Comparative Effects of Flaxseed Sources on the Egg ALA Deposition and Hepatic Gene Expression in Hy-Line Brown Hens
Abstract
:1. Introduction
2. Material and Methods
2.1. Bird Management
2.2. Diet Preparation
2.3. Flock Performance
2.4. Egg Quality and Fatty Acid Profile
2.5. Serum Biochemical Profile
2.6. RNA Extraction and Reverse Transcription
2.7. Statistical Analysis
3. Results
3.1. Performance
3.2. Egg Quality
3.3. Serum Lipid Metabolites
3.4. Fatty Acid Profile of Egg (mg/g)
3.5. Hepatic Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Francis, A.A.; Deniset, J.F.; Austria, J.A.; Lavalleé, R.K.; Maddaford, G.G.; Hedley, T.E.; Dibrov, E.; Pierce, G.N. Effects of dietary flaxseed on atherosclerotic plaque regression. Am. J. Physiol. Circ. Physiol. 2013, 304, H1743–H1751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, G.Y.; Simonyi, A.; Fritsche, K.L.; Chuang, D.Y.; Hannink, M.; Gu, Z.; Greenlief, C.M.; Yao, J.K.; Lee, J.C.-M.; Beversdorf, D.Q. Docosahexaenoic acid (DHA): An essential nutrient and a nutraceutical for brain health and diseases. Prostaglandins Leukot. Essent. Fat. Acids 2018, 136, 3–13. [Google Scholar] [CrossRef] [PubMed]
- Ehr, I.J.; Persia, M.E.; Bobeck, E.A. Comparative omega-3 fatty acid enrichment of egg yolks from first-cycle laying hens fed flaxseed oil or ground flaxseed. Poult. Sci. 2017, 96, 1791–1799. [Google Scholar] [CrossRef] [PubMed]
- Lei, B.; Li-Chan, E.C.Y.; Oomah, B.D.; Mazza, G. Distribution of Cadmium-Binding Components in Flax (Linum usitatissimum L.) Seed. J. Agric. Food Chem. 2003, 51, 814–821. [Google Scholar] [CrossRef] [PubMed]
- Shahid, M.S.; Wu, Y.; Xiao, Z.; Raza, T.; Dong, X.; Yuan, J. Duration of the flaxseed diet promotes deposition of n-3 fatty acids in the meat and skin of Peking ducks. Food Nutr. Res. 2019, 63. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Wang, Y.; Yin, D.; Shahid, M.S.; Yuan, J. Flaxseed diet caused inflammation by altering the gut microbiota of Peking ducks. Anim. Biotechnol. 2020, 31, 520–531. [Google Scholar] [CrossRef] [PubMed]
- Scheideler, S.E.; Froning, G.W. The Combined Influence of Dietary Flaxseed Variety, Level, Form, and Storage Conditions on Egg Production and Composition among Vitamin E-Supplemented Hens. Poult. Sci. 1996, 75, 1221–1226. [Google Scholar] [CrossRef]
- Bean, L.D.; Leeson, S. Long-term effects of feeding flaxseed on performance and egg fatty acid composition of brown and white hens. Poult. Sci. 2003, 82, 388–394. [Google Scholar] [CrossRef]
- Westbrook, L.A.; Cherian, G. Egg quality, fatty-acid composition and gastrointestinal morphology of layer hens fed whole flaxseed with enzyme supplementation. Br. Poult. Sci. 2019, 60, 146–153. [Google Scholar] [CrossRef]
- Shahid, M.S.; Wu, Y.Q.; Guo, X.R.; Raza, T.; Wang, Y.L.; Nie, W.; Yuan, J.M. The Effect of Multi-Carbohydrase Enzymes with Corn-Flaxseed or Wheat-Flaxseed Diets on Egg n-3 Deposition, Fatty Acids Metabolism, Absorption and Transport in the Laying Hens. Austin J. Nutr. Metab. 2020, 7, 1089. [Google Scholar]
- Parveen, R.; Khan, M.I.; Anjum, F.M.; Sheikh, M.A. Investigating potential roles of extruded flaxseed and α-tocopherol acetate supplementation for production of healthier broiler meat. Br. Poult. Sci. 2016, 57, 566–575. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Baurhoo, B.; Mustafa, A.F. Effects of feeding extruded flaxseed on layer performance, total tract nutrient digestibility, and fatty acid concentrations of egg yolk, plasma and liver. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1365–1374. [Google Scholar] [CrossRef] [PubMed]
