar] [CrossRef] [Green Version]
- Milani, M.I.; Rossini, E.L.; Catelani, T.A.; Pezza, L.; Toci, A.T.; Pezza, H.R. Authentication of roasted and ground coffee samples containing multiple adulterants using NMR and a chemometric approach. Food Control 2020, 112, 107104. [Google Scholar] [CrossRef]
- Okaru, A.O.; Scharinger, A.; de Rezende, T.R.; Teipel, J.; Kuballa, T.; Walch, S.G.; Lachenmeier, D.W. Validation of a quantitative proton nuclear magnetic resonance spectroscopy screening method for coffee quality and authenticity (NMR coffee screening). Foods 2020, 9, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogunade, I.; Jiang, Y.; Adeyemi, J.; Oliveira, A.; Vyas, D.; Adesogan, A. Biomarker of aflatoxin ingestion: 1H NMR-based plasma metabolomics of dairy cows fed aflatoxin B1 with or without sequestering agents. Toxins 2018, 10, 545. [Google Scholar] [CrossRef] [Green Version]
- Hachem, R.; Assemat, G.; Martins, N.; Balayssac, S.; Gilard, V.; Martino, R.; Malet-Martino, M. Proton NMR for detection, identification of adulterants in 160 herbal food supplements marketed for weight loss. J. Pharm. Biomed. Anal. 2016, 124, 34–47. [Google Scholar] [CrossRef]
- Wu, N.; Balayssac, S.; Danoun, S.; Malet-Martino, M.; Gilard, V. Chemometric analysis of low-field 1H NMR Spectra for unveiling adulteration of slimming dietary supplements by pharmaceutical compounds. Molecules 2020, 25, 1193. [Google Scholar] [CrossRef] [Green Version]
- Schmitt, C.; Bastek, T.; Stelzer, A.; Schneider, T.; Fischer, M.; Hackl, T. Detection of peanut adulteration in food samples by NMR spectroscopy. J. Agric. Food Chem. 2020. [Google Scholar] [CrossRef]
- Efenberger-Szmechtyk, M.; Nowak, A.; Kregiel, D. Implementation of chemometrics in quality evaluation of food and beverages. Crit. Rev. Food Sci. Nutr. 2018, 58, 1747–1766. [Google Scholar] [CrossRef]
- Minkler, M.J., Jr.; Kim, J.M.; Shinde, V.V.; Beckingham, B.S. Low-field 1H NMR spectroscopy: Factors impacting signal-to-noise ratio and experimental time in the context of mixed microstructures polyisoprenes. Magn. Reson. Chem. 2020, 1–9. [Google Scholar]
- Sudenkilde, U.K.; Larsen, L.B.; Bertram, H.C. NMR-based milk metabolomics. Metabolites 2013, 3, 204–222. [Google Scholar]
- Maher, A.D.; Rochfort, S.J. Applications of NMR in Dairy Research. Metabolites 2014, 4, 131–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yanibada, B.; Boudra, H.; Debrauwer, L.; Martin, C.; Morgavi, D.P.; Canlet, C. Evaluation of sample preparation methods for NMR-bases metabolomics of cow milk. Heliyon 2018, 4, e00856. [Google Scholar] [CrossRef] [Green Version]
- Bertram, H.C. NMR-based metabolomics: Quality and authenticity of milk and meat. In Modern Magnetic Resonance, 2nd ed.; Webb, G.A., Ed.; Springer International Publishing: Geneva, Switzerland, 2016; pp. 1–13. [Google Scholar]
- Markoska, T.; Visiljevic, T.; Huppertz, T. Unravelling conformational aspects of milk protein structure-Contributions from Nuclear Magnetic Resonance Studies. Foods 2020, 9, 1128. [Google Scholar] [CrossRef] [PubMed]
- Kalman, D.S.; Feldman, S.; Krieger, D.R.; Bloomer, R.J. Comparison of coconut water and a carbohydrate-electrolyte sport drink on measures of hydration and physical performance in exercise-trained men. J. Int. Soc. Sports Nutr. 2012, 9, 1. [Google Scholar] [CrossRef] [Green Version]
- Burns, D.T.; Johnston, E.-L.; Walker, M.J. Authenticity and the potability of coconut water—A critical review. J. AOAC Int. 2020, 103, 800–806. [Google Scholar] [CrossRef] [Green Version]
- Whei Miaw, C.S.; Martins Sena, M.; Carvalho de Souza, S.V.; Callao, M.P.; Ruisanchez, I. Detection of adulterants in grape nectars by attenuated total reflectance Fourier-transform mid-infrared spectroscopy and multivariate classification strategies. Food Chem. 2018, 266, 254–261. [Google Scholar] [CrossRef]
- Whei Miaw, C.S.; Assis, C.; Sales Silva, A.R.C.; Cunha, M.L.; Martins Sena, M.; Carvalho de Souza, S.V. Determination of main fruits in adulterated nectars by ATR-FTIR spectroscopy combined with multivariate calibration and variable selection methods. Food Chem. 2018, 254, 272–280. [Google Scholar] [CrossRef]
- Whei Miaw, C.S.; Martins Sena, M.; Carvalho de Souza, S.V.; Ruisanchez, I.; Callao, M.P. Variable selection for multivariate classification aiming to detect individual adulterants and their blends in grape nectars. Talanta 2018, 190, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Weaver, A.C.; Adams, N.; Yiannikouris, A. Use of technology to assess and monitor multimycotoxin and emerging mycotoxin challenges in feedstuff. Appl. Anim. Sci. 2020, 36, 19–25. [Google Scholar] [CrossRef]
- Singh, J.; Metha, A. Rapid and sensitive detection of mycotoxins by advanced and emerging analytical methods: A review. Food Sci. Nutr. 2020. [Google Scholar] [CrossRef]
- Sadhasivam, S.; Britzi, M.; Zakin, V.; Kostyukovsky, M.; Trostanetsky, A.; Quinn, E.; Sionov, E. Rapid detection and identification of mycotoxigenic fungi and mycotoxins in stored wheat grain. Toxins 2017, 9, 302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khatoon, A.; ul Abidim, Z. Mycotoxicoses—Diagnosis, prevention, and control: Past practices and future perspectives. Toxin Rev. 2018, 39, 99–114. [Google Scholar] [CrossRef]
- Salihah, N.T.; Hossain, H.H.; Lubis, H.; Ahmed, M.U. Trends and advances in food analysis by real-time polymerase chain reaction. J. Food Sci. Technol. 2016, 53, 2196–2209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Raamsdonk, L.W.D.; Prins, T.W.; Meijer, N.; Scholtens, I.M.J.; Bremer, M.G.E.G. de Jong, J. Bridging legal requirements and analytical methods: A review of monitoring opportunities of animal proteins in feed. Food Addit. Contam. Part A 2019, 39, 46–73. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Han, L.; Veys, P.; Baeten, V.; Jiang, X.; Dardenne, P. An overview of the legislation and light microscopy for detection of processed animal proteins in feeds. Microsc. Res. Tech. 2011, 74, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.; Choi, T.-Y.; Woo, D.; Min, M.-S.; Sugita, S.; Lee, H. Species identification key of Korean mammal hair. J. Vet. Med. Sci. 2014, 76, 667–675. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Þórhallsdóttir, R.; Walser, J.W.; Kristjánsdóttir, S.; Anamthawat-Jónsson, K. SEM analysis of an archeological hair sample from East-Iceland and comparative samples from nine modern-day species of mammals from the region. J. Archaeol. Sci. Rep. 2019, 24, 24–29. [Google Scholar]
- Farag, M.R.; Ghoniem, M.H.; Abou-Hadeed, A.H.; Dhama, K. Forensic identification of some wild animal hair using light and scanning electron microscopy. Adv. Anim. Vet. Sci. 2015, 3, 559–568. [Google Scholar] [CrossRef]
- Choudhary, O.P.; Choudhary, P. Forensic analysis of hair by scanning electron microscopy in domesticated animals. Int. J. Curr. Microb. Appl. Sci. 2019, 8, 1028–1034. [Google Scholar] [CrossRef]
- Golinelli, L.P.; Silva, J.T.; Carvalho, A.C.; Paschoalin, V.M.F. Detection of animal products in ruminant feeds by microscopy and real time PCR. J. Veterinar. Sci. Technol. 2016, 7, 3. [Google Scholar]
- Momcilovic, D.; Rasooly, A. Detection and analysis of animal materials in food and feed. J. Food Prot. 2000, 63, 1602–1609. [Google Scholar] [CrossRef]
- Nesic, K.; Samanc, H.; Vujanac, I.; Prodanovic, R.; Nesic, V.; Velebit, B.; Savic, B. Detection of meat and bone meal in cattle feed and ruminal fluid—Comparison and combining of microscopy and polymerase chain reaction. Anim. Feed Sci. Technol. 2014, 187, 86–90. [Google Scholar] [CrossRef]
- Hoofar, J.; Ahrens, P.; Rådström, P. Automated 5′ nuclease PCR assay for identification of Salmonella enterica. J. Clin. Microbiol. 2000, 38, 3429–3435. [Google Scholar] [CrossRef] [Green Version]
- Ocepek, M.; Pate, M.; Mićunović, J.; Bole-Hribovšek, V. Comparison and optimization of two PCR tests for identification of Salmonella in poultry feedstuffs, liver, faeces. Slov. Vet. Res. 2006, 43, 61–66. [Google Scholar]
- Soria, M.C.; Soria, M.A.; Bueno, D.J.; Terzolo, H.R. Comparison of 3 culture methods and PCR assays for Salmonella gallinarum and Salmonella pollorum detection in poultry feed. Poult. Sci. 2013, 92, 1505–1515. [Google Scholar] [CrossRef]
- Liu, Y.; Cao, Y.; Wang, T.; Dong, Q.; Li, J.; Niu, C. Detection of 12 common food-borne bacterial pathogens by TaqMan real-time PCR using a single set of reaction conditions. Front. Microbiol. 2019, 10, 222. [Google Scholar] [CrossRef]
- Ripolles-Avila, C.; Martinez-Garcia, M.; Capellas, M.; Yuste, J.; Fung, D.Y.C.; Rodriguez-Jerez, J.-J. From hazard analysis to risk control using rapid methods in microbiology: A practical approach for the food industry. Comp Rev. Food Sci. Food Saf. 2020, 19, 1877–1907. [Google Scholar] [CrossRef]
- Bonfini, L.; van den Bulcke, M.H.; Mazzara, M.; Enrico, B.; Patak, A. GMOMETHODS: The European Union Database of Reference Methods for GMO Analysis. 2007. Available online: https://gmo-crl.jrc.ec.europa.eu/gmomethods/ (accessed on 3 November 2020).
- Marchisotto, M.J.; Harada, L.; Blumenstock, J.A.; Bilaver, L.A.; Waserman, S.; Sicherer, S.; Boloh, Y.; Regent, L.; Said, M.; Schnadt, S.; et al. Global perceptions of food allergy thresholds in 16 countries. Allergy 2016, 71, 1081–1085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taylor, S.L.; Moneret-Vautrin, D.A.; Crevel, R.W.R.; Sheffield, D.; Morisset, M.; Dumont, P.; Remington, B.C.; Baumert, J.L. Threshold dose for peanut: Risk characterization based upon diagnostic oral challenge of a series of 286 peanut-allergic individuals. Food Chem. Toxicol. 2010, 48, 814–819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Westerhout, J.; Baumert, J.L.; Blom, W.M.; Allen, K.J.; Ballmer-Weber, B.; Crevel, R.W.R.; Dubois, A.E.J.; Fernández-Rivas, M.; Greenhawt, M.J.; Hourihane, J.; et al. Deriving individual threshold doses from clinical food challenge data for population risk assessment of food allergens. J. Allergy Clin. Immunol. 2019, 144, 1290–1309. [Google Scholar] [CrossRef] [PubMed]
- Crevel, R.W.R.; Baumert, J.L.; Baka, A.; Houben, G.F.; Knulst, A.C.; Kruizinga, A.G.; Luccioli, S.; Taylor, S.L.; Madsen, C.B. Development and evolution of risk assessment for food allergens. Food Chem. Toxicol. 2014, 67, 262–276. [Google Scholar] [CrossRef] [PubMed]
- DunnGalvin, A.; Chan, C.-H.; Crevel, R.; Grimshaw, K.; Poms, R.; Schnadt, S.; Taylor, S.L.; Turner, P.; Allen, K.J.; Austin, M.; et al. Precautionary allergen labelling: Perspectives from key stakeholders group. Allergy 2015, 70, 1039–1051. [Google Scholar] [CrossRef] [PubMed]
- Ballmer-Weber, B.K.; Fernandez-Rivas, M.; Beyer, K.; Defernez, M.; Sperrin, M.; Mackie, A.R.; Salt, L.J.; O’B Hourihane, J.; Asero, R.; Belohlavkova, S.; et al. How much is too much? Threshold dose distributions for 5 food allergens. J. Allergy Clin. Immunol. 2015, 135, 964–971. [Google Scholar] [CrossRef]
- [EFSA] European Food Safety Authority. Scientific Opinion on the evaluation of allergenic foods and food ingredients for labelling purposes. EFSA J. 2014, 12, 3894. [Google Scholar]
- Holazhauser, T.; Röder, M. Polymerase chain reaction (PCR) methods for detecting allergens in foods. In Handbook of Food Allergen Detection and Control, 1st ed.; Flanagan, S., Ed.; Elsevier Ltd.: Amsterdam, The Netherlands, 2015; pp. 245–263. [Google Scholar]
- Pinto, A.; Polo, P.N.; Henry, O.; Redondo, M.C.B.; Svobodova, M.; O’Sullivan, C.K. Label-free detection of gliadin food allergen mediated by real-time apta-PCR. Anal. Bional. Chem. 2014, 406, 515–524. [Google Scholar] [CrossRef]
- Jayathilake, C.; Kumachi, S.; Arai, H.; Motohashi, M.; Terai, T.; Murakami, A.; Nemoto, N. In vitro selection of anti-gliadin single- domain antibodies from naïve library for cDNA-display mediated immuno-PCR. Anal. Biochem. 2020, 589, 113490. [Google Scholar] [CrossRef]
- Hutzler, M.; Müller-Auffermann, K.; Koob, J.; Riedl, R.; Jacob, F. Beer spoiling microorganisms—A current overview. Brauwelt. Int. 2013, 1, 23. [Google Scholar]
- Esmaeili, S.; Mogharrabi, M.; Safi, F.; Sohrabvandi, S.; Mortazavian, A.M.; Bagheripoor-Fallah, N. The common spoilage microorganisms of beer: Occurrence, defects, and determination—A Review. Carp. J. Food Sci. Technol. 2015, 7, 68–73. [Google Scholar]
- Bokulich, N.A.; Bergsveinson, J.; Ziola, B.; Mills, D.A. Mapping microbial ecosystems and spoilage-gene flow in breweries highlights patters of contamination and resistance. eLife 2015, 4, e04634. [Google Scholar] [CrossRef]
- Cangelosi, G.A.; Meschke, J.S. Dead or Alive: Molecular assessment of microbial viability. Appl. Environ. Microbiol. 2014, 80, 5884–5891. [Google Scholar] [CrossRef] [Green Version]
- Sheth, N.K.; Wisniewski, T.R.; Franson, T.R. Survival of enteric pathogens in common beverages: An in vitro study. Am. J. Gastroenterol. 1988, 83, 658–660. [Google Scholar] [PubMed]
- Fumière, O.; Dubois, M.; Baeten, V.; von Holst, C.; Berben, G. Effective PCR detection of animal species in highly processed animal byproducts and compound feeds. Anal. Bioanal. Chem. 2006, 385, 1045–1054. [Google Scholar] [CrossRef]
- Prado, M.; Berben, G.; Fumière, O.; van Duijn, G.; Mensinga-Kruize, J.; Reaney, S.; Boix, A.; von Holst, C. Detection of ruminant meat and bone meals in animal feed by real-time polymerase chain reaction: Result of an interlaboratory study. J. Agric. Food Chem. 2007, 55, 7495–7501. [Google Scholar] [CrossRef]
- Cawthraw, S.; Saunders, G.C.; Martin, T.C.; Sawyer, J.; Windl, O.; Reaney, S.D. Real-time PCR detection and identification of prohibited mammalian and avian material in animal feeds. J. Food Prot. 2009, 72, 1055–1062. [Google Scholar] [CrossRef]
- Kim, M.-J.; Kim, H.-Y. Species identification of commercial jerky products in food and feed using direct pentaplex PCR assay. Food Control 2017, 78, 1–6. [Google Scholar] [CrossRef]
- Marchetti, P.; Mottola, A.; Piredda, R.; Ciccarese, G.; Di Pinto, A. Determining the authenticity of shark meat products by DNA sequencing. Foods 2020, 9, 1194. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.; Kim, S.; Lee, J.; Lee, S.; Lee, H.; Choi, Y.; Oh, H.; Yoon, Y. Identification of pork adulteration in processed meat products using the developed mitochondrial DNA-based primers. Korean J. Food Resour. 2017, 37, 464–468. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Hang, X.; Geng, R. Molecular detection of adulteration in commercial buffalo meat products by multiplex PCR assay. Food Sci. Technol. 2019, 39, 344–348. [Google Scholar] [CrossRef] [Green Version]
- Maciorowski, K.G.; Herrera, P.; Jones, F.T.; Pillai, S.D.; Ricke, S.C. Cultural and immunological detection methods for Salmonella spp. in animal feeds—A review. Vet. Res. Commun. 2006, 30, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Löfstrom, C.; Knutsson, R.; Axelsson, C.E.; Rådström, P. Rapid and specific detection of Salmonella spp. in animal feed samples by PCR after culture enrichment. Appl. Environ. Microbiol. 2004, 70, 69–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malorny, B.; Löfstrom, C.; Wagner, M.; Krämer, N.; Hoorfar, J. Enumeration of Salmonella bacteria in food and feed samples by real-time PCR for quantitative microbial risk assessment. Appl. Environ. Microbiol. 2008, 74, 1299–1304. [Google Scholar] [CrossRef] [Green Version]
- Kuijpers, A.F.A.; van de Kassteele, J.; Mooijman, K.A. EU Interlaboratory Comparison Study Animal Feed III (2014). 2016. Available online: https://www.eurlsalmonella.eu/sites/default/files/2018-06/2015-0080.pdf (accessed on 2 November 2020).