- Kanakri, K.; Carragher, J.; Hughes, R.J.; Muhlhausler, B.S.; Gibson, R. A reduced cost strategy for enriching chicken meat with omega-3 long chain polyunsaturated fatty acids using dietary flaxseed oil. Br. Poult. Sci. 2017, 58, 283–289. [Google Scholar] [CrossRef] [PubMed]
- Lamas, A.; Anton, X.; Miranda, J.M.; Roca-Saavedra, P.; Cobas, A.C.; Rodriguez, J.; Franco, C.M.; Cepeda, A. Technological development of functional egg products by an addition ofn-3 polyunsaturated-fatty-acid-enriched oil. CyTA J. Food 2016, 14, 289–295. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Shi, H.; Liu, W.; Wang, Y.; Wang, Q.; Li, H. Differential expression of L-FABP and L-BABP between fat and lean chickens. Genet. Mol. Res. 2013, 12, 4192–4206. [Google Scholar] [CrossRef] [PubMed]
- Mirshekar, R.; Boldaji, F.; Dastar, B.; Yamchi, A.; Pashaei, S.; Reza, M.; Fathollah, B.; Behrouz, D.; Ahad, Y.; Somayeh, P. Longer consumption of flaxseed oil enhances n-3 fatty acid content of chicken meat and expression of FADS2 gene. Eur. J. Lipid Sci. Technol. 2015, 117, 810–819. [Google Scholar] [CrossRef]
- Goldberg, I.J.; Eckel, R.H.; Abumrad, N.A. Regulation of fatty acid uptake into tissues: Lipoprotein lipase- and CD36-mediated pathways. J. Lipid Res. 2008, 50, S86–S90. [Google Scholar] [CrossRef] [Green Version]
- Jump, D.B.; Botolin, D.; Wang, Y.; Xu, J.; Christian, B.; Demeure, O. Fatty Acid Regulation of Hepatic Gene Transcription. J. Nutr. 2005, 135, 2503–2506. [Google Scholar] [CrossRef]
- Kersten, S. Integrated physiology and systems biology of PPARα. Mol. Metab. 2014, 3, 354–371. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Poultry; The National Academies Press: Washington, DC, USA, 1994. [Google Scholar]
- Christie, W.W. Preparation of ester derivatives of fatty acids for chromatographic analysis. Adv. Lipid Methodol. 1993, 2, e111. [Google Scholar]
- Shin, J.; Kim, J.; Goo, D.; Han, G.; Pitargue, F.; Kang, H.; Kil, D.Y. Effect of dietary supplementation of betaine on productive performance, egg quality and jejunal tight junction-related gene expression in laying hens raised under hot environmental conditions. Livest. Sci. 2018, 214, 79–82. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- SPSS. SPSS Base 20.0; SPSS Inc.: Chicago, IL, USA, 2010. [Google Scholar]
- Rodríguez, M.L.; Alzueta, C.; Rebolé, A.; Ortiz, L.T.; Centeno, C.; Treviño, J. Effect of inclusion level of linseed on the nutrient utilisation of diets for growing broiler chickens. Br. Poult. Sci. 2001, 42, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, F.I.L. Performance and Fatty Acid Composition of Adipose Tissue, Breast and Thigh in Broilers Fed Flaxseed: A Review. Curr. Res. Nutr. Food Sci. J. 2013, 1, 103–114. [Google Scholar] [CrossRef]
- Esonu, B.O.; Udedibie, A.B.I. The effect of replacing maize with cassava peel meal on the performance of weaner rabbits fed diets containing cassava root, peel and seviate. Niger. J. Anim. Prod. 1993, 9, 8185. [Google Scholar]
- Mridula, D.; Barnwal, P.; Singh, K.K. Screw pressing performance of whole and dehulled flaxseed and some physico-chemical characteristics of flaxseed oil. J. Food Sci. Technol. 2013, 52, 1498–1506. [Google Scholar] [CrossRef] [Green Version]
- Moghadam, M.B.; Shehab, A.; Cherian, G. Production Performance, Quality and Lipid Composition of Eggs from Laying Hens Fed Heated Flaxseed with Carbohydrase Enzymes. J. Appl. Poult. Res. 2020, 29, 121–129. [Google Scholar] [CrossRef]
- Nasi, M. Enzyme supplementation of laying hen diets based on barley and oats. Biotechnology in the feed industry. In Biotechnology in the Feed Industry, Proceedings of the Alltech’s 4th Annual Symposium; Lyons, T.P., Ed.; Alltech Technical Publication: Nicholasville, KY, USA, 1988; pp. 199–204. [Google Scholar]
- Pirmohammadi, A.; Khalaji, S.; Yari, M. Effects of Linseed Expansion on its Dietary Molecular Structures, and on Broiler Chicks Digestive Enzymes Activity, Serum Metabolites, and Ileal Morphology. J. Appl. Poult. Res. 2019, 28, 997–1012. [Google Scholar] [CrossRef]
- Souza, J.; Costa, F.; Queiroga, R.; Silva, J.; Schuler, A.; Goulart, C. Fatty acid profile of eggs of semi-heavy layers fed feeds containing linseed oil. Revista Brasileira de Ciência Avícola 2008, 10, 37–44. [Google Scholar] [CrossRef] [Green Version]
- Zheng, J.-L.; Luo, Z.; Zhu, Q.-L.; Tan, X.-Y.; Chen, Q.-L.; Sun, L.-D.; Hu, W. Molecular cloning and expression pattern of 11 genes involved in lipid metabolism in yellow catfish Pelteobagrus fulvidraco. Gene 2013, 531, 53–63. [Google Scholar] [CrossRef]
- Baziz, H.A.; Geraert, P.A.; Padilha, J.C.F.; Guillaumin, S. Chronic Heat Exposure Enhances Fat Deposition and Modifies Muscle and Fat Partition in Broiler Carcasses. Poult. Sci. 1996, 75, 505–513. [Google Scholar] [CrossRef] [PubMed]
- Oscai, L.B.; Essig, D.A.; Palmer, W.K. Lipase regulation of muscle triglyceride hydrolysis. J. Appl. Physiol. 1990, 69, 1571–1577. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.-L.; Zhang, J.; Wei, L.-Q.; Zhang, W.; Nie, C. Effect of Fermented Cottonseed Meal on the Lipid-Related Indices and Serum Metabolic Profiles in Broiler Chickens. Animals 2019, 9, 930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Celebi, S.; Utlu, N. Laying Performance, Serum Lipoproteins, Cholesterol and Triglyceride of Hens as influenced by Dietary Fat Sources. J. Appl. Anim. Res. 2004, 25, 121–124. [Google Scholar] [CrossRef]
- Dyall, S.C. Long-chain omega-3 fatty acids and the brain: A review of the independent and shared effects of EPA, DPA and DHA. Front. Aging Neurosci. 2015, 7, 52. [Google Scholar] [CrossRef] [Green Version]
- Frttsche, K.L.; Cassity, N.A.; Huang, S.-C. Effect of Dietary Fats on the Fatty Acid Compositions of Serum and Immune Tissues in Chickens. Poult. Sci. 1991, 70, 1213–1222. [Google Scholar] [CrossRef]
- Urrutia, O.; Soret, B.; Insausti, K.; Mendizabal, J.A.; Purroy, A.; Arana, A. The effects of linseed or chia seed dietary supplementation on adipose tissue development, fatty acid composition, and lipogenic gene expression in lambs. Small Rumin. Res. 2015, 123, 204–211. [Google Scholar] [CrossRef]
- Tu, W.; Cook-Johnson, R.; James, M.; Mühlhäusler, B.; Gibson, R. Omega-3 long chain fatty acid synthesis is regulated more by substrate levels than gene expression. Prostaglandins Leukot. Essent. Fat. Acids 2010, 83, 61–68. [Google Scholar] [CrossRef]
- Yang, J.-H. Perfluorooctanoic acid induces peroxisomal fatty acid oxidation and cytokine expression in the liver of male Japanese medaka (Oryzias latipes). Chemosphere 2010, 81, 548–552. [Google Scholar] [CrossRef]
- Aoyama, T.; Peters, J.M.; Iritani, N.; Nakajima, T.; Furihata, K.; Hashimoto, T.; Gonzalez, F.J. Altered Constitutive Expression of Fatty Acid-metabolizing Enzymes in Mice Lacking the Peroxisome Proliferator-activated Receptor α (PPARα). J. Biol. Chem. 1998, 273, 5678–5684. [Google Scholar] [CrossRef] [Green Version]