- Ferraz Castagna, S.M.; Muller, M.; Macagnan, M.; Rodenbusch, C.R.; Canal, C.W.; Cardoso, M. Detection of Salmonella sp. from porcine origin: A comparison between a PCR method and standard microbiological techniques. Braz. J. Microbiol. 2005, 36, 373–377. [Google Scholar] [CrossRef] [Green Version]
- Bonilauri, P.; Bardasi, L.; Leonelli, R.; Ramini, M.; Luppi, A.; Giacometti, F.; Merialdi, G. Detection of Food Hazards in Food: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods. Ital. J. Food Saf. 2016, 5, 5641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Agostino, M.; Diez-Valcarce, M.; Robles, S.; Losilla-Garcia, B.; Cook, N. A loop-mediated isothermal amplification-based method for analysing animal feed for the presence of Salmonella. Food Anal. Methods 2015, 8, 2409–2416. [Google Scholar] [CrossRef]
- Benahmed, F.; Wang, H.; Beaubrun, J.J.-G.; Gopinath, G.R.; Cheng, C.-M.; Hanes, D.E.; Hammack, T.S.; Rasmussen, M.; Davidson, M.K. Detection of Salmonella enterica subsp. Enterica serovar Cubana from naturally contaminated chick feed. J. Food Prot. 2017, 80, 1815–1820. [Google Scholar]
- Beaubrun, J.J.-G.; Ewing, L.; Dudley, K.; Benhamed, F.; Wang, H.; Hanes, D.E. Evaluation of a multiplex PCR method to serotype Salmonella in animal feeds pre-enrichment broth cultures. Methods X 2017, 4, 335–345. [Google Scholar]
- Salazar, G.A.; Guerrero-López, R.; Lalaleo, L.; Avilés-Esquivel, D.; Vinueza-Burgos, C.; Calero-Cáceres, W. Presence and diversity of Salmonella isolated from layer farms in central Ecuador. F1000Research 2019, 8, 235. [Google Scholar] [CrossRef]
- Heymans, R.; Vila, A.; van Heerwaarden, C.A.M.; Jansen, C.C.C.; Castelijn, G.A.A.; van der Voort, M.; Biesta-Peters, E.G. Rapid detection and differentiation of Salmonella species, Salmonella Typhimurium and Salmonella Enteritidis by multiplex quantitative PCR. PLoS ONE 2018, 13, e0206316. [Google Scholar] [CrossRef] [Green Version]
- Magossi, G.; Cernicchiaro, N.; Dritz, S.; Houser, T.; Woodworth, J.; Jones, C.; Trinetta, V. Evaluation of Salmonella presence in selected United States feed mills. Microbiol. Open 2018, e711. [Google Scholar] [CrossRef]
- Samar, Q.; Dura Susan, A.M.; Maysa, D.; Nahed, A.M.; El-Banna, N. PCR detection of Salmonella spp. in fresh vegetables and feed. Int. J. Biol. 2019, 11, 49–54. [Google Scholar] [CrossRef] [Green Version]
- Ishii, S.; Segawa, T.; Okabe, S. Simultaneous quantification of multiple food- and waterborne pathogens by use of microfluidic quantitative PCR. Appl. Environ. Microbiol. 2013, 79, 2891–2898. [Google Scholar] [CrossRef] [Green Version]
- Foddai, A.C.G.; Grant, I.R. Methods for detection of viable foodborne pathogens: Current state-of-art and future prospects. Appl. Microbiol. Biotechnol. 2020, 104, 4281–4288. [Google Scholar] [CrossRef] [Green Version]
- Law, J.W.-F.; Ab Mutalib, N.-S.; Chan, K.-G.; Lee, L.-H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2015, 5, 770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.-J.; Ryu, J.-O.; Song, J.-Y.; Kim, H.-Y. Multiplex polymerase chain reaction for identification of Shigellae and four Shigella species using a novel genetic markers screened by comparative genomics. Foodborne Pathog. Dis. 2017, 14, 400–606. [Google Scholar] [CrossRef] [PubMed]
- Fraiture, M.-A.; Herman, P.; Taverniers, I.; De Loose, M.; Deforce, D.; Roosens, N.H. Current and new approaches in GMO detection: Challenges and solutions. BioMed Res. Int. 2015, 2015, 1–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petrillo, M.; Angers-Loustau, A.; Henriksson, P.; Bonfini, L.; Patak, A.; Kreysa, J. JRC GMO-Amplicons: A collection of nucleic acid sequences related to genetically modified organisms. Database 2015, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbau-Piednoir, E.; De Keersmaecker, S.C.J.; Delvoye, M.; Gau, C.; Phillip, P.; Roosens, N.H. Use of next generation sequencing data to develop a qPCR method for specific detection of EU-unauthorized genetically modified Bacillus subtilis overproducing riboflavin. BMC Biotechnol. 2015, 15, 103. [Google Scholar] [CrossRef] [Green Version]
- Mano, J.; Hatano, S.; Nagatomi, Y.; Futo, S.; Takabatake, R.; Kitta, K. Highly sensitive GMO detection using real-time PCR with a large amount of DNA template: Single-laboratory validation. J. AOAC Int. 2018, 101, 507–514. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, Y.; Li, J.; Li, W.; Zhang, L.; Li, Y.; Li, X.; Zhu, L.; Wu, G. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods. Sci. Rep. 2014, 4, 7358. [Google Scholar] [CrossRef] [Green Version]
- Safaei, P.; Aghaee, E.M.; Khaniki, G.J.; Kuchak Afshari, S.A.; Rezaie, S. A simple and accurate PCR method for detection of genetically modified rice. J. Environ. Health Sci. Eng. 2019, 17, 847–851. [Google Scholar] [CrossRef] [Green Version]
- Klinnert, M.D.; McQuaid, E.L.; Fedele, D.A.; Faino, A.; Strand, M.; Robinson, J.; Atkins, D.; Fleisher, D.M.; O’B Hourihane, J.; Cohen, S.; et al. Children’s food allergies: Development of the food allergy management and adaptation scale. J. Pediatr. Pyschol. 2015, 40, 572–580. [Google Scholar] [CrossRef] [Green Version]
- Xiao, G.; Qin, C.; Wenju, Z.; Qin, C. Development of real-time quantitative PCR assay using TaqMan minor groove binder probe for the detection of α-lactalbumin in food. J. Dairy Sci. 2015, 99, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Villa, C.; Costa, J.; Mafra, I. Detection and quantification of milk ingredients as hidden allergens in meat products by a novel specific real-time PCR method. Biomolecules 2019, 9, 804. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Zhao, Y.; Xu, Q.; Chen, Q. Development of a triplex real-time PCR assay for simultaneous detection of allergenic ingredients in processed food. Czech J. Food Sci. 2018, 36, 22–27. [Google Scholar] [CrossRef] [Green Version]
- Renčová, E.; Piskatá, Z.; Kostelníková, D.; Tremlová, B. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method. Acta Vet. Brno 2014, 83, s77–s83. [Google Scholar] [CrossRef]
- Suh, S.-M.; Park, S.-B.; Kim, M.-J.; Kim, H.-Y. Simultaneous detection of fruit allergen-coding genes in tomato, apple, peach and kiwi through multiplex PCR. Food Sci. Biotechnol. 2019, 28, 1593–1598. [Google Scholar] [CrossRef]
- Miyazaki, A.; Watanabe, S.; Ogata, K.; Nagatomi, Y.; Kokutani, R.; Minegishi, Y.; Tamehiro, N.; Sakai, S.; Adachi, R.; Hirao, T. Real-time PCR detection methods for food allergens (wheat, buckwheat, peanuts) using reference plasmids. J. Agric. Food Sci. 2019, 67, 5680–5686. [Google Scholar] [CrossRef] [PubMed]
- Linacero, R.; Sanchiz, A.; Ballesteros, I.; Cuadrado, C. Application of real-time PCR for tree nut allergen detection in processed foods. Crit. Rev. Food Sci. Nutr. 2020, 60, 1077–1093. [Google Scholar] [CrossRef] [PubMed]
- Sharma, G.M.; Khuda, S.E.; Parker, C.H.; Eischeid, A.C.; Pereira, M. Detection of allergens markers: In food: Analytical methods. In Food Safety: Innovative Analytical Tools for Safety Assessment, 1st ed.; Spizzirri, U.G., Cirillo, G., Eds.; Scrivener Publishing: Beverly, MA, USA, 2017; pp. 65–121. [Google Scholar]
- Fernandes, T.J.R.; Costa, J.; Oliveira, M.B.P.P.; Mafra, I. A new real-time PCR quantitative approach for the detection of shrimp crustaceans as potential allergens. J. Food Compos. Anal. 2018, 72, 7–14. [Google Scholar] [CrossRef]
- Daems, D.; Peeters, B.; Delport, F.; Remans, T.; Lammertyn, J.; Spasic, D. Identification and quantification of celery allergens using fiber optic surface plasmon resonance PCR. Sensors 2017, 17, 1754. [Google Scholar] [CrossRef]
- Koob, J.; Methner, F.-J.; Jacob, F.; Hutzler, M. Lactobacillus sp. brewery isolate: A new threat to the brewing industry? Brewing Sci. 2016, 7, 42–49. [Google Scholar]
- Behr, J.; Geissler, A.J.; Schmid, J.; Zehe, A.; Vogel, R.F. The identification of novel diagnostic marker genes for the detection of beer spoiling Pediococcus damnosus strains using the BlAst Diagnostic Gene FindEr. PLoS ONE 2016, 11, e0152747. [Google Scholar] [CrossRef]
- Ma, Y.; Deng, Y.; Xu, Z.; Liu, J.; Dong, J.; Yin, H.; Yu, J.; Chang, Z.; Wang, D. Development of a propidium monoazide-polymerase chain reaction assay for detection of viable Lactobacillus brevis in beer. Braz. J. Micorbiol. 2017, 48, 740–746. [Google Scholar] [CrossRef] [PubMed]
- Schneiderbanger, J.; Grammer, M.; Jacob, F.; Hutzler, M. Statistical evaluation of beer spoilage bacteria by real-time PCR analysis from 2010 to 2016. J. Inst. Brew. 2018, 124, 173–181. [Google Scholar] [CrossRef] [Green Version]
- Meier-Dörnberg, T.; Jacob, F.; Michel, M.; Hutzler, M. Incidence of Saccharomyces cerevisiae var. diastaticus in the beverage industry: Cases of contamination, 2008–2017. MBAA QT 2017, 54, 140–148. [Google Scholar]
- Asano, S.; Suzuki, K.; Ozaki, K.; Kuriyama, H.; Yamashita, H.; Kitagawa, Y. Application of multiplex PCR to the detection of beer-spoilage bacteria. J. Am. Soc. Brew. Chem. 2008, 66, 37–42. [Google Scholar] [CrossRef]
- Asano, S.; Shimokawa, M.; Suzuki, K. PCR analysis methods for detection and identification of beer-spoilage lactic acid bacteria. In Lactic Acid Bacteria: Methods and Protocols, 1st ed.; Kanauchi, M., Ed.; Springer Science: Berlin/Heidelberg, Germany, 2019; pp. 95–194. [Google Scholar]
- Karlsson, S.; Sjöberg, V.; Ogar, A. Comparison of MP AES and ICP-MS for analysis of principal and selected trace elements in nitric acid digests of sunflower (Helianthus annuus). Talanta 2015, 135, 124–132. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Simmons, P.; Shrader, D.; Herrman, T.J.; Dai, S.Y. Microwave plasma-atomic emission spectroscopy as a tool for the determination of copper, iron, manganese and zinc in animal feed and fertilizer. Talanta 2013, 112, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.-D.; Yu, J.-J.; Liu, Y.-M.; Ouyang, K.; Zhang, F.-P.; Li, G.-L.; Fan, X.-L. Determination of multi-elements in aquatic feed by microwave plasma-atomic emission spectroscopy. Guang Pu Xue Guang Pu Fen Xi 2015, 35, 234–237. [Google Scholar]
- Barrientos, E.Y.; Wrobel, K.; Torres Guzman, J.C.; Corrales Escobosa, A.R.; Wrobel, K. Determination of SeMet adn Se(IV) in biofortified yeast by ion-pair reversed phase liquid chromatography-hydride generation-microwave induced nitrogen plasma atomic emission spectrometry (HPLC-HG-MP-AES). J. Anal. At. Spectrom. 2016, 31, 203–211. [Google Scholar] [CrossRef]
- Nelson, J.; Hopfer, H.; Gilleland, G.; Cuthbertson, D.; Boulton, R.; Ebeler, S.E. Elemental profiling of Malbec wines made under controlled conditions by microwave plasma atomic emission spectroscopy. Am. J. Enol. Vitic. 2015. [Google Scholar] [CrossRef]
- Ozbek, N.; Akman, S. Determination of boron in Turkish wines by microwave plasma atomic emission spectrometry. LWT Food Sci. Technol. 2015, 532–535. [Google Scholar] [CrossRef]
- Ozbek, N.; Akman, S. Method development for the determination of calcium, copper, magnesium, manganese, iron, potassium, phosphorus and zinc in different types of breads by microwave induced plasma-atomic emission spectrometry. Food Chem. 2016, 200, 245–248. [Google Scholar] [CrossRef]
- Ozbek, N.; Akman, S. Microwave plasma atomic emission spectrometric determination of Ca, K and Mg in various cheese varieties. Food Chem. 2016, 192, 295–298. [Google Scholar] [CrossRef]
- Pascariu, M.-C.; Tulucan, T.; Niculescu, M.; Sebarchievici, I.; Ştefănuț, M.N. Water quality survey streams from retezat mountains (Romania). J. Envrion. Geogr. 2016, 9, 27–32. [Google Scholar] [CrossRef] [Green Version]
- Tanabe, C.K.; Hopfer, H.; Gilleland, G.; Liba, A.; Ebeler, S.E.; Nelson, J. Total arsenic analysis in Californian wines with hydride generation—Microwave plasma—Atomic emission spectroscopy (HG-MPE-AES). J. Anal. At. Spectrom. 2016, 31, 1223. [Google Scholar] [CrossRef]
- Zaldarriaga Heredia, J.; Cina, M.; Savio, M.; Gil, R.A.; Camiña, J.M. Ultrasound-assisted pretreatment for multielement determination in maize seed samples by microwave plasma atomic emission spectrometry (MPAES). Microchem. J. 2016, 129, 78–82. [Google Scholar] [CrossRef]
- Rajmund, M.; Edward, M.; Joanna, K.; Jerzy, G.; Wojciech, L. Comparative MP-AES determination of selected metals in Polish and Romanian herbal teas. Hop. Med. Plants 2017, 25, 149–157. [Google Scholar]
- Ozbek, N. Elemental analysis of henna samples by MP AES. J. Turk. Chem. Soc 2018, 5, 857–868. [Google Scholar]
- Rodríguez-Solana, R.; Carlier, J.D.; Costa, M.C.; Romano, A. Multi-element characterisation of carob, fig and almond liqueurs by MP-AES. J. Inst. Brew. 2018, 124, 300–309. [Google Scholar] [CrossRef] [Green Version]
- Savoie, J.; St-Louis, R.; Clément, M. Facilitating local analysis in northern regions: Microwave plasma-atomic emission spectrometry for mercury determination in wild Atlantic salmon. Int. J. Environ. Anal. Chem. 2018, 98, 582–591. [Google Scholar] [CrossRef]
- Smirnova, S.V.; Samarina, T.O.; Ilin, D.V.; Pletnev, I.V. Multielement determination of trace heavy metals in water by microwave-induced plasma atomic emission spectrometry after extraction in unconventional single-salt aqueous biphasic system. Anal. Chem. 2018, 90, 6323–6331. [Google Scholar] [CrossRef]
- Herman-Lara, E.; Bolívar-Moreno, D.; Toledo-López, V.M.; Cuevas-Glory, L.F.; Lope-Navarrete, M.C.; Barron-Zambrano, J.A.; Díaz-Rivera, P.; Ramírez-Rivera, E.J. Minerals multi-element analysis and its relationship with geographical origin of artisanal Mexican goat cheeses. Food Sci. Technol. 2019, 39, 517–525. [Google Scholar] [CrossRef] [Green Version]
- Jung, M.Y.; Kang, J.H.; Choi, Y.S.; Lee, D.Y.; Lee, J.Y.; Park, J.S. Analytical features of microwave plasma-atomic emission spectrometry (MP-AES) for the quantitation of manganese (Mn) in wild grape (Vitis coignetiae) red wines: Comparison with inductively coupled plasma-optical emission spectrometry (ICP-OES). Food Chem. 2019, 274, 20–25. [Google Scholar] [CrossRef]
- Malhat, F.; Kasiotis, K.M.; Hassanin, A.S.; Shokr, S.A. An MIP-AES study of heavy metals in Egyptian honey: Toxicity assessment and potential health hazards to consumers. J. Elem. 2019, 24, 473–488. [Google Scholar]
- Mohammed, A.A.; Mohamed, H.O.; Muftah, E.K. Heavy metals contents in some commercially available coffee, tea, and cocoa samples in Misurata City-Libya. Prog. Chem. Biochem. Res. 2019, 2, 99–107. [Google Scholar]
- Fujihara, J.; Nishimoto, N. Total antimony analysis by hydride generation-microwave plasma-atomic emission spectroscopy with applications. Microchem. J. 2020, 157, 104992. [Google Scholar] [CrossRef]
- Merrick, J.; Saxby, D.; Dutra, E.S.; Caciano de Sena, R.; de Oliveira Araújo, T.; Dominguez de Almeida, M.; Yang, L.; Pihillagawa, I.G.; Mester, Z.; Sandoval, S.; et al. CCQM-K125 Elements in Infant Formula. 2017. Available online: https://www.bipm.org/utils/common/pdf/final_reports/QM/K125/CCQM-K125.pdf (accessed on 4 November 2020).