- Gamboa-Gómez, C.; Salgado, L.M.; Gonzalez-Gallardo, A.; Ramos-Gómez, M.; Loarca-Piña, G.; Reynoso-Camacho, R. Consumption of Ocimum sanctum L. and Citrus paradisi infusions modulates lipid metabolism and insulin resistance in obese rats. Food Funct. 2014, 5, 927–935. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Monroig, Ó.; Lu, Y.; Yuan, Y.; Li, Y.; Ding, L.; Tocher, D.R.; Zhou, Q.-C. Dietary DHA/EPA ratio affected tissue fatty acid profiles, antioxidant capacity, hematological characteristics and expression of lipid-related genes but not growth in juvenile black seabream (Acanthopagrus schlegelii). PLoS ONE 2017, 12, e0176216. [Google Scholar] [CrossRef] [PubMed]
- Sanz, M.; Lopez-Bote, C.J.; Menoyo, D.; Bautista, J.M. Abdominal Fat Deposition and Fatty Acid Synthesis Are Lower and β-Oxidation Is Higher in Broiler Chickens Fed Diets Containing Unsaturated Rather than Saturated Fat. J. Nutr. 2000, 130, 3034–3037. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.-T.; Li, Y.; Nestor, K.; Velleman, S.; Mersmann, H. Expression of turkey transcription factors and acyl-coenzyme oxidase in different tissues and genetic populations. Poult. Sci. 2003, 82, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Vestergren, A.S.; Wall, H.; Trattner, S.; Pickova, J.; Ivarsson, E. Feeding steam-pelleted rapeseed affects expression of genes involved in hepatic lipid metabolism and fatty acid composition of chicken meat. Poult. Sci. 2017, 96, 2965–2974. [Google Scholar] [CrossRef] [PubMed]
Ingredients | NC | PC | FS | EFM | FSO |
---|---|---|---|---|---|
Corn | 62.3 | ||||
Wheat | 70.7 | 70.7 | 69.59 | 73.6 | |
Soybean meal | 25 | 7.9 | 7.9 | 9 | 11.8 |
Flaxseed | 10 | 10 | |||
Extruded flaxseed meal | 10 | ||||
Soybean oil | 1.4 | ||||
Flaxseed oil | 2.5 | ||||
Limestone | 9.5 | 9.4 | 9.4 | 9.4 | 9.4 |
Calcium hydro-phosphate | 1 | 0.81 | 0.8 | 0.8 | 0.82 |
Salt | 0.35 | 0.35 | 0.35 | 0.35 | 0.35 |
Choline chloride | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
Minerals | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
DL-Methionine | 0.11 | 0.13 | 0.12 | 0.12 | 0.12 |
L-Lysine | 0.36 | 0.36 | 0.37 | 0.35 | |
Vitamin | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
Phytase | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
Compound enzyme | 0.02 | 0.02 | 0.02 | ||
Zeolite powder | 0.69 | ||||
Pigment | 0.01 | 0.01 | 0.01 | 0.01 | |
Total | 100 | 100 | 100 | 100 | 100 |
Nutrient analysis | |||||
AME ((kcal kg−1) | 2740 | 2740 | 2740 | 2742 | 2740 |
Protein % | 15.99 | 15.99 | 15.99 | 16.0 | 15.94 |
Ca% | 3.91 | 3.91 | 3.91 | 3.91 | 3.91 |
Available phosphorus% | 0.26 | 0.26 | 0.26 | 0.26 | 0.26 |
Lysine % | 0.79 | 0.79 | 0.80 | 0.81 | 0.80 |
Methionine % | 0.37 | 0.38 | 0.38 | 0.38 | 0.37 |
M+C | 0.63 | 0.63 | 0.63 | 0.63 | 0.62 |
Fatty acids % | |||||
Palmitic acid C16:0 | 13.5 | 9.6 | 9.4 | 9.3 | 9.2 |
Stearic acid C18:0 | 17.60 | 13.93 | 14.03 | 13.24 | 13.32 |
Oleic acid C18:1 | 29.6 | 24.08 | 24.11 | 23.27 | 24.52 |
Linoleic acid C18:2n6 | 36.34 | 43.21 | 42.63 | 42.21 | 43.43 |
Alpha Linolenic acid n3 | 8.32 | 22.56 | 23.22 | 23.46 | 23.75 |
Primers | Primer Sequence 5′–3′ | Accession Number |
---|---|---|
FADS1 | F: GAGCCATCGGTGAGGGTTTC | XM 420557 |
R: CTCCAGTCCTTTCCTTGCGT | ||
FADS2 | F: ACTGGTGGAACCATCGTCAC | NM_001160428.2 |
R: GCAGAGGTGGGAAGATGAGG | ||
ELOV2 | F: CACCGTCGCATACCTGCTCTG | NM_001197308.1 |
R: AGGTTCTGGCACTGCAAGTTGTAG | ||
ELOV5 | F: GCGATGCGTCCTTATCTGTGGTG | NM_001199197.1 |
R: GCTGGTCTGGAAGATTGTCAGGAC | ||
LPL | F: GAC AGC TTG GCA CAG TGC AA | NM_205282.1 |
R: CAC CCA TGG ATC ACC ACA AA | ||
PPAR-α | F: AGGCCAAGTTGAAAGCAGA | NM_001001464.1 |
R: GTCTTCTCTGCCATGCACAA | ||
ACOX1 | F: CCAGTCAGCTTGGTAGAGGC | NM_001006205.1 |
R: AGTGACAGTGTGCCTCAGATG | ||
LCPT1 | F: GCCCTGATGCCTTCATTCAA | AY675193 |
R: ATTTTCCCATGTCTCGGTGA | ||
Beta-actin | R: AAATCAAGATCATTGCCCCACCT | NM_205518.1 |
F: AGGGGTGTGGGTGTTGGTAA |
Groups | p-Values | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Weeks | NC | PC | FS | EFM | FSO | Mean | Groups | Weeks | Groups × Weeks | |
Egg weight (g) | 2 | 65.54 ± 0.48 | 64.64 ± 0.59 | 64.64 ± 0.29 | 65.43 ± 0.16 | 65.99 ± 0.31 | 65.24 AB | <0.001 | <0.001 | 0.026 |
4 | 64.21 ± 0.48 | 63.59 ± 0.71 | 63.76 ± 0.29 | 64.79 ± 0.38 | 65.01 ± 0.32 | 64.27 C | ||||
6 | 64.66 ± 0.34 | 64.64 ± 0.66 | 64.42 ± 0.16 | 65.02 ± 0.40 | 64.83 ± 0.36 | 64.72 BC | ||||
8 | 65.11 ± 0.34 a | 63.95 ± 0.38 b | 64.06 ± 0.20 b | 64.86 ± 0.46 ab | 65.68 ± 0.19 a | 64.73 BC | ||||
10 | 65.86 ± 0.28 a | 64.15 ± 0.18 b | 66.06 ± 0.37 a | 66.18 ± 0.30 a | 65.83 ± 0.29 a | 65.62 A | ||||
12 | 65.87 ± 0.39 a | 63.22 ± 0.44 b | 65.88 ± 0.21 a | 65.76 ± 0.31 a | 65.93 ± 0.23 a | 65.33 AB | ||||
Mean | 65.21 AB | 64.03 C | 64.80 B | 65.34 AB | 65.54 A | |||||
Egg mass (g) | 2 | 59.41 ± 0.70 | 59.06 ± 0.87 | 57.76 ± 0.92 | 58.12 ± 0.99 | 59.2 ± 0.83 | 58.71 B | <0.001 | <0.001 | <0.001 |
4 | 60.20 ± 0.76 | 60.37 ± 1.17 | 59.42 ± 0.67 | 60.05 ± 0.40 | 60.16 ± 0.39 | 60.04 A | ||||
6 | 60.80 ± 0.86 | 59.86 ± 1.07 | 59.74 ± 0.66 | 59.38 ± 1.33 | 60.25 ± 1.03 | 60.00 A | ||||
8 | 60.94 ± 0.87 | 59.87 ± 1.01 | 60.83 ± 0.91 | 60.36 ± 0.48 | 60.57 ± 0.64 | 60.51 A | ||||
10 | 63.01 ± 0.26 a | 56.26 ± 0.25 c | 61.21 ± 0.24 b | 61.59 ± 0.63 b | 61.93 ± 0.69 ab | 60.80 A | ||||
12 | 63.64 ± 0.47 a | 54.11 ± 0.22 c | 60.94 ± 0.30 b | 61.53 ± 0.38 b | 60.99 ± 0.31 b | 60.24 A | ||||
Mean | 61.33 A | 58.25 C | 59.98 B | 60.17 B | 60.51 AB | |||||
Hen day egg production (%) | 2 | 91.19 ± 2.00 | 88.33 ± 1.63 | 92.22 ± 1.10 | 89.76 ± 2.07 | 91.67 ± 1.78 | 90.63 B | <0.001 | <0.001 | 0.119 |
4 | 94.05 ± 1.48 | 93.22 ± 0.75 | 94.28 ± 1.03 | 93.81 ± 0.77 | 94.29 ± 1.06 | 93.93 A | ||||
6 | 94.29 ± 1.57 | 93.33 ± 1.68 | 94.52 ± 1.45 | 93.69 ± 2.36 | 94.28 ± 1.61 | 94.02 A | ||||
8 | 94.52 ± 1.65 | 95.12 ± 1.16 | 95.12 ± 1.26 | 93.69 ± 2.03 | 94.52 ± 1.65 | 94.59 A | ||||
10 | 95.08 ± 0.92 b | 92.02 ± 0.38 c | 97.47 ± 0.45 a | 97.65 ± 0.38 a | 95.66 ± 0.38 b | 95.58 A | ||||
12 | 96.08 ± 0.41 b | 88.95 ± 0.74 c | 98.04 ± 0.20 a | 97.79 ± 0.34 a | 95.59 ± 0.24 b | 95.29 A | ||||
Mean | 94.20 A | 91.83 B | 95.28 A | 94.40 A | 94.34 A | |||||
Body weight gain (g) | 2 | 0.03 ± 0.01 | 0.02 ± 0.01 | 0.02 ± 0.01 | 0.03 ± 0.01 | 0.03 ± 0.01 | 0.025 B | <0.045 | <0.001 | 0.063 |
4 | 0.02 ± 0.01 | 0.1 ± 0.07 | 0.02 ± 0.01 | 0.04 ± 0.01 | 0.02 ± 0.01 | 0.039 B | ||||
6 | 0.01 ± 0.01 | 0.03 ± 0.01 | 0.02 ± 0.01 | 0.04 ± 0.01 | 0.03 ± 0.01 | 0.026 B | ||||
8 | 0.13 ± 0.03 | 0.08 ± 0.03 | 0.15 ± 0.06 | 0.05±0.02 | 0.06 ± 0.01 | 0.095 A | ||||
10 | 0.1 ± 0.01 | 0.17 ± 0.06 | 0.12 ± 0.03 | 0.09 ± 0.02 | 0.05 ± 0.01 | 0.106 A | ||||
12 | 0.03 ± 0.01 | 0.03 ± 0.01 | 0.05 ± 0.02 | 0.02 ± 0.01 | 0.02 ± 0.01 | 0.031 B | ||||
Mean | 0.53 AB | 0.73 A | 0.64 AB | 0.46 AB | 0.34 B | |||||
Feed intake (g) | 2 | 122.19 ± 2.01 | 122.36 ± 0.84 | 120.50 ± 0.54 | 120.17 ± 1.28 | 121.09 ± 0.77 | 120.86 C | <0.000 | <0.000 | 0.854 |
4 | 123.17 ± 0.73 a | 123.78 ± 0.41 a | 120.84 ± 0.23 b | 121.20 ± 0.45 b | 121.46 ± 0.64 b | 122.09 B | ||||
6 | 122.66 ± 0.45 | 123.81 ± 0.49 | 121.11 ± 0.81 | 121.95 ± 0.63 | 122.66 ± 0.83 | 122.44 AB | ||||
8 | 122.37 ± 0.54 | 123.39 ± 0.65 | 121.25 ± 0.68 | 121.29 ± 0.42 | 122.33 ± 0.84 | 122.12 B | ||||
1 | 123.94 ± 0.53 b | 125.36 ± 0.36 a | 122.36 ± 0.56 c | 122.30 ± 0.32 c | 122.78 ± 0.53 bc | 123.35 A | ||||
12 | 123.44 ± 0.85 b | 126.57 ± 0.35 a | 122.05 ± 0.48 b | 122.89 ± 0.50 b | 122.22 ± 0.55 b | 123.43 A | ||||