- Mikheev, I.V.; Karpukhina, E.A.; Usol’tseva, L.O.; Samarina, T.O.; Volkov, D.S.; Proskurnin, M.A. Application of Microwave Plasma Atomic Emission Spectrometry and Hydride Generation for Determination of Arsenic and Selenium in Mineral Water. Inorg. Mat. 2017, 53, 1422–1426. [Google Scholar]
- Corrales Escobosa, A.R.; Wrobel, K.; Barrientos, E.Y.; Jaramillo Ortiz, S.; Ramirez Segovia, A.S.; Wrobel, K. Effect of different glycation agents on Cu(II) binding to human serum albumin, studied by liquid chromatography, nitrogen microwave-plasma atomic-emission spectrometry, inductively-coupled-plasma mass spectrometry, and high resolution molecular-mass spectrometry. Anal. Bioanal. Chem. 2015, 407, 1149–1157. [Google Scholar] [PubMed]
- Wrobel, K.; Corrales Escobosa, A.R.; González-Ibarra, A.A.; García, M.M.; Barrientos, E.Y.; Wrobel, K. Mechanistic insight into chromium(VI) reduction by oxalic acid in the presence of manganese(II). J. Hazard. Mater. 2015, 300, 144–152. [Google Scholar] [CrossRef]
- Linge, K.L.; Jarvis, K.E. Quadrupole ICP-MS: Introduction to instrumentation, measurement techniques and analytical capabilities. Geostandards. Geoanal. Res. 2020, 33, 445–467. [Google Scholar] [CrossRef]
- Vincevica-Gaile, Z.; Klavins, M.; Rudovica, V.; Viksna, A. Potentially toxic metals in honey from Latvia: Is there connection with botanical origin? In Recent Researches in Environment, Energy Systems & Sustainability, 1st ed.; Rodrigues Ramos, R.A., Straupe, I., Panagopoulus, T., Eds.; WSEAS Press: Rodos, Greece, 2011; pp. 158–163. [Google Scholar]
- Chen, H.; Fan, C.; Chang, Q.; Pang, G.; Hu, X.; Lu, M.; Wang, W. Chemometric determination of the botanical origin for Chinese honeys on the basis of mineral elements determined by ICP-MS. J. Agric. Food Chem. 2014, 62, 2443–2448. [Google Scholar] [CrossRef]
- Conti, M.E.; Finoia, M.G.; Fontana, L.; Mele, G.; Botrè, F.; Iavicoli, I. Characterization of Argentina honeys on the basis of their mineral content and some typical quality parameters. Chem. Central J. 2014, 8, 44. [Google Scholar] [CrossRef]
- Döker, S.; Aydemir, O.; Uslu, M. Evaluation of digestion procedures for trace element analysis of Cankiri, Turkey, honey by inductively coupled plasma mass spectrometry. Anal. Lett. 2014, 47, 2080–2094. [Google Scholar] [CrossRef]
- Oroian, M.; Amariei, S.; Leahu, A.; Gutt, G. Multi-element composition of honey as a suitable tool for its authenticity analysis. Pol. J. Food Nutr. Sci. 2015, 65, 93–100. [Google Scholar] [CrossRef] [Green Version]
- Costa, V.C.; Picoloto, R.S.; Hartwig, C.A.; Mello, P.A.; Flores, E.M.M.; Mesko, M.F. Feasibility of ultra-trace determination of bromine and iodine in honey by ICP-MS using high high sample mass in microwave-induced combustion. Anal. Bioanal. Chem. 2015, 407, 7957–7964. [Google Scholar] [CrossRef] [PubMed]
- Müller, E.I.; Souza, J.P.; Anschau, K.F.; Enders, M.S.P.; Müller, A.L.H.; Mortari, S.R.; Duarte, F.A. Determination of Br, Cl and I in honey using ICP-based techniques following microwave-assisted wet digestion with H2O2 in a single reaction chamber. Anal. Methods 2017, 9, 649–654. [Google Scholar] [CrossRef]
- Altun, S.K.; Dinç, H.; Paksoy, N.; Temamoğulları, F.K.; Savrunlu, M. Analyses of mineral content and heavy metal of honey samples from south and east region of Turkey by using ICP-MS. Int. J. Anal. Chem. 2017, 2017. [Google Scholar] [CrossRef]
- Ataide de Oliveira, F.; Trópia de Abreu, A.; de Oliveira Nascimento, N.; Santos Froes-Silva, R.E.; Antonini, Y.; Nalini, H.A., Jr.; de Lena, C.J. Evaluation of matrix effect on the determination of rare earth elements and As, Bi, Cd, Pb, Se and In in honey and pollen of native Brazilian bees (Tetragonisca angustula—Jataí) by Q-ICP-MS. Talanta 2017, 162, 488–494. [Google Scholar] [CrossRef]
- Pillay, A.E.; Stephen, A.; Vukusic, S. Toxins in honey—A study by ICP-MS. Can. J. Pure Appl. Sci. 2017, 11, 4215–4221. [Google Scholar]
- Zhou, X.; Taylor, M.P.; Salouros, H.; Prasad, S. Authenticity and geographic origin of global honeys determined using carbon isotope ratios and trace elements. Sci. Rep. 2018, 8, 14639. [Google Scholar] [CrossRef] [Green Version]
- Spiric, D.; Ciric, J.; Teodorovic, V.; Nikolic, D.; Nikolic, A.; Radicevic, T.; Jankovic, S. Trace elements and heavy metals in multifloral honeys from Serbia. IOP Sci. 2019, 333, 012104. [Google Scholar] [CrossRef]
- Hungerford, N.L.; Tinggi, U.; Tan, B.L.L.; Farrell, M.; Fletcher, M.T. Mineral and Trace element analysis of Australian/Queensland Apis mellifera honey. Int. J. Environ. Res. Public Health 2020, 17, 6304. [Google Scholar] [CrossRef]
- Voica, C.; Iordache, A.M.; Ionete, R.E. Multielemental characterization of honey using inductively coupled plasma mass spectrometry fused with chemomentrics. J. Mass Spec. 2020, 55, e4512. [Google Scholar] [CrossRef] [PubMed]
- Mello, P.A.; Barin, J.S.; Duarte, F.A.; Bizzi, C.A.; Diehl, L.O.; Muller, E.I.; Flores, E.M.M. Analytical methods for the determination of halogens in bioanalytical sciences: A review. Anal. Bioanal. Chem. 2013, 405, 7615–7642. [Google Scholar] [CrossRef] [PubMed]
- Mesko, M.F.; Balbinot, F.P.; Scaglioni, P.T.; Nascimento, M.S.; Picoloto, R.S.; da Costa, V.C. Determination of halogens and sulfur in honey: A green analytical method using a single anlaysis. Anal. Bioanal. Chem. 2020, 412, 6475–6484. [Google Scholar] [CrossRef] [PubMed]
- Marcinkowska, M.; Barałkiewicz, D. Multielemental speciation analysis by advanced hyphenated technique—HPLC/ICP-MS: A review. Talanta 2016, 161, 177–204. [Google Scholar] [CrossRef]
- Katerinopoulou, K.; Kontogeorgos, A.; Salmas, C.E.; Patakas, A.; Ladavos, A. Geographical origin authentication of agri-food products: A review. Foods 2020, 9, 489. [Google Scholar] [CrossRef]
- Kaczmarek, A.; Muzolf-Panek, M.; Tomaszewska-Gras, J.; Konieczny, P. Predicting the botanical origin of honeys with chemometric analysis according to their antioxidant and physicochemical properties. Pol. J. Food Nutr. 2019, 69, 191–201. [Google Scholar] [CrossRef]
- Muccio, Z.; Jackson, G.P. Isotope ratio mass spectrometry. Analyst 2009, 134, 213–222. [Google Scholar] [CrossRef]
- Gehre, M.; Strauch, G. High-temperature elemental analysis and pyrolysis techniques for stable isotope analysis. Rapid. Comm Mass Spect. 2003, 17, 1497–1503. [Google Scholar] [CrossRef]
- Bontempo, L.; van Leeuwen, K.A.; Paolini, M.; Laursen, K.H.; Micheloni, C.; Prenzler, P.D.; Ryan, D.; Camin, F. Bulk and compond-specific stable isotope ratio analysis for authenticity testing of organically grown tomatoes. Food Chem. 2020, 318, 126426. [Google Scholar] [CrossRef]
- Mai, Z.; Lai, B.; Sun, M.; Shao, J.; Guo, L. Food adulteration and traceability tests using stable carbon isotope technologies. Trop. J. Pharm. Res. 2019, 18, 1771–1784. [Google Scholar]
- Aries, E.; Burton, J.; Carrasco, L.; De Rudder, O.; Maquet, A. Scientific Support to the Implementation of a Coordinated Control Plan with a View to Establishing the Prevalence of Fraudulent Practices in the Marketing of Honey” N° SANTE/2015/E3/JRC/SI2.706828. Available online: https://ec.europa.eu/food/sites/food/files/safety/docs/oc_control-progs_honey_jrc-tech-report_2016.pdf (accessed on 5 November 2020).
- Geana, E.I.; Popescu, R.; Costinel, D.; Dinca, O.R.; Ionete, R.E.; Stefanescu, I.; Artem, V.; Bala, C. Classification of red wines using suitable markers coupled with multivariate statistic analysis. Food Chem. 2016, 192, 1015–1024. [Google Scholar] [CrossRef] [PubMed]
- Santato, A.; Bertoldi, D.; Perini, M.; Carmin, F.; Larcher, R. Using elemental profiles and stable isotopes to trace the origin of green coffee beans on the global market. J. Mass Spec. 2012, 47, 1132–1140. [Google Scholar] [CrossRef]
- Carmin, F.; Bertoldi, D.; Santato, A.; Bontempo, L.; Perini, M.; Ziller, L.; Stroppa, A.; Larcher, R. Validation of methods for H, C, N and S stable isotopes and elemental analysis of cheese: Results of and international collaborative study. Rapid Commun. Mass Spectrom. 2015, 29, 415–423. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Guo, L.; Li, Y.; Wang, Z. Systematic comparison of C3 and C4 plants based on metabolic network analysis. BMC Syst. Biol. 2012, 6, S9. [Google Scholar] [CrossRef] [Green Version]
- Wu, L.; Du, B.; Heyden, Y.V.; Chen, L.; Zhao, L.; Wang, M.; Xue, X. Recent advancements in detecting sugar-based adulterants in honey—A challenge. Trends Anal. Chem. 2017, 86, 25–38. [Google Scholar] [CrossRef]
- Imaizumi, V.M.; Pereira Sartori, M.M.; Ducatti, C.; Venturini Filho, W.G. Use of stable isotopes of carbon to detect coconut water adulteration. Sci. Agric. 2019, 76, 261–265. [Google Scholar] [CrossRef] [Green Version]
- Arana, V.A.; Medina, J.; Esseiva, P.; Pazos, D.; Wist, J. Classification of coffee beans by GC-C-IRMS, GC-MS, and 1H-NMR. J. Anal. Meth. Chem. 2016, 2016. [Google Scholar] [CrossRef] [Green Version]
- Driscoll, A.W.; Howa, J.D.; Bitter, N.Q.; Ehleringer, J.R. A predictive spatial model for roasted coffee using oxygen isotopes of α-cellulose. Rapid Commun. Mass Spectrom. 2020, 34, e8626. [Google Scholar] [CrossRef]
- Barbosa, J.N.; Borem, F.M.; Alves, H.M.R.; Cirillo, M.A.; Hanson, C. Isotopic Signature of the relation between environment and the quality of spatial coffee. Af. J. Agric. Res. 2019, 14, 354–360. [Google Scholar]
- Peng, C.-Y.; Zhang, Y.-L.; Song, W.; Cai, H.-M.; Wang, Y.; Granato, D. Characterization of Brazilian coffee based on isotope ratio mass spectrometry (δ13C, δ18O, δ2H, δ15N) and supervised chemometrics. Food Chem. 2019, 297, 12. [Google Scholar] [CrossRef]
- Schipilliti, L.; Bonaccorsi, I.; Buglia, A.G.; Mondello, L. Comprehensive isotopic data evaluation (CIDE) of carbon isotope ratios for quality assessment and traceability of coffee. Food Anal. Methods 2019, 12, 121–127. [Google Scholar] [CrossRef]
- Worku, M.; Upadhayay, H.R.; Latruwe, K.; Taylor, A.; Blake, W.; Vanhaecke, F.; Duchateau, L.; Boeckx, P. Differentiating the geographical origin of Ethiopian coffee using XRF- and ICP-based multi-element and stable isotope profiling. Food Chem. 2019, 290, 295–307. [Google Scholar] [CrossRef] [PubMed]
- Buzek, F.; Čejková, B.; Jačková, I.; Lněničová, Z. The 18O/16O ratio of retail Moravian wines from the Czech Republic in comparison with European wines. Czech J. Food Sci. 2017, 35, 200–207. [Google Scholar] [CrossRef] [Green Version]
- dos Santos, V.H.; Celso, P.G.; Rocha, A.L.; Giovanaz, S.; Guerra, C.Z.; Pires, J.P.; Engelmann, P.M.; Rodrigues, L.F. Exploratory analysis of sparkling wines based in the combined data of stable isotope analysis with physicochemical variables and volatile profile. J. Braz. Chem. Soc. 2017, 28, 1534–1546. [Google Scholar] [CrossRef]
- Fan, S.; Zhong, Q.; Gao, H.; Wang, D.; Li, G.; Huang, Z. Elemental profile and oxygen isotope ratio (δ18O) for verifying the geographical origin of Chinese wines. J. Food Drug Anal. 2018, 26, 1033–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kokkinofta, R.; Fotakis, C.; Zervou, M.; Zoumpoulakis, P.; Savvidou, C.; Poulli, K.; Louka, C.; Economidou, N.; Tzioni, E.; Damianou, K.; et al. Isotopic and elemental authenticity markers: A case study on Cypriot Wines. Food Anal. Methods 2017, 10, 3902–3913. [Google Scholar] [CrossRef]
- Bonello, F.; Cravero, M.C.; Dell’Oro, V.; Tsolakis, C.; Ciambotti, A. Wine traceability using chemical analysis, isotopic parameters, and sensory profiles. Beverages 2018, 4, 54. [Google Scholar] [CrossRef] [Green Version]
- Perini, M.; Nardin, T.; Camin, F.; Malacarne, M.; Larcher, R. Combination of sugar and stable isotopes analyses to detect the use of nongrape sugars in balsamic vinegar must. J. Mass Spectrom. 2018, 53, 772–780. [Google Scholar] [CrossRef]
- Kawashima, H.; Suto, M.; Suto, N. Stable carbon isotope ratios for organic acids in commercial honey samples. Food Chem. 2019, 289, 49–55. [Google Scholar] [CrossRef]
- Vetrova, O.V.; Kalashnikova, D.A.; Melkov, V.N.; Simonova, G.V. Detection of honey adulterations with sugar syrups by stable isotope mass spectrometry. J Anal. Chem. 2017, 72, 756–760. [Google Scholar] [CrossRef]
- Christoph, N.; Hermann, A.; Wachter, H. 25 years authentication of wine with stable isotope analysis in the European Union—Review and outlook. BIO Web. Conf. 2015, 5, 02020. [Google Scholar] [CrossRef] [Green Version]
- Jha, S.N.; Jaiswal, P.; Grewal, M.K.; Gupta, M.; Bhardwaj, R. Detection of adulterants and contaminants in liquid foods—A review. Crit. Rev. Food Sci. 2016, 56, 1662–1684. [Google Scholar] [CrossRef]
- De Macedo Neto, J.J.; dos Santos, J.A.; Schwatrz, W.R. Meat adulteration detection through digital image analysis of histological cuts using LBP. arXiv 2017, arXiv:1611.02260. [Google Scholar]
- Guelmamene, R.; Bennoune, O.; Elgroud, R. Histological techniques for quality control of meat and meat products—A mini review. J. Nutr. Hum. Health 2018, 2, 24–29. [Google Scholar]
- Yang, Z.; Nie, G.; Pan, L.; Zhang, Y.; Huang, L.; Ma, X.; Zhang, X. Development and validation of near-infrared spectroscopy for the prediction of forage quality parameters in Lolium multiflorum. PeerJ 2017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norman, H.C.; Hulm, E.; Humphries, A.W.; Hughes, S.J.; Vercoe, P.E. Broad near-infrared spectroscopy calibrations can predict the nutritional value of >100 forage species within the Australian feedbase. Anim. Prod. Sci. 2020, 60, 1111–1122. [Google Scholar] [CrossRef]
- Dixit, Y.; Casado-Gavalda, M.P.; Cama-Moncunill, R.; Cama-Moncunill, M.; Markiewicz-Keszycka, M.; Cullen, P.J.; Sullvian, C. Developments and challenges in online NIR spectroscopy for meat processing. Comp Rev. Food Sci. Food Saf. 2017, 16, 1172–1187. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Yang, Z.; Han, L. A review on the use of near-infrared spectroscopy for analyzing feed protein materials. Appl. Spectros. 2013, 48, 509–522. [Google Scholar] [CrossRef]
- Donnelly, D.M.; Dórea, J.R.R.; Yang, H.; Combs, D.K. Comparison of dry matter measurements from handheld near-infrared units with oven drying at 60 °C for 48 hours and other on-farm methods. J. Dairy Sci. 2018, 101, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Modroño, S.; Soldado, A.; Martínez-Fernández, A.; de la Roza-Delgado, B. Handheld NIRS sensors for routine compound feed quality control: Real time and field monitoring. Talanta 2017, 162, 597–603. [Google Scholar] [CrossRef]
- Lohumi, S.; Lee, H.; Kim, M.S.; Qin, J.; Cho, B.-W. Raman hyperspectral imaging and spectral similarity analysis for quantitative detection of multiple adulterants in wheat flour. Biosys. Eng. 2019, 181, 103–113. [Google Scholar] [CrossRef]
- Kämper, W.; Trueman, S.J.; Tahmasbian, I.; Bai, S.H. Rapid determination of nutrient concentrations in Hass Avocado fruit by Vis/NIR hyperspectral imaging of flesh or skin. Remote Sens. 2020, 12, 3409. [Google Scholar] [CrossRef]
- Lee, K.-M.; Yarbrough, D.; Kozman, M.M.; Herman, T.J.; Park, J.; Wang, R.; Kurouski, D. Rapid detection and prediction of chlortetracycline and oxytetracycline in animal feed using surface-enhanced Raman spectroscopy (SERS). Food Control 2020, 114, 107243. [Google Scholar] [CrossRef]
- Femenias, A.; Bainotti, M.B.; Gatius, F.; Ramos, A.J.; Marín, S. Standarization of near infrared hyperspectral imaging for wheat sigle kernel sorting according to deoxynivalenol level. Food Res. Int. 2021, 139, 109925. [Google Scholar] [CrossRef] [PubMed]
- Parrag, V.; Gillay, Z.; Kovács, Z.; Zitek, A.; Böhm, K.; Hinterstoisser, B.; Krska, R.; Sulyok, M.; Felföldi, J.; Firtha, F.; et al. Application of hyperspectral imaging to detect toxigenic Fusarium infection on cornmeal. Prog. Agric. Eng. Sci. 2020, 16, 51–60. [Google Scholar]
- Dasenaki, M.E.; Thomaidis, N.S. Quality and authenticity control of fruit juices—A review. Molecules 2019, 24, 1014. [Google Scholar] [CrossRef] [Green Version]
- Ballin, N.Z. Authentication of meat and meat products. Meat Sci. 2010, 86, 577–587. [Google Scholar] [CrossRef]
- Zajac, A.; Hanuza, J.; Dyminska, L. Raman spectroscopy in determination of horse meat content in the mixture with other meats. Food Chem. 2014, 156, 333–338. [Google Scholar] [CrossRef]
- Mamani-Linares, L.W.; Gallo, C.; Alomar, D. Identification of cattle, llama, and horse meat by near infrared reflectance or transflectance spectroscopy. Meat Sci. 2012, 90, 378–385. [Google Scholar] [CrossRef] [PubMed]
- Rohman, A.; Sismindari, E.Y.; Che Man, Y.B. Analysis of pork adulteration in beef meatball using Fourier transform infrared (FTIR) spectroscopy. Meat Sci. 2011, 88, 91–95. [Google Scholar] [CrossRef]
- Alamprese, C.; Casale, M.; Sinelli, N.; Lanteri, S.; Casiraghi, E. Detection of minced beef adulteration with turkey meat by UV-Vis, NIR, and MIR spectroscopy. LWT-Food Sci. Technol. 2013, 53, 225–232. [Google Scholar] [CrossRef]
- Snyder, A.B.; Sweeney, C.F.; Rodrigues-Saona, L.E.; Giusti, M. Rapid authentication of concord juice concentration in a grape juice blend using Fourier-Transform infrared spectroscopy and chemometric analysis. Food Chem. 2014, 147, 295–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nawayon, J.; Sirisomboon, P. Detetcion of sugar solution adulteration of fresh orange juice by near infrared spectroscopy. Int. J. Bioprocess Biotechnol. Adv. 2015, 1, 57–62. [Google Scholar]
- Alamar, P.D.; Caramês, E.T.S.; Poppi, R.J.; Pallone, J.A.L. Quality evaluation of frozen guava and yellow passion fruit pulps by NIR spectroscopy and chemometrics. Food Res. Int. 2016, 85, 209–214. [Google Scholar] [CrossRef]
- Ellis, D.I.; Ellis, J.; Muhamadali, H.; Xu, Y.; Horn, A.B.; Goodacre, R. Rapid, high-throughput, and quantitative determination of orange juice adulteration by Fourier-transform infrared spectroscopy. Anal. Methods 2016, 8, 5581–5586. [Google Scholar] [CrossRef] [Green Version]
- Shen, F.; Wu, Q.; Su, A.; Tang, P.; Shao, X.; Liu, B. Detection of adulteration in freshly squeezed orange juice by electronic nose and infrared spectroscopy. Czech J. Food Sci. 2016, 34, 224–232. [Google Scholar] [CrossRef] [Green Version]
- Alamar, P.D.; Caramês, E.T.S.; Poppi, R.J.; Pallone, J.A.L. Detection of fruit pulp adulteration using multivariate analysis: Comparison of NIR, MIR and data fusion performance. Food Anal. Methods 2020, 13, 1357–1365. [Google Scholar] [CrossRef]
- Ellis, D.I.; Eccles, R.; Xu, Y.; Griffen, J.; Muhamadali, H.; Matousek, P.; Goodall, I.; Goodacre, R. Through-container, extremely low concentration detection of multiple chemical markers of counterfeit alcohol using a handheld SORS device. Sci. Rep. 2017, 7, 12082. [Google Scholar] [CrossRef]
- Richardson, P.I.C.; Muhamadali, H.; Ellis, D.I.; Goodacre, R. Rapid quantification of the adulteration of fresh coconut water by dilution and sugars using Raman spectroscopy and chemometrics. Food Chem. 2019, 272, 157–164. [Google Scholar] [CrossRef]
- Nunes, K.M.; Andrade, M.V.O.; Santos Filho, A.M.P.; Lasmar, M.C.; Sena, M.M. Detection and characterisation of frauds in bovine meat in natura by non-meat ingredient additions using data fusion of chemical parameters and ATR-FTIR spectroscopy. Food Chem. 2016, 205, 14–22. [Google Scholar] [CrossRef]
- Nunes, K.M.; Andrade, M.V.O.; Almeida, M.R.; Fantini, C.; Sena, M.M. Raman spectroscopy and discriminant analysis applied to the declaration of frauds in bovine meat by the addition of salts and carrageenan. Microchem. J. 2019, 147, 582–589. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, B.; Yan, P.; Wang, K.; Zhang, X.; Wang, H.; Lv, Y. Nondestructive identification of salmon adulteration with water based on hyperspectral data. J. Food Qual. 2018, 2018, 1809297. [Google Scholar] [CrossRef]
- Yang, L.; Wu, T.; Liu, Y.; Zou, J.; Huang, Y.; Babu, S.; Lin, L. Rapid identification of pork adulterated in the beef and mutton by infrared spectroscopy. J. Spectros. 2018, 2018, 1809297. [Google Scholar] [CrossRef]
- Aureli, R.; Ueberschlag, Q.; Klein, F.; Noël, C.; Guggenbuhl, P. Use of near infrared reflectance spectroscopy to predict phytate phosphorus, total phosphorus, and crude protein of common poultry feed ingredients. Poult. Sci. 2017, 96, 160–168. [Google Scholar] [CrossRef]
- Fan, X.; Tang, S.; Li, G.; Zhou, X. Non-invasive detection of protein content in several types of plant feed materials using a hybrid near infrared spectroscopy model. PLoS ONE 2016, 11, e0163145. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, S.L.; Vasconcellos, R.S.; Rossi, R.M.; Cambito de Paula, V.R.; Fachinello, M.R.; Díaz-Huepa, L.M.; Pozza, P.C. Using near infrared spectroscopy to predict metabolizable energy of corn for pigs. Sci. Agric. 2018, 75, 486–493. [Google Scholar] [CrossRef] [Green Version]
- Samadin, S.; Amiruddin, A.W.; Munawar, A.A. Rapid and simultaneous determination of feed nutritive values by means of near infrared spectroscopy. Trop. Anim. Sci. J. 2018, 41, 121–127. [Google Scholar] [CrossRef] [Green Version]
- Karayilanli, E.; Cherney, J.H.; Sirois, P.; Kubinec, D.; Cherney, D.J.R. Botanical composition prediction of alfalfa-grass mixtures using NIRS: Developing a robust calibration. Crop Sci. 2016, 56, 3361–3366. [Google Scholar] [CrossRef]
- Andueza, D.; Picard, F.; Dozias, D.; Aufrère, J. Fecal near-infrared reflectance spectroscopy prediction of the feed value of temperate forages for ruminants and some parameters of the chemical composition of feces: Efficiency of four calibration strategies. Appl. Spectros. 2017, 71, 2164–2176. [Google Scholar] [CrossRef]
- Parrini, S.; Acciaioli, A.; Crovetti, A.; Bozzi, R. Use of RT-NIRS for determination of chemical components and nutritional value of natural pasture. Ital. J. Anim. Sci. 2017, 17, 87–91. [Google Scholar] [CrossRef] [Green Version]
- Comandini, P.; Verardo, V.; Maiocchi, P.; Caboni, M.F. Accelerated oxidation: Comparative study of a new reactor with oxidation stability instrument. Eur. J. Lipid Sci. Technol. 2009, 111, 933–940. [Google Scholar] [CrossRef]
- Tinello, F.; Lante, A.; Bernardi, M.; Cappiello, F.; Galgano, F.; Caruso, M.C.; Favati, F. Comparison of OXITEST and RANCIMAT methods to evaluate the oxidative stability in frying oils. Eur. Food Res. Technol. 2017, 244, 747–755. [Google Scholar] [CrossRef]
- Amato, M.; Caruso, M.C.; Guzzo, F.; Galgano, F.; Commisso, M.; Bochicchio, R.; Labella, R.; Favati, F. Nutritional quality of seeds and leaf metabolites of Chia (Salvia hispanica L.) from Southern Italy. Eur. Food Res. Technol. 2015, 244, 747–755. [Google Scholar] [CrossRef]
- Claus, T.; Palombini, S.V.; Carbonera, F.; Figueiredo, I.L.; Matsushita, M.; Visentainer, J.V. Response surface methodology applied in the study of emulsion formulations in the presence of leaves of rosemary (Rosmarinus officinalis L.) as a source of natural antioxidants. J. Braz. Chem. Soc. 2015, 26, 2097–2104. [Google Scholar]
- Riciputi, Y.; Caboni, M.F. Assessing oil oxidative stability in Tarallini by OXITEST®. Ital. J. Food Sci. 2017, 29, 63–73. [Google Scholar]
- Morina, R.; Hyseni, B.; Musaj, A. Effects of nitrates and chilli peppers on stability of meat products. Albanian J. Agric. Sci. 2017, 2017, 81–84. [Google Scholar]
- Marzocchi, S.; Caboni, M.F. Study of the effect of tyrosyl oleate on lipid oxidation in a typical Italian bakery product. J. Agric. Food Chem. 2018, 66, 12555–12560. [Google Scholar] [CrossRef]
- Shan, Q.; Wang, M.; Tian, J.; Hu, L.; Ren, S.; Chen, J.; Ye, X.; Liu, D. Effects of Chinese pickled and dried mustard on nutritional quality, sensory quality, and shelf life of steamed pork belly. Food Sci. Nutr. 2018, 6, 747–756. [Google Scholar] [CrossRef]
- Thanomwongwatana, S. Applications of phenolic extracts from tamarid seed husk to inhibit the formation of antioxidants in animal feeds. In The First International Conference of Food and Agriculture; IOP Publishing Ltd.: Bristol, UK, 2018; pp. 222–227. [Google Scholar]
- Dordoni, R.; Cantaboni, S.; Spigno, G. Walnut paste: Oxidative stability and effect of grape skin extract addition. Heliyon 2019, 5, e02506. [Google Scholar] [CrossRef] [Green Version]
- Karadag, A. The effects of surfactants on the oxidation of sunflower oil in emulsions. Int. J. Food Technol. Nutr. 2019, 2, 20–24. [Google Scholar]
- Oleynikov, V.V. Antioxidant and antimicrobial properties of oregano extract (Origani vulgaris herba L.). Foods Raw Mater. 2020, 8, 84–90. [Google Scholar] [CrossRef]
- Romeo, R.; De Bruno, A.; Imeneo, V.; Piscopo, A.; Poiana, M. Impact of stability of enriched oil with phenolic extract from olive mill wastewaters. Foods 2020, 8, 856. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.-Q.; Xu, Y.-J.; Lu, Y.-Z.; Li, L.-Q.; Lan, X.-Z.; Zhong, Z.-C. Study on the fatty acids, aromatic compounds and shelf life of Paeonia ludlowii kernel oil. J. Oleo Sci. 2020, 9, 1001–1009. [Google Scholar] [CrossRef]
- Manzocco, L.; Romano, G.; Calligaris, S.; Nicoli, M.C. Modeling the effects of the oxidation status of the ingredient oil on the stability and shelf life of low-moisture bakery products: The case study of crackers. Foods 2020, 9, 749. [Google Scholar] [CrossRef]
- Picó, Y. Mass spectrometry in Food Quality and Safety: An overview of the current status. Compr. Anal. Chem. 2015, 68, 3–76. [Google Scholar]
- Sun, H.; Wang, P.; Li, H.; Li, Y.; Zheng, S.; Matsiko, J.; Hao, Y.; Zhang, W.; Wang, D.; Zhang, Q. Determination of PCDD/Fs and dioxin-like PCBs in food and feed using gas chromatography-triple quadrupole mass spectrometry. Sci. China Chem. 2017, 60. [Google Scholar] [CrossRef]
- Franchina, F.A.; Lazzari, E.; Scholl, G.; Focant, J.-F. Assessment of a new GC-MS/MS system for the confirmatory measurement of PCDD/Fs and (N)-DL-PCBs in food under EU Regulation. Foods 2019, 8, 302. [Google Scholar] [CrossRef] [Green Version]
- Galani, J.H.Y.; Houbraken, M.; Wumbei, A.; Djeugap, J.F.; Fotio, D.; Spanoghe, P. Evaluation of 99 pesticide residues in major agricultural products from the Western Highlands Zone of Cameroon using QuEChERS method extraction and LC-MS/MS and GC-ECD analyses. Foods 2018, 7, 184. [Google Scholar] [CrossRef] [Green Version]
- Hengel, M.J.; Wong, J.W.; Redman, Z.C.; Rering, C.; Williams, K.L. Analysis of pesticides in plant foods by QuEChERS and Gas Chromaotgraphy-Mass Spectrometry: An undergraduate laboratory experiment. J. Chem. Educ. 2020, 97, 226–233. [Google Scholar] [CrossRef]
- Bernaldo de Quirós, A.; Sendón, R.; Cardama, A.L.; García Ibarra, V. Food Contamination by Packaging, Migration of Chemicals from Food Contact Materials, 1st ed.; De Gruyter: Berlin, Germany, 2019; pp. 1–166. [Google Scholar]
- Stein, S. Mass spectral reference libraries: An ever-expanding resource for chemical identification. Anal. Chem. 2012, 84, 7274–7282. [Google Scholar] [CrossRef]
- Wallace, W.E.; Ji, W.; Tchekhovskoi, D.V.; Phinney, K.W.; Stein, S.E. Mass spectral library quality assurance by inter-library comparison. J. Am. Soc. Mass Spectrom. 2017, 28, 733–738. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schmidt, C.; Jaros, D.; Rohm, H. Ion mobility spectrometry as a potential tool for flavor control in chocolate manufacture. Foods 2019, 8, 460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradley, M.A.; Barst, B.D.; Basu, N. A review of mercury bioavailability in humans and fish. Int. J. Environ. Res. Public Health 2017, 14, 169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimáková, T.; Kuzmová, L.; Nevolná, Z.; Bencko, V. Fish and fish products as risk factors of mercury exposure. Ann. Agric. Environ. Med. 2018, 25, 488–493. [Google Scholar] [CrossRef] [Green Version]
- Yin, Y.G.; JingFu, L.; GuiBin, J. Recent advances in speciation analysis of mercury, arsenic and selenium. Toxic Metal Poll. 2013, 58, 150–161. [Google Scholar] [CrossRef] [Green Version]
- Amde, M.; Yin, Y.; Zhang, D.; Liu, J. Methods and recent advances in speciation analysis of mercury chemical species in environmental samples: A review. Chem. Speciat. Bioavailab. 2016, 28, 51–65. [Google Scholar] [CrossRef] [Green Version]
- Jung, S.A.; Chung, D.; On, J.; Moon, M.H.; Lee, J.; Pyo, H. Correlation between total mercury and methyl mercury-In whole blood of South Korean. Bull. Korean Chem. Soc. 2013, 34, 1101–1107. [Google Scholar] [CrossRef] [Green Version]
- Watanabe, T.; Kikuchi, H.; Matsuda, R.; Hayashi, T.; Akaki, K.; Teshima, R. Performance evaluation of an improved GC-MS method to quantify methylmercury in fish. Food Hyg. Saf. Sic. 2015, 56, 69–73. [Google Scholar] [CrossRef] [Green Version]
- León-Pérez, D.E.; Muñoz-Jiménez, A.M.; Jiménez-Cartagena, C. Determination of mercury species in fish and seafood by gas chromatography-mass spectrometry: Validation study. Food Anal. Methods 2015, 8, 2383–2391. [Google Scholar] [CrossRef]
- Li, J.; He, Q.; Wu, L.; Sun, J.; Zheng, F.; Li, L.; Liu, W.; Liu, J. Ultrasensitive speciation of mercury in waters by headspace solid-phase microextraction coupled with gas chromatography-triple quadrupole mass spectrometry. Microchem. J. 2020, 153, 104459. [Google Scholar] [CrossRef]
- Zhu, S.; Chen, B.; He, M.; Huang, T.; Hu, B. Speciation of mercury in water and fish samples by HPLC-ICP-MS after magnetic solid phase extraction. Talanta 2017, 171, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Londonio, A.; Hasouka, P.E.; Pacheco, P.; Gil, R.A.; Smichowski, P. Online solid phase extraction-HPLC-ICP-MS system for mercury and methylmercury preconcentration using functionalised carbon nanotubes for their determination in dietary supplements. J. Anal. At. Spectrom. 2018, 33, 1737–1744. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Liu, C.; Guo, Y.; Deng, T. Speciation analysis of trace arsenic, mercury, selenium and antimony in environmental and biological samples based on hyphenated techniques. Molecules 2019, 24, 926. [Google Scholar] [CrossRef] [Green Version]