Mean | 122.63 B | 124.21 A | 121.35 C | 121.63 BC | 122.09 BC | |||||
feed conversion ratio (%) | 2 | 2.02 ± 0.04 | 2.07 ± 0.02 | 2.09 ± 0.03 | 2.07 ± 0.02 | 2.05 ± 0.03 | 2.06 | <0.001 | 0.078 | <0.001 |
4 | 2.05 ± 0.03 | 2.05 ± 0.05 | 2.03 ± 0.02 | 2.02 ± 0.01 | 2.02 ± 0.01 | 2.04 | ||||
6 | 2.02 ± 0.03 | 2.07 ± 0.04 | 2.03 ± 0.02 | 2.06 ± 0.05 | 2.04 ± 0.03 | 2.04 | ||||
8 | 2.01 ± 0.03 | 2.06 ± 0.03 | 2.00 ± 0.02 | 2.01 ± 0.01 | 2.02 ± 0.02 | 2.02 | ||||
10 | 1.97 ± 0.01 b | 2.23 ± 0.01 a | 2.00 ± 0.01 b | 1.99 ± 0.02 b | 1.98 ± 0.02 b | 2.03 | ||||
12 | 1.94 ± 0.02 c | 2.34 ± 0.01 a | 2.00 ± 0.01 b | 2.00 ± 0.01 b | 2.01 ± 0.01 b | 2.06 | ||||
Mean | 2.00 B | 2.14 A | 2.03 B | 2.04 B | 2.02 B |
Groups | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Weeks | NC | PC | FS | EFM | FSO | Mean | Groups | Weeks | Groups × Weeks | |
Albumen height (mm) | 4 | 7.92 ± 0.20 | 8.1 ± 0.15 | 7.89 ± 0.25 | 7.98 ± 0.15 | 7.95 ± 0.28 | 7.97 | <0.001 | 0.204 | 0.002 |
6 | 6.82 ± 0.57 b | 6.30 ± 0.31 b | 8.09 ± 0.41 a | 8.40 ± 0.37 a | 8.31 ± 0.42 a | 7.58 | ||||
8 | 7.00 ± 0.34 bc | 6.56 ± 0.38 c | 9.06 ± 0.36 a | 8.07 ± 0.39 ab | 7.99 ± 0.27 ab | 7.74 | ||||
10 | 7.62 ± 0.41 bc | 6.83 ± 0.37 c | 8.74 ± 0.25 a | 8.37 ± 0.30 ab | 8.70 ± 0.33 a | 8.05 | ||||
12 | 7.99 ± 0.23 a | 6.00 ± 0.42 b | 8.3 ± 0.36 a | 8.55 ± 0.26 a | 8.54 ± 0.42 a | 7.88 | ||||
Mean | 7.47 B | 6.76 C | 8.42 A | 8.27 A | 8.30 A | |||||
Haugh unit (AA) | 4 | 88.05 ± 1.12 | 87.63 ± 1.25 | 91.41 ± 0.54 | 87.73 ± 1.16 | 87.25 ± 1.48 | 88.41 AB | <0.001 | 0.002 | 0.240 |
6 | 93.18 ± 1.86 a | 87.13 ± 2.43 ab | 92.88 ± 2.44 a | 91.97 ± 1.86 ab | 91.74 ± 2.26 b | 91.38 A | ||||
8 | 92.58 ± 1.50 a | 82.57 ± 1.84 b | 92.41 ± 2.07 a | 92.31 ± 2.77 a | 95.03 ± 1.80 a | 90.98 A | ||||
10 | 91.9 5± 1.34 a | 83.90 ± 0.88 b | 92.41 ± 2.01 a | 91.01 ± 1.21 a | 90.93 ± 1.62 a | 90.04 AB | ||||
12 | 87.14 ± 1.17 ab | 82.91 ± 1.05 b | 88.99 ± 1.84 a | 89.83 ± 1.45 a | 89.53 ± 1.85 a | 87.68 B | ||||
Mean | 90.58 A | 84.83 B | 91.62 A | 90.57 A | 90.90 A |
Groups | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Weeks | NC | PC | FS | ESM | FSO | Mean | Groups | Weeks | Groups × Weeks | |
TC (mmol/L) | 4 | 6.75 ± 0.25 a | 4.28 ± 0.24 b | 3.12 ± 0.47 b | 3.18 ± 0.53 b | 3.27 ± 0.51 b | 4.12 A | <0.001 | 0.001 | 1.000 |
6 | 6.71 ± 0.32 a | 4.36 ± 0.29 b | 3.11 ± 0.19 c | 3.15 ± 0.18 c | 3.22 ± 0.17 c | 4.11 A | ||||
8 | 6.70 ± 0.38 a | 4.19 ± 0.36 b | 2.94 ± 0.16 c | 2.94 ± 0.16 c | 2.88 ± 0.13 c | 3.93 A | ||||
10 | 6.13 ± 0.38 a | 4.21 ± 0.34 b | 2.87 ± 0.19 c | 2.84 ± 0.21 c | 2.68 ± 0.23 c | 3.75 AB | ||||
12 | 5.97 ± 0.15 a | 3.74 ± 0.23 b | 2.57 ± 0.29 c | 2.35 ± 0.27 c | 2.29 ± 0.28 c | 3.39 B | ||||
Mean | 6.45 A | 4.16 B | 2.93 C | 2.90 C | 2.87 C | |||||
TG (mmol/L) | 4 | 17.27 ± 0.71 a | 15.43 ± 0.36 b | 13.77 ± 0.29 c | 13.88 ± 0.40 c | 13.55 ± 0.23 c | 14.78 A | <0.001 | <0.001 | 0.825 |
6 | 17.21 ± 1.01 a | 15.37 ± 0.40 b | 13.70 ± 0.32 c | 13.65 ± 0.34 c | 13.48 ± 0.36 c | 14.68 A | ||||
8 | 16.54 ± 1.05 a | 14.71 ± 0.41 a | 12.54 ± 0.55 b | 12.38 ± 0.52 b | 12.21 ± 0.57 b | 13.67 B | ||||
10 | 17.18 ± 1.65 a | 14.68 ± 0.31 b | 11.51 ± 0.51 c | 11.68 ± 0.44 c | 11.52 ± 0.34 c | 13.31 B | ||||
12 | 17.45 ± 1.29 a | 14.46 ± 0.70 b | 11.45 ± 0.44 c | 11.62 ± 0.36 c | 11.29 ± 0.44 c | 13.26 B | ||||
Mean | 17.13 A | 14.93 B | 12.64 C | 12.60 C | 12.41 C | |||||
4 | 4.38 ± 0.27 a | 3.13 ± 0.39 b | 2.88 ± 0.25 b | 2.71 ± 0.23 b | 2.65 ± 0.24 b | 3.15 | <0.001 | 0.286 | 1.000 | |