- Nevado, J.J.B.; Martín-Doimeadios, R.C.R.; Krupp, E.M.; Bernardo, F.J.G.; Fariñas, N.R.; Moreno, M.J.; Wallace, D.; Ropero, M.J.P. Comparison of gas chromatographic hyphenated techniques for mercury speciation analysis. J. Chromatogr. A 2011, 1218, 4545–4551. [Google Scholar] [CrossRef] [PubMed]
- Carrasco, L.; Vassileva, E. Determination of methylmercury in marine biota samples: Method validation. Talanta 2014, 122, 106–114. [Google Scholar]
- Liu, M.; Liu, J.; He, C.; Song, H.; Liu, Y.; Zhang, Y.; Wang, Y.; Guo, J.; Yang, H.; Su, X. Characterization and comparison of key aroma-active compounds of cocoa liquors from five different areas. Int. J. Food Prop. 2017, 20, 2396–2408. [Google Scholar] [CrossRef] [Green Version]
- da Veiga Moreira, I.; de Figuereido Vivlela, L.; Santos, C.; Lima, N.; Schwan, F.R. Volatile compounds and protein profiles analyses of fermented cocoa beans and chocolates from different hybrids cultivated in Brazil. Food Res. Int. 2018, 109, 196–203. [Google Scholar] [CrossRef]
- Alasti, F.M.; Asefi, N.; Maleki, R.; SeiiedlouHeris, S.S. Investigating the flavor compounds in the cocoa powder production process. Food Sci. Nutr. 2019, 7, 3892–3901. [Google Scholar] [CrossRef] [Green Version]
- Clark, C.; Bettenhausen, H.M.; Heuberger, A.L.; Miller, J.; Yao, L.; Stone, M. Effects of time and temperature during melanging on the volatile profile of dark chocolate. Sci. Rep. 2020, 10, 14922. [Google Scholar] [CrossRef]
- Hamdan, A.B.; Riaty, C.; Fitriya, W.; Ekantari, N. Effects of nanoencapsulated carotenoid of Spirulina platensis on the sensory profiles of dark and milk chocolate. E3S Web. Conf. 2020, 147, 03022. [Google Scholar] [CrossRef] [Green Version]
- Cortés-Herrera, C.; Artavia, G.; Leiva, A.; Granados-Chinchilla, F. Liquid Chromatography Analysis of Common Nutritional Components in Feed and Foods. Foods 2019, 8, 1. [Google Scholar] [CrossRef] [Green Version]
- Rojas-Garbanzo, C.; Gleichenhagen, M.; Heller, A.; Esquivel, P.; Schulze-Kaysers, N.; Schieber, A. Carotenoid Profile, Antioxidant Capacity, and Chromoplasts of Pink Guava (Psidium guajava L. Cv. ‘Criolla’) during Fruit Ripening. J. Agric. Food Chem. 2017, 65, 3737–3747. [Google Scholar] [CrossRef] [PubMed]
- Erşana, S.; Berninga, J.C.; Esquivel, P.; Jiménez, V.; Carlea, R.; May, B.; Schweiggert, R.; Steingassaf, C. Phytochemical and mineral composition of fruits and seeds of wild-growing Bactris guineensis (L.) H.E. Moore palms from Costa Rica. J. Food Compos. Anal. 2020, 94, 103611. [Google Scholar]
- Dominguez, I.; Frenich, A.G.; Romero-González, R. Mass spectrometry approaches to ensure food safety. Anal. Methods 2020, 12, 1148–1162. [Google Scholar] [CrossRef]
- Bessaire, T.; Mujahid, C.; Mottier, P.; Desmarchelier, A. Multiple Mycotoxins determination in food by LC-MS/MS: An International Collaborative Study. Toxins 2019, 11, 658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leiva, A.; Méndez, G.; Rodríguez, C.; Molina, A.; Granados-Chinchilla, F. Chemical assessment of mycotoxin contaminats and veterinary residues in Costa Rican animal feed. Int. J. Food Contam. 2019, 6, 5. [Google Scholar] [CrossRef]
- Luckas, B.; Erler, K.; Krock, B. Analysis of Marine Biotoxins using LC-MS/MS. In Natural Products from Marine Algae: Methods and Protocols, Methods in Molecular Biology, 1st ed.; Stengel, D.B., Connan, S., Eds.; Springer Science+Business Media: New York, NY, USA, 2015; pp. 277–297. [Google Scholar]
- Schirone, M.; Berti, M.; Visciano, P.; Chiumiento, F.; Miglioratti, G.; Tofalo, R.; Suzzi, G.; Di Giacinto, F.; Ferri, N. Determination of lipophilic marine biotoxins in mussels harvested from Adriatic Sea by LC-MS/MS. Front. Microbiol. 2018, 9, 152. [Google Scholar] [CrossRef] [Green Version]
- Castada, H.Z.; Liu, J.; Barringer, S.A.; Huang, X. Cyanogenesis in Macadamia and direct analysis of hydrogen cyanide in Macadamia flowers, leaves, husks, and nuts using selected ion flow tube-mass spectrometry. Foods 2020, 9, 174. [Google Scholar] [CrossRef] [Green Version]
- Abbot, N.L.; Hill, K.L.; Garrett, A.; Carter, M.D.; Hamelin, E.I.; Johnson, R.C. Detection of α-, β-, and γ-amanitin in urine by LC-MS/MS using 15N10-α-amanitin as the internal standard. Toxicon 2018, 152, 71–77. [Google Scholar] [CrossRef]
- Yoshioka, N.; Hayakawa, I.; Minatani, T.; Tomozawa, J.; Akiyama, H.; Yomo, H. Quantitiative analysis of the Tricholoma ustale-derived toxin, ustalic acid, in mushroom, and food samples by LC-MS/MS. Forensic Sci. Int. 2020, 317, 110554. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Zhao, Y.; Li, H.; Zhou, S.; Chen, D.; Zhang, Y.; Yao, Q.; Sun, C. A simple and high-throughput analysis of amatoxins and phallotoxins in human plasma, serum and urine using UPLC-MS/MS combined with PRiME HLB μelution platform. Toxins 2016, 8, 128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bambauer, T.P.; Wagmann, L.; Weber, A.A.; Meyer, M.R. Analysis of α- and β-amanitin in human plasma at subnanogram per milliliter levels by reverse phase ultra-high performance liquid chromatography coupled to orbitrap mass spectrometry. Toxins 2020, 12, 671. [Google Scholar] [CrossRef]
- Gavilán, R.E.; Nebot, C.; Veiga-Gómez, M.; Roca-Saavedra, P.; Vazquez Belda, B.; Franco, C.M.; Cepeda, A. A confirmatory method based on HPLC-MS/MS for detection and quantification of residue of tetracyclines in nonmedicated feed. J. Anal. Methods Chem. 2016, 2016, 1202954. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Przeniosło-Siwczyńska, M.; Grelik, A.; Kwiatek, K. Identification and quantification of tylosin in animal feed by liquid chromatography combined with electrospray ionisation mass spectrometry. J. Vet. Res. 2020, 64, 299–304. [Google Scholar] [CrossRef]
- Van Tricht, F.; Essers, M.; Groot, M.; Sterk, S.; Blokland, M.; van Ginkel, L. A fast quantitative multi-analyte method for growth promoters in bovine meat using bead-disruption, 96-well SPE clean-up and narrow-bore UHPLC-MS/MS analysis. Food Anal. Methods 2018, 11, 2206–2217. [Google Scholar] [CrossRef] [Green Version]
- Galvão, J.A.; Yamatogi, R.S.; Biondo, A.W.; de Almeida Nogueira Pinto, J.P.; Marques Silva, J.R.; Carbonari, C.A.; Velini, E.D. Multiscreening LC-MS/MS designed for ten pesticide and six antimicrobial residues in eggs. J. Food Qual. 2017, 2017, 9718451. [Google Scholar] [CrossRef]
- Feng, Y.; Zhang, W.-J.; Liu, Y.-W.; Xue, J.-M.; Zhang, S.-Q.; Li, Z.-J. A simple, sensitive, and reliable method for the simultaneous determination of multiple antibiotics in vegetables through SPE-HPLC-MS/MS. Molecules 2018, 23, 1953. [Google Scholar] [CrossRef] [Green Version]
- Delatour, T.; Racault, L.; Bessaire, T.; Desmarchelier, A. Screening of veterinary drug residues in food by LC-MS/MS. Background and challenges. Food Addit. Contam. 2018, 35, 633–646. [Google Scholar] [CrossRef]
- Stachniuk, A. LC-MS/MS determination of pesticide residues in fruits and vegetables. In Bioactive Molecules in Food, 1st ed.; Mérillon, J.-M., Ramawat, K.G., Eds.; Springer Nature: Cham, Switzerland, 2019; pp. 2137–2161. [Google Scholar]
- Kowalska, G.; Pankiewicz, U.; Kowalski, R. Estimation of pesticide residues in selected products of plant origin from Poland with the use of the HPLC-MS/MS technique. Agriculture 2020, 10, 192. [Google Scholar] [CrossRef]
- Croote, D.; Quake, S. Food allergen detection by mass spectrometry: The role of systems biology. Syst. Biol. Appl. 2016, 2, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Pilolli, R.; De Angelis, E.; Monaci, L. Streamlining the analytical workflow for multiplex MS/MS allergen detection in processed Foods. Food Chem. 2017, 221, 1747–1753. [Google Scholar] [CrossRef]
- Jozinović, A.; Šarkanj, B.; Ačkar, U.; Balentić, J.; Šubarić, D.; Cvetković, T.; Ranilović, J.; Guberac, S.; Babić, J. Simultaneous determination of acrylamide and hydroxymethylfurfural in extruded products by LC-MS/MS method. Molecules 2019, 24, 1971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rice, J.M. The carcinogenicity of acrylamide. Mutat. Res. 2005, 580, 3–20. [Google Scholar] [CrossRef]
- Blank, I.; Robert, F.; Goldmann, T.; Pollien, P.; Varga, N.; Devaud, S.; Saucy, F.; Huynh-Ba, T.; Stadle, R.H. Mechanisms of acrylamide formation. In Chemistry and Safety of Acrylamide in Food; Springer: Berlin/Heidelberg, Germany, 2005; Volume 561, pp. 171–189. [Google Scholar]
- WHO. Health Implications of acrylamide in food Report of Joint FAO. In WHO Consultasion; WHO Headqarters: Geneva, Switzerland, 2002. [Google Scholar]
- Ofosu, I.W.; Ankar-Brewoo, G.M.; Lutterodt, H.E.; Benefo, E.O.; Menyah, C.A. Estimated daily intake and risk of prevailing acrylamide content of alkalized roasted cocoa beans. Sci. Afr. 2019, 6, e00176. [Google Scholar] [CrossRef]
- Oracz, J.; Nebesny, E.; Zyzelewiz, D. New trends in quantification of acrylamide in food products. Talanta 2011, 86, 23–34. [Google Scholar] [CrossRef]
- Kepekci, S.; Önal, C.; Önal, A. A Review of Current Methods for the Determination of Acrylamide in Food Products. Food Anal. Methods 2012, 5, 29–39. [Google Scholar] [CrossRef]
- Pan, M.; Liu, K.; Yang, J.; Hong, L.; Xie, X.; Wang, S. Review of Research into the determination of acrylamide in Foods. Foods 2020, 9, 524. [Google Scholar] [CrossRef] [PubMed]
- Eslamizada, S.; Kobarfarda, F.; Tabib, K.; Yazdanpanaha, H.; Salamzadeha, J. Development of a sensitive and rapid method for determination of acrylamide in bread by LC-MS/MS and analysis of real samples in Iran IR, Iranian. J. Pharm. Res. 2020, 19, 413–423. [Google Scholar]
- Chen, Y.H.; Xia, E.Q.; Xu, X.R.; Ling, W.H.; Li, S.; Wu, S.; Li, H. Evaluation of acrylamide in food from China by a LC/MS/MS Method. Int. J. Environ. Res. Public Health 2012, 9, 4150–4158. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.; Moniruzzaman, M.; Hasan Razu, M. Method Development and validation for the quantification of acrylamide in potato chips and other locally available food by LC-MS/MS in Bangladesh. Food Nutr. Sci. 2019, 10, 876–892. [Google Scholar] [CrossRef] [Green Version]
- Nematollahi, A.; Kamankesh, M.; Hosseini, H.; Ghasemi, J.; Hosseini-Esfahani, F.; Mohammadi, A.; Mousavi Khaneghah, A. Acrylamide content of collected food products from Tehran’s market: A risk assessment study. Environ. Sci. Pollut. Res. 2020, 27, 30558–30570. [Google Scholar] [CrossRef] [PubMed]
- Gökmen, V.; Şenyuva, H.Z.; Acar, J.; Sarioǧlu, K. Determination of acrylamide in potato chips and crisps by high-performance liquid chromatography. J. Chromatogr. A 2005, 1088, 193–199. [Google Scholar] [CrossRef] [PubMed]
- Şenyuva, H.Z.; Gökmen, V. Interference-free determination of acrylamide in potato and cereal-based foods by a laboratory validated liquid chromatography-mass spectrometry method. Food Chem. 2006, 97, 539–545. [Google Scholar] [CrossRef]
- Rufián-Henares, J.A.; Morales, F.J. Determination of acrylamide in potato chips by a reversed-phase LC-MS method based on a stable isotope dilution assay. Food Chem. 2006, 97, 555–562. [Google Scholar] [CrossRef] [Green Version]
- Alpözen, E.; Güven, G.; Özdestan, Ö.; Üren, A. Determination Of Acrylamide In Three Different Bread Types By An In-House Validated LC-MS/MS Method. Acta Alimentaria 2015, 44, 211–220. [Google Scholar] [CrossRef] [Green Version]
- Crawford, L.M.; Wang, S.C. Comparative Study of Four Analytical Methods for the Routine Determination of Acrylamide in Black Ripe Olives. J. Agric. Food Chem. 2019, 67, 12633–12641. [Google Scholar] [CrossRef] [PubMed]
- Yaranga, R. Efecto de la Temperatura de Escaldado y Fritado en el Contenido de Acrilamida de Papa Nativa, oca y Mashua Amarilla (Tesis para Optar el Título Profesional de Ingeniera en Industrias Alimentarias). Bachelor’s Thesis, Universidad Nacional del Centro del Perú, Facultad de Ingeniería en Industrias Alimentarias, Huancayo, Perú, 2019. [Google Scholar]
- Barón, W. Acrilamida—Estudio de Consumo en Alimentos Bogotanos; Universidad Nacional de Colombia: Bogotá, Colombia, 2016. [Google Scholar]
- Weijun, Y. Direct determination of acrylamide in food by gas chromatography with nitrogen chemiluminescence detection. J. Sep. Sci. 2015, 38, 2272–2277. [Google Scholar] [CrossRef]
- Kruszewski, B.; Obiedziński, M.W. Impact of Raw Materials and Production Processes on Furan and Acrylamide Contents in Dark Chocolate. J. Agric. Food Chem. 2020, 68, 2562–2569. [Google Scholar] [CrossRef]
- Zeng, S.; Xu, T.; Wang, M.; Yang, C. Determination of acrylamide in roasted coffee by UPLC MS/MS. In 3rd International Conference on Material, Mechanical and Manufacturing Engineering; Atlantis Press: Paris, France, 2015. [Google Scholar]
- Önal, A.; Kepekci, S.; Önal, C. A review of the liquid chromatographic methods for the determination of biogenic amines in foods. Food Chem. 2013, 138, 509–515. [Google Scholar] [CrossRef]
- Neofotistos, A.; Tsagkaris, A.; Danezis, G.; Proestos, C. Emerging Trends in Biogenic Amines Analysis; IntechOpen: London, UK, 2019. [Google Scholar]
- Sarkadi, L. Amino acids and biogenic amines as food quality factors. Pure Appl. Chem. 2019, 91, 289–300. [Google Scholar] [CrossRef]
- Ruiz-Capillas, C.; Herrero, A. Impact of Biogenic Amines on Food Quality and Safety. Foods 2019, 8, 62. [Google Scholar] [CrossRef] [Green Version]
- Sentellas, S.; Nuúñez, O.; Saurina, J. Recent Advances in the Determination of Biogenic Amines in Food Samples by (U)HPLC. J. Agric. Food Chem. 2016, 64, 7667–7678. [Google Scholar] [CrossRef] [Green Version]
- Munir, M.; Badri, K. The importance of derivatizing reagent in chromatography applications for biogenic amine detection in food and beverages. J. Anal. Methods Chem. 2020. [Google Scholar] [CrossRef]
- Weremfo, A.; Kodjo, M.; Gyimah, H.; Abassah-Oppong, S. Monitoring the Levels of Biogenic Amines in Canned Fish Products Marketed in Ghana. J. Food Qual. 2020. [Google Scholar] [CrossRef]
- Smělá, D.; Pechová, P.; Komprda, T.; Kjejdus, B.; Kubán, V. Liquid Chromatographic determination of biogenic amines in meat product during fermentation and long-term storage. Czech J. Food Sci. 2003, 21, 167–175. [Google Scholar] [CrossRef]
- Yoon, H.; Park, J.; Choi, A.; Hwang, H.; Mah, J. Validation of an HPLC Analytical Method for Determination of Biogenic Amines in Agricultural Products and Monitoring of Biogenic Amines in Korean Fermented. Agric. Prod. Toxicol. Res. 2015, 31, 299–305. [Google Scholar] [CrossRef] [PubMed]
- Moracanin, S.; Stefanovic, S.; Radicevic, T.; Borovic, B.; Djukic, D. Production of biogenic amines by lactic acid bacteria isolated from Uzicka sausages. Procedia Food Sci. 2015, 5, 308–311. [Google Scholar] [CrossRef] [Green Version]
- Ekici, K.; Omer, A. The determination of some biogenic amines in Turkish fermented sausages consumed in Van. Toxicol. Rep. 2018, 5, 639–643. [Google Scholar] [CrossRef] [PubMed]
- Food and Drug Administration. Fish and Fishery Products Hazards and Controls Guidance; US Department of Health and Human Services Food and Drug Administration Center for Food Safety and Applied Nutrition: White Oak, MD, USA, 2011.