LDL-C (mmol/L) | 6 | 4.28 ± 0.30 a | 3.16 ± 0.22 b | 2.70 b ± 0.15 c | 2.61 ± 0.16 bc | 2.45 ± 0.07 c | 3.04 | |||
8 | 4.31 ± 0.33 a | 3.15 ± 0.45 b | 2.48 ± 0.29 b | 2.41 ± 0.28 b | 2.25 ± 0.16 b | 2.92 | ||||
10 | 4.25 ± 0.29 a | 3.13 ± 0.24 b | 2.41 ± 0.20 c | 2.33 ± 0.18 c | 2.17 ± 0.22 c | 2.86 | ||||
12 | 4.28 ± 0.30 a | 3.11 ± 0.34 b | 2.45 ± 0.14 bc | 2.38 ± 0.12c | 2.05 ± 0.17 c | 2.86 | ||||
Mean | 4.30 A | 3.14 B | 2.56C | 2.49 C | 2.31 C | |||||
4 | 1.12 ± 0.21 b | 2.27 ± 0.32 a | 2.85 ± 0.21 a | 2.80 ± 0.23 a | 2.71 ± 0.24 a | 2.35 | <0.001 | 0.909 | 1.000 | |
6 | 1.21 ± 0.24 b | 2.27 ± 0.24 a | 2.76 ± 0.21a | 2.60 ± 0.78 a | 2.52 ± 0.52 a | 2.27 | ||||
HDL-C (mmol/L) | 8 | 1.06 ± 0.20 b | 2.23 ± 0.15 ab | 2.89 ± 0.41 a | 2.56 ± 0.08 a | 2.28 ± 0.18 a | 2.20 | |||
10 | 1.15 ± 0.37 b | 2.31 ± 0.26 a | 2.91 ± 0.48 a | 2.58 ± 0.26 a | 2.23 ± 0.25 a | 2.24 | ||||
12 | 1.05 ± 0.21 c | 2.22 ± 0.23 b | 2.88 ± 0.23 a | 2.71 ± 0.14 ab | 2.38 ± 0.18 ab | 2.25 | ||||
Mean | 1.12 C | 2.26 B | 2.86A | 2.65 AB | 2.43 B | |||||
4 | 2.09 ± 0.22 a | 1.59 ± 0.11 b | 1.36 ± 0.05 bc | 1.31 ± 0.04 bc | 1.12 ± 0.16 c | 1.49 | <0.001 | 0.668 | 1.000 | |
VLDL-C (mmol/L) | 6 | 2.09 ± 0.21 a | 1.55 ± 0.09 b | 1.36 ± 0.10 bc | 1.31 ± 0.07 bc | 1.11 ± 0.13 c | 1.48 | |||
8 | 1.92 ± 0.17 a | 1.59 ± 0.13 ab | 1.35 ± 0.09 bc | 1.19 ± 0.08 bc | 1.02 ± 0.16 c | 1.43 | ||||
10 | 2.04 ± 0.19 a | 1.60 ± 0.09 ab | 1.41 ± 0.11 bc | 1.13 ± 0.20 bc | 0.96 ± 0.23 c | 1.41 | ||||
12 | 2.02 ± 0.18 a | 1.51 ± 0.11 b | 1.36 ± 0.12 bc | 1.02 ± 0.23 bc | 0.94 ± 0.18 c | 1.37 | ||||
Mean | 2.03 A | 1.56 B | 1.37 AB | 1.19 CD | 1.03 D | |||||
LPL (U/mL) | 4 | 442.91 ± 5.70 b | 787.34 ± 25.28 a | 815.26 ± 33.15 a | 821.92 ± 17.78 a | 815.25 ± 13.81 a | 736.54 | <0.001 | 0.848 | 0.995 |
6 | 451.99 ± 6.39 b | 782.33 ± 31.43 a | 833.92 ± 25.64 a | 798.59 ± 32.84 a | 826.92 ± 25.41 a | 738.75 | ||||
8 | 460.48 ± 12.40 b | 805.67 ± 35.74 a | 798.59 ± 16.30 a | 808.59 ± 11.68 a | 831.92 ± 25.91 a | 741.05 | ||||
10 | 452.67 ± 5.89 b | 784.00 ± 42.73 a | 793.59 ± 14.99 a | 801.92 ± 14.37 a | 795.26 ± 25.84 a | 725.48 | ||||
12 | 450.62 ± 8.66 b | 805.83 ± 47.58 a | 831.92 ± 34.34 a | 825.99 ±2 0.86 a | 792.59 ± 20.71 a | 741.39 | ||||
Mean | 451.73 B | 793.03 A | 811.40 A | 812.39 A | 814.66 A |
Groups | p-Values | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
FA | Weeks | NC | PC | FS | EFM | FSO | Mean | Groups | Weeks | Group × Weeks |
DHA | 2 | 56.68 ± 1.52 c | 83.66 ± 5.61 b | 92.33 ± 1.60 a | 96.33 ± 0.72 a | 97.33 ± 1.89 a | 85.27 C | <0.001 | <0.001 | <0.001 |
4 | 64.51 ± 3.84 d | 88.68 ± 5.44 c | 112.35 ± 2.14 b | 115.18 ± 3.18 b | 132.85 ± 2.91 a | 102.72 B | ||||
6 | 58.52 ± 2.45 d | 92.02 ± 1.45 c | 125.85 ± 4.21 b | 126.84 ± 1.70 b | 139.35 ± 4.08 a | 108.52 B | ||||
8 | 65.35 ± 1.51 d | 111.18 ± 2.43 c | 136.18 ± 3.09 b | 137.01 ± 6.22 b | 154.71 ± 5.99 a | 120.89 A | ||||
10 | 66.18 ± 3.39 d | 115.01 ± 2.50 c | 138.85 ± 2.63 b | 139.18 ± 1.92 b | 156.01 ± 9.62 a | 123.05 A | ||||
12 | 68.35 ± 0.60 d | 115.85 ± 1.97 c | 129.68 ± 4.69 b | 136.51 ± 4.82 b | 152.18 ± 6.74 a | 120.51 A | ||||
Mean | 63.26 D | 101.07 C | 122.54 B | 125.18 B | 138.74 A | |||||
2 | 1492.44 ± 1.45 a | 1312.27 ± 30.20 b | 1358.94 ± 17.85 b | 1364.27 ± 28.92 b | 1238.94 ± 81.23 b | 1353.37 A | <0.001 | <0.001 | <0.001 | |
Total n-6 | 4 | 1458.72 ± 2.36 a | 1242.04 ± 17.44 c | 1314.04 ± 34.86 b | 1259.54 ± 3.21 bc | 1092.04 ± 29.73 d | 1273.28 B | |||
6 | 1468.89 ± 10.09 a | 1049.06 ± 31.69 c | 1201.56 ± 43.33 b | 1000.05 ± 18.93 cd | 948.89 ± 32.58 d | 1133.69 C | ||||