- Landete, J.; Ferrer, S.; Polo, L.; Pardo, I. Biogenic amines in wines from three Spanish regions. J. Agric. Food Chem. 2005, 4, 1119–1124. [Google Scholar] [CrossRef]
- Halász, A.; Baráth, Á.; Holzapfel, W.H. The influence of starter culture selection on sauerkraut fermentation. Z. Lebensm. Unters. Forsch. A 1999, 208, 434–438. [Google Scholar] [CrossRef]
- Papageorgiou, M.; Lambropoulou, D.; Morrison, C.; Kłodzińska, E.; Namieśnik, J.; Płotka-Wasylka, J. Literature update of analytical methods for biogenic amines determination in food and beverages. TrAC Trends Anal. Chem. 2018, 98, 128–142. [Google Scholar] [CrossRef] [Green Version]
- Mietz, J.L.; Karmas, E. Polyamine and histamine content of rockfish, salmon, lobster, and shrimp as an indicator of decomposition. J. Assoc. Off. Anal. Chem. 1978, 61, 139–145. [Google Scholar] [CrossRef]
- Hernández-Jover, T.; Izquierdo-Pulido, M.; Veciana-Nogués, M.T.; Vidal-Carou, M.C. Ion-Pair High-Performance Liquid Chromatographic Determination of Biogenic Amines in Meat and Meat Products. J. Agric. Food Chem. 1996, 44, 2710–2715. [Google Scholar] [CrossRef]
- Salazar, A.; Lozada, J. Central Composite Design to Optimizate the Derivatization Procedure for Analysis of Biogenic Amines by HPLC-UV. J. Braz. Chem. Soc. 2017, 28, 575–581. [Google Scholar] [CrossRef] [Green Version]
- Sagratini, G.; Fernández-Franzón, M.; De Berardinis, F.; Fnt, G.; Vittori, S.; Mañes, J. Simultaneous determination of eight underivatised biogenic amines in fish by solid phase extraction and liquid chromatography–tandem mass spectrometry. Food Chem. 2012, 132, 537–543. [Google Scholar] [CrossRef]
- Sirocchi, V.; Caprioli, G.; Ricciutelli, M.; Vittori, S.; Sagratini, G. Simultaneous determination of ten underivatized biogenic amines in meat by liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). J. Mass Spectrom. 2014, 49, 819–825. [Google Scholar] [CrossRef]
- Gupta, R.S.; Springston, M.R.; Warrier, B.S.; Rajesh, K.; Pongracic, J.; Holl, J.L. The prevalence, severity, and distribution of childhood food allergy in the United States. Pediatrics 2011, 128, 9–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Christofakis, M.; Xila, A. LC–MS/MS Techniques for Food Allergen testing Food Allergen Testing: Molecular, Immunochemical and Chromatographic Techniques; John Wiley & Sons: Hoboken, NJ, USA, 2014. [Google Scholar]
- Tolin, S.; Pasini, G.; Simonato, B.; Mainente, F.; Arrigoni, G. Analysis of commercial wines by LC-MS/MS reveals the presence of residual milk and egg white allergens. Food Control 2012, 28, 321–326. [Google Scholar] [CrossRef]
- Croote, D.; Braslavsky, I.; Quake, S. Addressing Complex Matrix Interference Improves Multiplex Food Allergen Detection by Targeted LC−MS/MS. Anal. Chem. 2019, 91, 9760–9769. [Google Scholar] [CrossRef]
- Yoshimitsu, M.; Kiyota, K.; Kajimura, K.; Yamano, T. Development of an LC-MS/MS-based analytical method for quantification of soybean allergen Gly m 4 in soybean grains and processed foods. Food Agric. Immunol. 2019, 30, 25–33. [Google Scholar] [CrossRef]
- Ortea, I.; Cañas, B.; Gallardo, J.M. Selected tandem mass spectrometry ion monitoring for the fast identification of seafood species. J. Chromatogr. A 2011, 1218, 4445–4451. [Google Scholar] [CrossRef] [Green Version]
- Carrera, M.; Cañas, B.; Gallardo, J.M. Rapid direct detection of the major fish allergen, parvalbumin by selected MS/MS on monitoring mass spectrometry. J. Proteom. 2012, 75, 3211–3220. [Google Scholar] [CrossRef] [Green Version]
- Colgrave, M.L.; Goswami, H.; Blundell, M.; Howitt, C.A.; Tanner, G.J. Using mass spectrometry to detect hydrolysed gluten in beer that is responsible for false negatives by ELISA. J. Chromatogr. A 2014, 1370, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Colgrave, M.L.; Byrne, K.; Blundell, M.; Howitt, C.A. Identification of barley-specific peptide markers that persist in processed foods and are capable of detecting barley contamination by LC-MS/MS. J. Proteom. 2016, 147, 169–176. [Google Scholar] [CrossRef]
- Lamberti, C.; Acquadro, E.; Corpillo, D.; Giribaldi, M.; Decastelli, L.; Garino, C.; Arlorio, M.; Ricciardi, C.; Giuffrida, M.G. Validation of a mass spectrometry-based method for milk traces detection in baked food. Food Chem. 2016, 199, 119–127. [Google Scholar]
- Sealey-Voyksner, J.; Zweigenbaum, J.; Voyksner, R. Discovery of highly conserved unique peanut and tree nut peptides by LC–MS/MS for multi-allergen detection. Food Chem. 2017, 194, 201–211. [Google Scholar] [CrossRef] [PubMed]
- Monaci, L.; Pilolli, R.; De Angelis, E.; Godula, M.; Visconti, A. Multi-allergen detection in food by micro high-performance liquid chromatography coupled to a dual cell linear ion trap mass spectrometry. J. Chromatogr. A 2014, 1358, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.; Zhu, P.; Pi, F.; Sun, C.; Sun, J.; Jia, M.; Ying, C.; Zhang, Y.; Sun, X. Development of a liquid chromatography-tandem mass spectrometry method for simultaneous detection of the main milk allergens. Food Control 2017, 74, 79–88. [Google Scholar] [CrossRef]
- New, L.S.; Schreiber, A.; Stahl-Zeng, J.; Liu, H.-F. Simultaneous analysis of multiple allergens in food products by LC-MS/MS. J. AOAC Int. 2018, 101, 132–145. [Google Scholar] [CrossRef]
- Korte, R.; Oberleitner, D.; Brockmeyer, J. Determination of food allergens by LC-MS: Impacts of sample preparation, food matrix, and thermal processing on peptide detectability and quantification. J. Proteom. 2019, 196, 131–140. [Google Scholar] [CrossRef]
- Planque, M.; Arnould, T.; Gillard, N. Food Allergen Analysis: Detection, Quantification and Validation by Mass Spectrometry; Intechopen: London, UK, 2017. [Google Scholar]
- Downs, M.; Johnson, P. Target Selection Strategies for LC-MS/MS Food Allergen Methods. J. AOAC Int. 2018, 101, 146–151. [Google Scholar] [CrossRef]
- Shefcheck, K.; Callahan, J.; Musser, S. Confirmation of Peanut Protein Using Peptide Markers in Dark Chocolate Using Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS). J. Agric. Food Chem. 2006, 54, 7953–7959. [Google Scholar] [CrossRef]
- Chassaigne, H.; Nørgaard, J.; Van Hengel, A. Proteomics-Based Approach To Detect and Identify Major Allergens in Processed Peanuts by Capillary LC-Q-TOF (MS/MS). J. Agric. Food Chem. 2007, 55, 4461–4473. [Google Scholar] [CrossRef]
- de Jager, L.S.; Perfetti, G.A.; Diachenko, G.W. Determination of coumarin, vanillin, and ethyl vanillin in vanilla extract products: Liquid chromatography mass spectrometry method development and validation studies. J. Chrom. A 2007, 1145, 83–88. [Google Scholar] [CrossRef]
- Brunschwig, C.; Collard, F.X.; Bianchini, J.-P.; Raharivelomanana, P. Evaluation of chemical variability of cured vanilla beans (Vanilla tahitensis and Vanilla planifolia). Nat. Product. Commun. 2009, 4, 1394–1400. [Google Scholar]
- Shen, Y.; Han, C.; Liu, B.; Lin, Z.; Zhou, X.; Wang, C.; Zhu, Z. Determination of vanillin, ethyl vanillin, and coumarin in infant formula by liquid chromatography-quadrupole linear ion trap mass spectrometry. J. Dairy Sci. 2014, 97, 679–686. [Google Scholar] [CrossRef]
- Lončar, M.; Jakovljević, M.; Šubarić, D.; Pavlić, M.; Služek, V.B.; Cindrić, I.; Molnar, M. Coumarins in food and methods of their determination. Foods 2020, 9, 645. [Google Scholar] [CrossRef]
- Gu, F.; Chen, Y.; Hong, Y.; Fang, Y.; Tan, L. Comparative metabolomics in vanilla pod and vanilla bean revealing the biosynthesis of vanillin during the curing process of vanilla. AMB Expr. 2017, 7, 116. [Google Scholar] [CrossRef] [Green Version]
- Busconi, M.; Lucini, L.; Soffritti, G.; Bernardi, J.; Bernando, L.; Brunschwig, C.; Lepers-Andrzejewski, S.; Raharivelomanana, P.; Fernandez, J.A. Phenolic profiling for traceability of Vanilla ×tahitensis. Front. Plant Sci. 2017, 8, 1746. [Google Scholar] [CrossRef] [Green Version]
- Santos, I.C.; Smuts, J.; Schug, K.A. Rapid profiling and authentication of vanilla extracts using gas chromatography-vacuum ultraviolet spectroscopy. Food Anal. Methods 2017, 10, 4068–4078. [Google Scholar] [CrossRef]
- Lamprecht, G.; Pichlmayer, F.; Schmid, E.R. Determination of the authenticity of vanilla extracts by stable isotope ratio analysis and component analysis by HPLC. J. Agric. Food Chem. 1994, 42, 1722–1727. [Google Scholar] [CrossRef]
- Sølvbjerg Sølvbjerg Hansen, A.-M.; Fromberg, A.; Frandsen, H.L. Authenticity an traceability of vanilla flavors by analysis of stable isotopes of carbon and hydrogen. J. Agric. Food Chem. 2014, 62, 10326–10331. [Google Scholar] [CrossRef]
- Moreno-Ley, C.M.; Hernández-Martínez, D.M.; Osorio-Revilla, G.; Tapia-Ochoategui, A.P.; Dávila-Ortiz, G.; Gallardo-Velásquez, T. Prediction of coumarin and ethyl vanillin in pure vanilla extracts using MID-FTIR spectroscopy and chemometrics. Talanta 2019, 197, 264–269. [Google Scholar] [CrossRef]
Matrix | Application | Method, Solvent | Nucleus | Frequency, MHz | Reference |
---|---|---|---|---|---|
Milk | |||||
Mammalian milk | Phospholipid fingerprinting | 1H decoupling | 31P | 400 (161) | [36] |
Skim milk | Ionic strength effect on micellar casein during membrane separation and diafiltration | 1D, D2O | 31P | 500 (202) | [37] |
UHT Milk | Authenticity | 1D and 2D, HSQC, and HMBC, D2O | 1H, 13C | 400 (100) | [38] |
Mammary gland secretory tissue and milk serum | Two goat breeds | 1D NOESY | 1H | 800 | [39] |
Milk powder | Fat content | Time-domain transverse relaxation | 1H | 9 | [40] |
Water Buffalo milk | Conventional vs. biological feeding | 1D, D2O, Carr–Purcell–Meiboom–Gill) pulse sequence | 1H, 13C, 31P | 400 (100, 161) | [41] |
Milk | Butyrate marker unknown fat blends | 1D, broadband, and inverse gate decoupling | 13C | 400 (100) | [42] |
Milk | Holstein Friesian vs. autochthonous Italian cows | 1D and 2D, DOSY, TOCSY, HSQC, HMBC | 1H, 13C | 400 (100) | [43] |
Serum, urine, and liver | Displaced abomasum in Holstein cows | 1D NOESY, D2O | 1H | 600 | [44] |
Formula milk | Organic vs. conventional production | 1D NOESY | 1H | 500 | [45] |
Commercial bovine milk | Chemical composition analysis | 1D, T1 NOESY, D2O | 1H | 700 | [46] |
Infant formula | Phospholipid fingerprinting | 1D, 1H decoupling | 31P | 400 (161) | [47] |
Goat milk | Mastitis and heat stress | 1D, D2O | 1H | 600 | [48] |
Beverages | |||||
Alcoholic beverages | Hazardous substances (diethyl phthalate or polyhexamethyleneguanidine, MeOH, ethyl carbamate) | 1D, D2O, 1.5 mol·L−1 KH2PO4 pH 7.4 | 1H | 400 | [49] |
Grape juice | Authenticity | 1D, D2O, zgpr | 1H | 400 | [50] |
Wine, beers, spirits | Alcohol content | 1D, one pulse | 1H | 45/400 | [51] |
Coconut water | Water-sugar mixtures | 1D, zgesp, | 1H | 800 | [52] |
Grape pulp | Authenticity (adulteration with apple or cashew juice) | 1D, Carr-Purcell-Meiboom-Gill pulse sequence | 1H | 15 | [53] |
Processed coffee seeds | |||||
Roasted and ground coffee | Authenticity | 1D, zg30 and ZGCPPR | 1H | 600 | [54] |
Roasted and ground coffee | Authenticity | 1D, zg30, D2O | 600 | [55] | |
Commercial coffee samples | Quality and authenticity | 1D, zg30, qNMR | 1H | 400 | [56] |
Toxins/Biological samples | |||||
Bovine blood | Aflatoxin ingestion biomarker | NOESY, D2O, and 250 mmol L−1 KH2PO4, pH 7.0 | 1H | 700 | [57] |
Dietary ingredients | |||||
Food supplements | Adulteration with phenolphthalein, sildenafil, fluoxetine, lorcaserin, orlistat, and sibutramine | Qualitative, CD3CN:D2O; qNMR: MeOD | 1H | 500 | [58] |
Food supplements | Adulteration with phenolphthalein and sibutramine | MeOD | 1H | 59.7 | [59] |
Allergens | |||||
Foods | Adulteration with peanut, (2S,4R)-N-methyl-4-9 hydroxy-L-proline (marker) | NOESY, CD3Cl, MeOD | 1H | 400/600 | [60] |
Organism/Target Gene | Primer Sequence (5′-3′) | Amplicon Size, bp | Reference |
---|---|---|---|
Single allergen analysis | |||
Bos taurus α-lactalbumin | α-LA-F: CACCCAGGCTGAACAGTTAACA α-LA-R: TCCGTAGCCCTTCAAGTCTTTC Probe: FAM-AGGTGTTCCGGGAGC-MGB | 67 | [139] |
Bos domesticus 12S rRNA gene | 916-F: GTACTACTAGCAACAGCTTA 916-R: AGACTGTATTAGCAAGAATTGGTG Probe: FAM-TCTAGAAGGATATAAAGCACCGCCAAGT-BHQ1 EUK-F: AGCCTGCGGCTTAATTTGAC EUK-R: CAACTAAGAACGGCCATGCA Probe: FAM-AGGATTGACAGATTGAG-BHQ2 18SRG-F: CTGCCCTATCAACTTTCGATGGTA 18SRG-R: TTGGATGTGGTAGCCGTTTCTCA | 121, 120, 113 | [140] |
Multiplex allergen analysis | |||
soy28k (soybean/Glycine max (L.) Merr.), 2S albumin (sesame/Sesamum indicum L.), and Ara h 1 (peanut/Arachis hypogaea L.) | Soy28k-F: CTAGAAACATTGGAAACACC Soy28k-R: ATCACATACCCTCAAGACAT Ses i 1-F: TGAGGAACGTGGACGAGAG Ses i 1-R: CCCTAGCCCTCTGGTAAACC Ara h 1-F: CCATCATTTCACCATCCACAC Ara h 1-R: CTCTCATTGCTCCTGCTACTA 18S rRNA-F: TCTGCCCTATCAACTTTCGATGGTA 18S rRNA-R: AATTTGCGCGCCTGCTGCCTTCCTT | 147, 126, and 82 | [141] |
Peanut (Ara h 1) and hazelnut/Corylus avellana L. (Cor a 1) | Ara h 1-F: AGAGGGAGATATCACCAACCCAATC Ara h 1-R: GAGTTGAAGTGTGGGAGCATCAAAG Cor a 1-F: AAAGGCCATCAAGAGCATTG Cor a 1-R: CATCGCCTTCAATCACACTG Chloroplast-F: CGGACGAGAATAAAGATAGAGT Chloroplast-R: TTTTGGGGATAGAGGGACTTG | 180, 258, 124 | [142] |
Tomato (Cyclophilin), Apple (Mdtl 1), Peach (Pru p 2.01A), and Kiwi (Pectin methylesterase inhibitor). | Pru-F: GCAACCGGAATTAGCAAC Pru-R: AAATCTTGACCCCCGTTCTC 18S rRNA-F: CGAAAGCATTTGCCAAGGAT 18S rRNA-R: CCGGAACCCAAAGACTTTGA Sola 5-F: GGAGCCAAATTCAACGATG Sola 5-R: ACGACGTGCTTTCCGTTGA Act 6-F: AAATCTGTCCCAAAACTCGC Act 6-R: TTAGCACTGGCCTGAGCTAT Mal 2-F: CTTGCCTTGCGTTTGGTGAT Mal 2-R: GGCACTGCTTCTCAAAGATCTCA | 209, 172, 146, 127, and 105 | [143] |
Wheat, buckwheat, and peanut | F: CAT GGT GGG CGT CCTC R: AAA GGC CAT AAT GCC AGC TG Probe: FAM-CGG ATG CAC TGC ITT GAT AAA G-MGB F: CGT TGC CGA GAG TCG TTC TGT TT R: CGC CAA GGA CCA CGA ACA GAA G Probe: FAM-CGG GAC GCG CTT C-MGB F: TTG GTT CAA AGA GAC GGG CTC R: CAC GAG GGT TGT TCT CGA CC Probe: FAM-ACC GCG GCA GAT GG-MGB | 64, 101, and 71 | [144] |
Matrix | Sample Treatment | Minerals Tested and Wavelengths Used (nm) | Sensibility, mg·L−1 or mg·kg−1 | Reference |
---|---|---|---|---|
Sunflower a | Microwave digestion HNO3 | Al 394.401/396.152, As 193.695/234.984, Ba 455.403/614.171, Be 234.861, Ca 393.366, 422.673, Cd 226.502/228.802, Co 340.512/345.351, Cr 357.868/425.433, Cu 324.754/327.395, Fe 259.940/ 371.993, K 766.491/769.897, La 394.910, Lu 261.542, Mg 285.213/383.829, Mn 403.076/403.307, Mo 379.825/386.410, Na 588.995/589.592, Ni 341.476/352.454, Pb 368.346/405.781, Sr 407.771/ 460.733 88, Y 371.029, V 309.311/437.923, Zn 213.857/481.053 | 0.20 × 10−4 | [156] |
Animal Feed | Microwave digestion HNO3 | Cu 324.754, Fe 259.940, Mn 257.610, and Zn 213.857 | 1.5 (Mn) to 4.1 (Fe) | [157] |
Aquaculture feed | Dry ash | Cu, Fe, Mn, Zn, K, and Na | 0.4 to 3.9 | [158] |
Biofortified yeast b | Methanesulfonic acid digestion 16 h 120 °C, heptafluorobutyric acid and K2S2O8 + NaOH/HCl/NaBH4 + NaOH (hydride formation) | SeMet and Se 196.026 | (3.80 and 7.60) × 10−4 | [159] |
Malbec wines c | Dilution HNO3 and ethanol | Sr 407.771, Rb 780.027, Mg 279.553, Ca 396.847, Na 589.592, K 769.897 | 1.0 × 10−3 | [160] |
Bread a | Wet digestion HNO3/H2O2 | Ca 393.366, Cu 324.754, Fe 371.993, K 766.491, Mg, 285.213, Mn 403.076, P 214.915, Zn 213.857 | 2.8 × 10−4 (Cu) to 7.5 (P) | [161] |
Cheese a (several varieties) | Wet digestion, HNO3 + H2O2, Cs as a suppressor | Ca 445.478, K 766.491, Mg 285.213 | 0.012 (Mg) to 0.19 (Ca) | [162] |
Wines a | Standard addition, dilution ethanol | B 249.772 | 0.08 | [163] |
Natural water | Filtrate | Al 396.152, Cd 228.802, Co 340.512, Cr 425.433, Cu 324.754, Fe 259.940, Mn 403.076, Mg 285.213, Mo 379.825, Ni 352.454, Pb 405.781, and Zn 213.857. | 0.005 | [164] |
Californian wines b | Dilution HCl/KI (reduction) | As 193.695 | 3.8 × 10−4 | [165] |
Corn a | Microwave digestion HNO3 | Ag 328.068, Al 396.152, Ba 455.403, Be 234.861, Ca 422.673, Cd 228.802, Co 340.512, Cr 324.433, Cu 324.754, Fe 259.94, Mg 383.829, Mn 403.076, Mo 386.41, Na 589.592, Ni 352.454, Pb 283.305, Tl 535.046, V 437.923, Zn 481.053 | 0.7 (Mo and Fe) to 4.3 (Ca) | [166] |
Drinking water b | None, NaBH4/HCl | As 188.979, Se 196.026/203.985, and Hg | 0.007 (Hg) to 0.04 (As) | |
Herbal tea infusions | Filtrate | Cr, Mn, Fe, Ni, Cu, Zn, Cd, Al, Pb, Co | 0.01 to 0.12 | [167] |
Henna a | Microwave digestion (HNO3/H2O2) | Al 396.15 B 249.77, Cd 228.80, Co 340.51, Cr 425.43 Cu 324.75 Fe 371.99, Mn 403.08, Mo 379.83, Ni 352.45, Pb 405.78 Sn 317.51 | 0.30 (Cu) to 8.43 (Ni) | [168] |
Carob, fig, and almond liquors | Wet (HNO3/H2O2/HCl/HClO4) and dry ash mineralization (450 °C/HNO3) | Na 588.995, K 766.491, Cu 324.754, Ca 393.366, Mg 403.076, Na 588.995, K 766.491, Fe 371.993, Zn 213.857, Mn 403.076, Cd 226.502, Pb 368.346 and P 213.618 | 0.05 (Cu) to 0.52 (Ca) | [169] |
Salmon b | Microwave digestion H2O2 + HNO3/NaBH4 Thiourea | Hg 253.652 | 0.02 | [170] |
Water a | Tetrahexylammonium bromide/4-(2-pyridylazo)-resorcinol/ ethanol/HCl | Pb 283.305, Cd 228.802, Co 345.351, Ni 305.082, Zn 213.857, and Cu 324.754 | 0.06 (Cu) to 4.9 (Cd) | [171] |
Goat cheese | Dry ash (550 °C 5 h and HCl/HNO3) | Pb 405.781, As 193.695, Cd 228.802, Al 396.152, Ca 393.366, Mg 285.213, K 766.491, 588.995, Co 340.512, Cu 324.754, Cr 425.433, Fe 371.993, Mn 403.076, Se 196.026, Zn 213.857, Ni 352.454, Sr 407.771 | 0.023 (Mn) to 100 (Na) | [172] |
Wine a | Wet digestion H2O2/HNO3 | Mn 403.076 | 0.67 × 10−4 | [173] |
Honey a | Dry ash (450 °C for 4 h) and HNO3/H2O2 | Cu 324.75, Fe 259.94, Pb 405.78, Zn 213.86, and Cd 228.80 | 0.29 to 4.5 | [174] |
Coffee, tea, cocoa | Dry ash 600 °C for 4 h and HNO3 | Mn, Cr, Fe, Cu, Zn, Pb, and Cd | <0.1 | [175] |
Related matrices | ||||
Blood b | HNO3 + H2O2/KI/NaBH4 + NaOH (hydride formation) | Sb 231.147 | 1.50 × 10−4 | [176] |
Location of Origin | Sample Treatment | Instrument used/Minerals Tested or Isotopes Used | Concentrations Found | Sensibility | Reference |
---|---|---|---|---|---|
μg·L−1 or μg·kg−1 | |||||
Latvia | Wet digestion, dilution/HNO3 + H2O2 | Al, As, Ba, Cd, Ce, Co, Cr, Ni, Pb, Rb, Sr, V | 1.15 × 103 (Al) to 1.14 × 101 (Pb) | <2 | [182] |
China | Microwave digestion, HNO3 + H2O2 | Agilent 7700x, 23Na, 24Mg, 31P, 39K, 43Ca, 55Mn, 56Fe, 63Cu, 66Zn, 85Rb, 88Sr, and 137Ba | 5.52 × 105 (K) to 9.00 × 101 (Cu) | 290 (K) to 0.2 (Mn) | [183] |
Argentina | Microwave digestion HNO3 | Dynamic reaction cell Elan, Perkin Elmer, As, Be, Ca, Cd, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, Pb, Se, Tl, U, V, Zn | 8.16 × 105 (K) to 3.00 × 101 (Cr) | <10 | [184] |
Turkey | Microwave digestion HNO3 and HNO3 + H2O2 | Agilent 7700x, 24Mg, 27Al, 44Ca, 55Mn, 56Fe, 63Cu, 66Zn, 85Rb, 88Sr, and 7Li, 51V, 52Cr, 59Co, 60Ni, 69Ga, 75As, 78Se, 101Ru, 105Pd, 111Cd, 121Sb, 125Te, 133Cs, 137Ba, 178Hf, 193Ir, 195Pt, 205Tl, 208Pb. | 1.20 × 102 (Cu) to 1.25 × 104 (Mg) and 0.6 (Tl) to 42.1 (Cr) | <1 (Mn, Cu, Zn, Rb, Sr) to 100 (Ca) and 0.2 (Tl, Sb) to 217 (Li) | [185] |
Romania | Microwave digestion HNO3 + H2O2 | Agilent 7500, Ag, Al, As, Ba, Be, Ca, Cd, Co, Cr, Cs, Cu, Fe, Ga, K, Li, Mg, Mn, Na, Ni, Pb, Rb, Se, Sr, Tl, U, V and Zn | 2.29 × 105 (K) to 1 (Tl) | 0.25 (Rb) to 118.3 (K) | [186] |
Brazil | Microwave digestion, cellulose, NH4NO3, NH4(CO3)2, NH4OH | 79Br, 127I | 5.81 × 102 to 3.84 × 103 (Br), 9.9 (I) | 34 (Br), 6.0 (I) | [187] |
Brazil | H2O2 + NH4OH/single reaction chamber system (UltraWaveTM) | ELANTM DRC II, Perkin Elmer-SCIEX, 79Br, Cl, and 127I | 2.60 × 102 to 1.51 × 103 (Br), 7.00 × 104 to 3.21 × 105 (Cl), 42 (I) | <30 (Br) 1.00 × 104 (Cl), and 5 (I) | [188] |
Turkey | Microwave digestion HNO3 + H2O2 | Agilent 7500 ce, 25Na, 27Al, 39K, 44Ca, 52Cr, 55Mn, 56Fe, 60Ni, 63Cu, 66Zn, 78Se, 111Cd, and 208Pb | 4.55 × 104 (K) to 4.56 × 101 (Mn) | <1 | [189] |
Brazil | Microwave digestion HNO3 + H2O2 | Agilent 7700x, 45Sc, 75As, 79Se, 89Y, 111Cd, 115In, 139La, 140Ce, 141Pr, 144Nd, 150Sm, 152Eu, 157Gd, 162Dy, 165Ho, 167Er, 169Tm, 173Yb, 175Lu, 208Pb, and 209Bi | 13.84 (As) to 0.04 (Yb) | 1.20 × 10−4 (Tm) to 3.1 (Pb) | [190] |
UAE | Microwave digestion, 3 mL/100 mL HNO3 | Li, Be, Ag, Cd, Sb, Hg, Tl, Bi, Th, U and Pb, Se, V, Ni, Cr, Al | 1 to 25 and 1.00 × 102 to 4.00 × 103 | <1 | [191] |
Australia and International | Wet digestion HNO3 100 °C, 2 h | Agilent 7900, Ag, Al, As, Au, B, Ba, Be, Bi, Ca, Cd, Ce, Cs, Cr, Co, Cu, Dy, Er, Eu, Fe, Ga, Gd, Ge, Hg, Hf, Ho, Rb, K, La, Li, Lu, Mg, Mn, Mo, Na, Nb, Nd, Ni, Os, P, Pb, Pd, Pt, Pr, Re, Ru, Se, Sb, Sr, Sm, Sn, Ta, Tb, Te, Th, Tl, Tm, Ti, U, V, W, Y, Yb, Zn, and Zr | 1.00 × 106 (Na) to 1.00 × 102 (Sr) | Non indicated | [192] |
Serbia | Microwave digestion HNO3 + H2O2 | As, Cu, Zn, Fe, Cd, and Pb | 3 (Cd, As) to 2.21 × 103 (Fe) | 1 (As, Cd) to 120 (Zn) | [193] |
Australia | Microwave digestion, HNO3 | Agilent 8800 Triple quad, Ag, Al, As, B, Ba, Ca, Cd, Co, Cr, Cu, Fe, Hg, K, Mg, Mn, Mo, Na, Ni, P, Pb, Sb, Se, Sn, Sr, V, and Zn | 2.5 (Hg) to 9.65 × 105 (K) | 5 (As, Hg, Pb) to 5.00 × 103 (P) | [194] |
Romania | Microwave digestion HNO3 + H2O2 | Al, As, Ba, Ca, Cd, Co, Cr, Cu, Mg, Mn, Na, Ni, K, Pb, Sr, Tl, V, and Zn | 1.90 × 105 (K) to 5 (As) | 0.50 (Sr, Pb) to 5.00 × 103 (K) | [195] |
Technique | Sample Presentation | Number of Samples | Countries | Isotopes Measured | Reference |
---|---|---|---|---|---|
Coffee | |||||
GC-C-IRMS | Roasted coffee | 34 | Colombia, Brazil, Peru | δ13C | [212] |
IRMS (on α-cellulose) | Roasted coffee | 49 | Brazil, Burundi, Colombia, Costa Rica, El Salvador, Ethiopia, Guatemala, Honduras, India, Indonesia, Kenya, Mexico, Nicaragua, Panama, Papua New Guinea, Peru, Rwanda, Tanzania, USA, Vietnam, Yemen | δ18O | [213] |
EA-P and EA-C-IRMS | Green beans | 24 | Brazil | δ13C, δ18O, δ14N | [214] |
EA-IRMS | Roasted coffee | 67 | Brazil | δ13C, δ15N, δ18O, and δ2H | [215] |
GC-C-IRMS | Green and roasted coffee | 320 | Vietnam, Brazil, Cameroon, India, El Salvador, Ethiopia | δ13C | [216] |
EA-IRMS | Green coffee | 81 | Ethiopia | δ13C, δ15N, and δ18O | [217] |
Wine and related matrices | |||||
GC-P-IRMS | Several wine varietals | 110+ | Europe | δ18O | [218] |
GC-C-IRMS | Traditional and Moscatel Sparkling wine | 36 | Brazil | δ13C-CO2 | [219] |
GC-P-IRMS | Cabernet Sauvignon, Riesling, Pinot noir, Merlot, Cabernet Gernischet, Chardonnay, Longyan, Crystal and Rose honey | 188 | China | δ18O | [220] |
SNIF-NMR-IRMS | Xynisteri, Maratheftiko, Cabernet Sauvignon, Shiraz | 76 | Cyprus | δ2H, δ13C, and δ18O | [221] |