8 | 1551.12 ± 3.65 a | 976.96 ± 31.01 b | 894.95 ± 22.58 c | 861.95 ± 2.91 c | 895.79 ± 20.71 c | 1036.16 D | ||||
10 | 1534.51 ± 3.78 a | 941.85 ± 14.95 b | 862.68 ± 33.79 b | 775.85 ± 41.15 c | 880.18 ± 19.91 b | 999.02 D | ||||
12 | 1546.18 ± 8.73 a | 934.68 ± 22.07 b | 853.68 ± 38.63 b | 770.85 ± 39.17 c | 871.18 ± 21.20 b | 995.32 D | ||||
Mean | 1508.65 A | 1076.14 B | 1080.98 B | 1005.42 C | 987.84 C | |||||
2 | 85.92 ± 0.83 c | 268.76 ± 19.70 b | 341.88 ± 8.69 a | 354.04 ± 9.00 a | 370.38 ± 5.49 a | 284.20 D | <0.001 | <0.001 | <0.001 | |
4 | 89.60 ± 2.18 c | 282.59 ± 20.02 b | 350.71 ± 5.57 a | 365.37 ± 5.90 a | 381.21 ± 12.13 a | 293.90 D | ||||
Total n-3 | 6 | 96.10 ± 0.75 c | 321.92 ± 3.41 b | 413.21 ± 14.43 a | 434.04 ± 9.09 a | 437.87 ± 18.69 a | 340.63 C | |||
8 | 104.76 ± 1.26 c | 385.92 ± 23.15 b | 457.21 ± 6.24 a | 466.71 ± 12.96 a | 474.21 ± 7.92 a | 377.76 B | ||||
10 | 114.42 ± 1.24 d | 416.76 ± 5.70 c | 533.71 ± 5.14 b | 540.37 ± 3.74 b | 570.87 ± 5.60 a | 435.23 A | ||||
12 | 117.76 ± 2.48 d | 425.10 ± 7.59 c | 542.04 ± 9.42 b | 548.71 ± 3.20 b | 578.21 ± 5.35 a | 442.36 A | ||||
Mean | 101.43 D | 350.18 C | 439.72 B | 451.54 B | 468.79 A | |||||
2 | 17.38 ± 0.17 a | 5.01 ± 0.36 b | 3.99 ± 0.11 c | 3.86 ± 0.08 c | 3.36 ± 0.24 c | 6.72 A | <0.001 | <0.001 | <0.001 | |
4 | 16.33 ± 0.41 a | 4.50 ± 0.32 b | 3.75 ± 0.08 c | 3.45 ± 0.05 cd | 2.87 ± 0.05 d | 6.18 B | ||||
6 | 15.29 ± 0.14 a | 3.26 ± 0.11 b | 2.92 ± 0.11 c | 2.31 ± 0.05 d | 2.19 ± 0.13 d | 5.19 C | ||||
n-6:n-3 | 8 | 14.82 ± 0.20 a | 2.58 ± 0.18 ab | 1.96 ± 0.05 c | 1.85 ± 0.05 c | 1.89 ± 0.08 c | 4.62 D | |||
10 | 13.42 ± 0.17 a | 2.26 ± 0.04 b | 1.62 ± 0.05 c | 1.44 ± 0.08 c | 1.54 ± 0.04 c | 4.06 E | ||||
12 | 13.16 ± 0.26 a | 2.21 ± 0.08 b | 1.58 ± 0.07 c | 1.41 ± 0.07 c | 1.51 ± 0.04 c | 3.97 E | ||||
Mean | 15.06 A | 3.30 B | 2.63 C | 2.39 D | 2.23 D |
Group | Gene Expression | |||||||
---|---|---|---|---|---|---|---|---|
ACOX1 | LCPT1 | PPAR-α | FADS1 | FADS2 | Elov2 | Elov5 | LPL | |
NC | 0.62 ± 0.06 d | 0.52 ± 0.06 d | 1.05 ± 0.01 a | 0.38 ± 0.04 d | 0.36 ± 0.04 c | 0.43 ± 0.04 d | 0.95 ± 0.10 | 0.55 ± 0.08 b |
PC | 0.91 ± 0.02 c | 0.90 ± 0.02 c | 0.84 ± 0.13 b | 0.81 ± 0.15 c | 0.74 ± 0.15 c | 0.99 ± 0.05 c | 1.00 ± 0.10 | 0.51 ± 0.10 b |
FS | 1.36 ± 0.11 b | 1.14 ± 0.04 b | 0.59 ± 0.06 c | 1.34 ± 0.06 b | 1.40 ± 0.04 b | 1.28 ± 0.05 b | 1.04 ± 0.03 | 1.15 ± 0.02 a |
FSM | 1.28 ± 0.04 b | 1.22 ± 0.04 b | 0.60 ± 0.05 c | 1.45 ± 0.10 b | 1.55 ± 0.07 b | 1.39 ± 0.09 b | 1.04 ± 0.11 | 1.08 ± 0.02 a |
FSO | 1.65 ± 0.05 a | 1.43 ± 0.05 a | 0.32 ± 0.03 d | 2.14 ± 0.12 a | 2.20 ± 0.10 a | 1.61 ± 0.08 a | 0.76 ± 0.08 | 1.18 ± 0.02 a |
p-value | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | 0.182 | <0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shahid, M.S.; Raza, T.; Wu, Y.; Hussain Mangi, M.; Nie, W.; Yuan, J. Comparative Effects of Flaxseed Sources on the Egg ALA Deposition and Hepatic Gene Expression in Hy-Line Brown Hens. Foods 2020, 9, 1663. https://0-doi-org.brum.beds.ac.uk/10.3390/foods9111663
Shahid MS, Raza T, Wu Y, Hussain Mangi M, Nie W, Yuan J. Comparative Effects of Flaxseed Sources on the Egg ALA Deposition and Hepatic Gene Expression in Hy-Line Brown Hens. Foods. 2020; 9(11):1663. https://0-doi-org.brum.beds.ac.uk/10.3390/foods9111663
Chicago/Turabian StyleShahid, Muhammad Suhaib, Tausif Raza, Yuqin Wu, Mazhar Hussain Mangi, Wei Nie, and Jianmin Yuan. 2020. "Comparative Effects of Flaxseed Sources on the Egg ALA Deposition and Hepatic Gene Expression in Hy-Line Brown Hens" Foods 9, no. 11: 1663. https://0-doi-org.brum.beds.ac.uk/10.3390/foods9111663