SNIF-NMR-IRMS | White (Fiano-Verdicchio) and red (Refosco-Nero) wines | 16 | Italy | δ2H, δ13C and δ18O | [222] |
SNIF-NMR-IRMS | Balsamic vinegar must | 27 | Italy | δ2H and δ13C | [223] |
Honey | |||||
EA-IRMS | Raw and commercial | 54 | Australia, China, India, Indonesia, Iran, South Korea, China, Greece, Hungary, Macedonia, Romania, Serbia, New Zealand | δ13C | [192] |
EA- and LC-IRMS (on organic acids) | Commercial | 116 | Japan, Spain, France, New Zealand, Italy, China, Hungary, Argentina, Bulgaria, Canada, Mexico, Romania, Taiwan, USA | δ13C | [224] |
EA-IRMS | Commercial | 17 | Russia | δ13C | [225] |
Coconut water | |||||
EA-IRMS | Commercial/Industrialized | 17 | Brazil | δ13C | [211] |
Matrix | Adulterant | Technique | Markers Used | Reference |
---|---|---|---|---|
Fruit juices, nectars, or pulps | ||||
Concord Grape | Grape juice blends | FT-IR | Phenolic compound-rich fraction | [247] |
Orange | Added sugar | FT-IR | Whole spectra | [248] |
Passion fruit and guava | Water | NIR | Whole spectra | [249] |
Orange | Added sugar | FT-IR | Fructose, glucose, and sucrose | [250] |
Orange | Concentrate vs. fresh squeezed | ATR-FTIR | Whole spectra | [251] |
Grape | Apple and cashew juice | MIR/ATR-0FTIR | Whole spectra | [70,71] |
Grape, orange, peach, and passion fruit | Syrup, apple, cashew | MIR/ATR-FTIR | Whole spectra | [72] |
Guava | Sugar and water | NIR and MIR | Whole spectra | [252] |
Spirit drinks | ||||
Distilled and aged ethanol | Counterfeit alcohol/ denaturants and additives | Raman | C-C stretch at 892, C-O stretch at 1059 and 1097, and CHx bend at 1460 cm−1 | [253] |
Natural drinks | ||||
Coconut water | Sugar and water | Raman | Fructose, glucose, and sucrose at 627, 835, and 1123 cm−1 | [254] |
Meat tissue | ||||
Bovine | NaCl, phosphates, carrageenan, maltodextrin | ATR-FTIR | Whole spectra | [255] |
Bovine | Salts and carrageenan | Raman | Whole spectra | [256] |
Salmon | Water | NIR | Whole spectra | [257] |
Beef and mutton | Pork | FT-IR | Whole spectra | [258] |
Country | Matrix Tested | Application | Induction Period (h) or Shelf Life and Temperature (°C, days) | Reference |
---|---|---|---|---|
Italy | Chia seeds | Differential analysis by country | 13.01 | [268] |
Brazil | Rosemary leaves emulsion | Antioxidant capabilities | 24.45 | [269] |
Italy | Bakery snack/Tarallini | Shelf life | 20.90 (using extra virgin olive oil) | [270] |
Kosovo | Cured and fresh meats | Effect of the addition of nitrates and chili peppers | 15.11 (sausage with onions and peppers) | [271] |
Italy | Tarallini | Enrichment with Tyrosyl oleate | 25.28 | [272] |
China | Steam pork belly | Enrichment with pickled and dried mustard/Nutritional quality | Days | [273] |
Thailand | Animal feed | Addition of tamarind polyphenols | 5.42/5.43 | [274] |
Italy | Walnut paste | Enrichment with grape skin extract | 13.85 | [275] |
Turkey | Sunflower oil | Effects of surfactants on emulsions | 13.42 | [276] |
Russia | Oregano extract | Antioxidant capabilities | 0.52 | [277] |
Italy | Sunflower oil | Enrichment with polyphenols from olive mill wastewater | 17.03 | [278] |
China | God’s flower | Potential oil source | Days | [279] |
Matrix | Mercury Species | Extraction Method | Chromatographic Conditions/Ions, m/z | Concentration Range, μg·kg−1 or μg·L−1 | Reference |
---|---|---|---|---|---|
Cod, tuna, mackerel, and bonito | MeHg | Acetone, toluene, KBr, CuSO4, cysteine, HCl, NaBPh4, Na2SO4, PEG200 | Inertcap 5MS/NP | 265 to 294 (Validation data) | [295] |
Tuna, shortfin squid, blue mussel, oyster, squid, tiger prawn, crown conch, hake, and salmon | MeHg and EtHg | MeOH and KOH, copper acetate, hexane, freeze-drying | TG-5MS/292, 294, 279 (Hg2+) and 308 306, 279 | 59.46 to 497.10 and 60.08 to 510.93 | [296] |
Water | Hg2+, MeHg, and EtHg | Sodium acetate, NaBPh4, and PDMS fiber SPME | Headspace, HP-5MS | 1.2 × 10−4 to 5.0 × 10−2 | [297] |
Country | Matrix Analyzed | Pyrazine Compounds | Extraction Method | Chromatographic Conditions | Concentration Range | Reference |
---|---|---|---|---|---|---|
Papa New Guinea, Ivory Coast, Indonesia, Ghana, Cameroon | Cocoa liquors | 2,3-/2,5-/2,6-diMePy, EtPy, triMePy, 2-Et-3,5-diMePy, 3-Et-2,5-diMePy, tetraMePy, 3,5-diEt-2-MePy | Purge and Trap concentrator | DB-WAX and DB-5MS | 11.19 (triMePy/Indonesia)-532.37 (tetraMePy/Papa New Guinea) (ng/g) | [303] |
Brazil | Cocoa beans and chocolates | 2,3,5,6-tetraMePy, 2,3,5-triMePy | Maceration liquid nitrogen, SPME (DVB/CAR/PDMS) | Headspace, OV Carbonwax 20M | Qualitative | [304] |
Ivory Coast | Cocoa powder | 2,3,5,6-tetraMePy, 2-Et-3-Py, 2,5-diMePy, 2,3,5-triMePy | Water, Likens–Nickerson, hexane, Na2SO4 | HP-5 MS | 0.23–2.69 (g/100 g relative area) | [305] |
USA/Ghana | Dark chocolate | 2,6-diMePy, tetraMePy, 2,3,5-trimethyl 6-ethyl pyrazine | 10 min 60 °C, SPME (DVB/CAR/PDMS) | Headspace, DB-WAXUI Ultra Inert | Qualitative | [306] |
Indonesia | Dark and milk chocolate | 2,3-/2,5-/2,6-diMePy, triMePy, tetraMePy, 2-Et-5-MePy, MePy | 30 min 55 °C, SPME | Not indicated | 0.13 to 1.21 (g/100 g relative area) | [307] |
Matrix Tested, Allergens Analyzed or Peptide Sequence | Extraction Method/Digestion | Chromatographic Conditions/LC System | Reference |
---|---|---|---|
Single allergen approaches | |||
Soybena grains, soybean and bovine milk, soy flour, fruit and vegetable juices/Gly m 4 | Tris-HCl, shaking 1 h, centrifugation, trypsin digestion, SPE clean-up (OASIS® MCX), centrifugation Nanosep® membrane | 3200QTRAP, ESI+, AdvanceBio Peptide Map, 2.1 × 150 mm, 2.7 μm | [377] |
P. muelleri (LTNAVNEIEKR), P. borealis (SFLVWVNEEDQLR), P. monodon (AVFDQLKEK/VSSTLSSLEGELK/ TFLVWVNEEDHLR/LEEVAGKYNLQVR), L. vannamei (VSSTLSSLEGELK/TFLVWVNEEDHLR/ LEEVAGKYNLQVR), F. merguiensis (ALFDQLKDKK/TFLVWVNEEDHLR/LEEVAGKYNLQVR), F. indicus (TFLVWVNEEDQLR/LEEVAGKYNLQVR), F. notialis (VSSTLSSLEGELK/TFLVWVNEEDHLR). | Dispersion in H2O, centrifugation, sonication, desalted trypsin digests | nano-electrospray ionization (ESI)-ion trap (IT), BioBasic-18 RP 0.18 × 150 mm, SMIM, | [378] |
Fish. Parvalbumin (e.g., LFLQTFSAGAR) | Tris-HCl dispersion of muscle, centrifugation, trypsin digestion using high-intensity ultra sound | LTQ LIT (linear ion trap) ESI+, reverse phase C18 gradient ACN and H2O, SMIM, e.g., 709.36 m/z | [379] |
Beer. Gluten (hordein, glutenin, γ-secalin, γ-prolamin, and γ-gliadin) | Degassification, centrifugation, dithiotretol reduction, iodoacetamide, trypsin digestion | nanoESI+ TripleTOFTM, Zorbax300SB-C18 150 mm × 75 μm | [380] |
Cereals. Barley/Gluten (VFLQQQCSPVR) | 2-propanol and dithiotreitol 60 °C, centrifugation, iodoacetamide alkylation (prevent re-oxidation of cysteine residues), trypsin digestion | 6500 QTRAP, MRM (see reference immediately above) | [381] |
Cookies. Casein αS1 (FFVAPFPEVFGK) | NH4HCO3/(NH4)2CO3, SDS, centrifugation, trypsin | 3D ion trap ESI+, ACE C18-300 Å 250 × 1 mm, | [382] |
Multiple allergen approaches | |||
Multiple commercial products. e.g., nutter bar, protein bar, nut crisps. Roasted and native peanut and tree nuts (e.g., AHVQVVDSNGDR/SFNLDEGHALR/GTGNLELVAVR/TANDLNLLILR). | Tris-HCl, 2 h 50 °C, centrifugation trypsin digestion. | 6530 q-TOF Protein analysis Poroshell 300 2.1 × 75 mm 2.7 μm, 300–2800 m/z Peptide analysis ESI+, Poroshell 120 2.1 × 50 mm 2.7 μm, | [383] |
Cookies. Ovalbumin (EVVGSAEAGVDAASVSEEFR/GGLEPINFQTAADQAR/LTEWTSSNVMEER/YPILPEYLQCVK) for eggs, β-lactoglobulin (TPEVDDEALEK), αs-casein (YLGYLEQLLR/FFVAPFPEVFGK) for milk, β-conglycinin-α-chain (ESYFVDAQPK/TISSEDKPFNLR) for soy | Tris-HCl, G25 Sphadex, Ultrasound, Trypsin digestion and RapidigestTM as surfactant/denaturing agent | ESI+ Linear IonTrap Dual Velos ProTM, AcclaimTM PepMap 1 mm × 15 cm × 3 μm, at 0.06 mL·min−1 ACN and H2O, SRM 1004.98/844.42/799.36/761.90; 623.30; 634.36/692.87; 592.23/703.87 m/z | [384] |
Cookies, cake. α-La (VGINYWLAHK), β-Lg (LIVTQTMK/TPEVDDEALEK), αs1-CN (HQGLPQEVINENLLR/YLGYLEQLLR) | Tris-HCl, centrifugal filter, SDS-PAGE, acetylation iodoacetamide, Trypsin digestion | BEH300 C18 2.1 × 100 mm, 1.7 μm, Q-TOF ESI+ (Cooroborated by MALDI-TOF-TOF), 601.1/931.5; 601.1/654.4; 623.8/199.2; 623.8/1048.2; 634.6/249.2, 634.6/991.3 m/z, MRM | [385] |
Cookies, bread, cookie dough, salada dressing, white wine, infant formula, dark and milk chocolate, ice cream, breakfast cereal. Egg white, egg yolk, milk, peanut, hazelnut, pine nut, Brazilian nut, cashew, pecan, soy, almond. | Defat in hexane, Trizma base for deproteinization, octyl β-D-glucopyranoside, tris(2-carboxyethyl)phosphine hydrochloride, S-methyl methanethiosulfonate, CaCl2, NH4HCO3, trypsin digestion | Screening. UFLCXR, MRM, ESI+ Quantification. ExionLC AD, QTRAP 6500, IonDrive Turbo V Ion Source, MRM | [386] |
Bakery products and chocolates. Peanut Pistachio, Hazelnut, Almond, Cashew Walnut | Dispersion, trypsin digestion, C18 SPE | QTRAP 6500, IonDriveTM Tubo V ESI+, Phenomenex Kinetex, 2.6 μm, C18, 100 × 2.1 mm at 0.3 mL·min−1 ACN and H2O, MRM | [387] |
Food Product | Country | Target Compounds | LC System | Chromatographic Conditions | Concentrations Found, mg·mL−1 or mg·g−1 | Reference |
---|---|---|---|---|---|---|
Vanilla extracts | USA, Mexico, Peru, Dominican Republic | Coumarin Vanillin 3′,4′-(methylenedioxy)acetophenone (as IS) Ethyl vanillin | LC-UV-MS, ESI+ SIM, 147, 153, 165, 167 m/z, λ = 254 nm | Luna 5 μm ODS C18 250 × 2.0 mm, 0.25 mL·min−1, isocratic elution ACN and H2O | Vanillinauthenthic = 1.12–1.61 Vanillinartifical = 1.95–8.59 Ethyl vanillinartifical = 0.33–0.65 | [392] |
V. planifolia J. W. Moore and V. tahitensis G. Jackson cured beans | Mexico, Reunion Island India, Costa Rica, Madagascar, Papa New Guinea, French Polynesia | p-hydroxybenzyl alcohol, protocatechuic acid, vanillyl alcohol, protocatechualdehyde, p-hydroxybenzoic acid, vanillic acid, p-hydroxybenzaldehyde, isovanillin, vanillin, anisyl alcohol, methyl p-hydroxybenzoate, anisic acid, anisaldehyde, methyl anisate | LC-UV-MS, ESI+ SIM, 147, 153, 165, 167 m/z, λ = 260 nm | λ = 260 and 280 nm, Superspher 100 RP C18, 250 × 4 mm, 4μm | V. planifolia 1.7–3.6 dwb; V. tahitensis 1.0–2.0 dwb | [393] |
Infant Formula | China | Coumarin Vanillin Ethyl vanillin vanillin-13C6 and coumarin-D4 | LC-QqLIT-MS 153.0, 167.0, 147.0 m/z | Waters XSelect HSS T3 150 × 2.1 mm and 3.5–μm, gradient ACN and H2O | Vanillin = 0.0023 to 0.71 | [394] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Artavia, G.; Cortés-Herrera, C.; Granados-Chinchilla, F. Selected Instrumental Techniques Applied in Food and Feed: Quality, Safety and Adulteration Analysis. Foods 2021, 10, 1081. https://0-doi-org.brum.beds.ac.uk/10.3390/foods10051081
Artavia G, Cortés-Herrera C, Granados-Chinchilla F. Selected Instrumental Techniques Applied in Food and Feed: Quality, Safety and Adulteration Analysis. Foods. 2021; 10(5):1081. https://0-doi-org.brum.beds.ac.uk/10.3390/foods10051081
Chicago/Turabian StyleArtavia, Graciela, Carolina Cortés-Herrera, and Fabio Granados-Chinchilla. 2021. "Selected Instrumental Techniques Applied in Food and Feed: Quality, Safety and Adulteration Analysis" Foods 10, no. 5: 1081. https://0-doi-org.brum.beds.ac.uk/10.3390/foods10051081